CN109613258A - A kind of application of ulcerative colitis biomarker and therapy target - Google Patents

A kind of application of ulcerative colitis biomarker and therapy target Download PDF

Info

Publication number
CN109613258A
CN109613258A CN201811533001.7A CN201811533001A CN109613258A CN 109613258 A CN109613258 A CN 109613258A CN 201811533001 A CN201811533001 A CN 201811533001A CN 109613258 A CN109613258 A CN 109613258A
Authority
CN
China
Prior art keywords
noc4l
ulcerative colitis
leu
mouse
application
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201811533001.7A
Other languages
Chinese (zh)
Inventor
李向东
贾力娜
任新敏
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
China Agricultural University
Original Assignee
China Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by China Agricultural University filed Critical China Agricultural University
Priority to CN201811533001.7A priority Critical patent/CN109613258A/en
Publication of CN109613258A publication Critical patent/CN109613258A/en
Pending legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A61K38/1745—C-reactive proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/06—Gastro-intestinal diseases
    • G01N2800/065—Bowel diseases, e.g. Crohn, ulcerative colitis, IBS

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Hematology (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Urology & Nephrology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biomedical Technology (AREA)
  • Epidemiology (AREA)
  • Biochemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Cell Biology (AREA)
  • Marine Sciences & Fisheries (AREA)
  • Biotechnology (AREA)
  • Pathology (AREA)
  • General Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Food Science & Technology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses the applications of a kind of ulcerative colitis biomarker and therapy target.Present invention discover that for the expression quantity of NOC4L albumen with ulcerative colitis there are correlation, NOC4L albumen can be used as ulcerative colitis biomarker in Mice Body.It has also been found that the ulcerative colitis symptom that macrophage specifically knocks out NOC4L mouse is improved, and its survival rate is higher.The present invention provides a new target spot for the newtype drug of research treatment ulcerative colitis, also provides detection target for the diagnosis of ulcerative colitis, application prospect is good.

Description

A kind of application of ulcerative colitis biomarker and therapy target
Technical field
The present invention relates to biomarkers, specifically, being related to NOC4L albumen as ulcerative colitis biomarker And the application of therapy target.
Background technique
Inflammatory bowel disease (IBD) is one group of agnogenic chronic nonspecific inflammatory bowel disease, mainly includes ulcer Property colitis (UC) and Crohn disease (CD).The disease past is common in western countries, and developing country's disease incidence is relatively low, However cause clinic as the process of industrialization, urbanization, the disease incidence of Chinese IBD show an increasing trend year by year in the past 20 years The attention of worker also deepens continuously to the research of the disease.
UC is that a kind of colon that the cause of disease is not still fully aware of and rectum chronic nonspecific inflammation disease, lesion are confined to Colorectal mucosa and submucosa.Lesion multidigit also may extend to colon descendens or even entire colon in sigmoid colon and rectum.Disease Cheng Manchang, normal recurrent exerbation.However it is directed to this problem, clinically still lack effective drug and treatment method.It is being directed to In terms of the treatment method of UC, mainly there are dietary therapy, drug therapy and operative treatment.Dietary therapy is for slight exedens knot Enteritis is effective, and the drug therapy period is long, and easily repeatedly, is also easy to produce drug resistance.Operative treatment patient suffering, stress is big, gives Body causes certain damage.The detection method of UC is mainly colonoscopy and histological examination.
Summary of the invention
In order to solve the problems in the existing technology, the object of the present invention is to provide a kind of new UC biomarker and Therapy target.
In order to achieve the object of the present invention, the application present invention firstly provides NOC4L albumen as UC biomarker.
It is higher that inventor studies expression of the discovery NOC4L in inflammatory cell, thus it is speculated that and NOC4L is related with diseases associated with inflammation, It was found that NOC4L albumen (nucleolar complex associated protein 4homologGenBank NO.NM_ 153570) expression in the colorectal carcinoma of UC mouse model is higher, sees Fig. 1.
Application the present invention also provides NOC4L albumen as UC therapy target.The amino acid sequence of the NOC4L albumen As shown in SEQ ID NO.1.
The present invention provides application of the NOC4L albumen in preparation ulcerative colitis detection kit.
It will be appreciated by those skilled in the art that the reagent containing detection NOC4L expressing quantity is exedens for detecting The kit of colitis also belongs to protection scope of the present invention.
Invention further provides the methods of detection NOC4L expressing quantity in preparation ulcerative colitis diagnosis system In application.
The present invention also provides NOC4L albumen as the application in treatment of ulcerative colitis target spot.
Further, the present invention provides NOC4L protein expression inhibitor in the drug for preparing treatment ulcerative colitis In application.
Preferably, the NOC4L protein expression inhibitor can reduce the expression quantity of NOC4L albumen.
Preferably, the NOC4L protein expression inhibitor is able to suppress the expression of NOC4L albumen or makes NOC4L albumen not Expression.
The present invention provides a kind of drug for treating ulcerative colitis, and the drug contains targeting NOC4L and can reduce The biological agent or chemicals of NOC4L expression quantity.
The present invention provides a kind of drug for treating ulcerative colitis, and the drug contains targeting NOC4L and is able to suppress The biological agent or chemicals of the expression of NOC4L.
NOC4L albumen will increase body to the neurological susceptibility of UC in the high expression of colorectal carcinoma.
Therefore the present invention provides NOC4L albumen or its expression promotor to prepare the application in UC animal model.
The beneficial effects of the present invention are: present invention discover that the expression quantity of NOC4L albumen is with UC, there are correlations, and find Expression of the NOC4L albumen in Colon and rectum reduces the symptom that can weaken UC mouse model, and improves its survival rate.It is sent out through research Existing, the mouse (KO mouse) that macrophage NOC4L is specifically knocked out and the mouse (OE mouse) that macrophage NOC4L is specifically overexpressed are luring When leading UC model, the symptom for overexpressing mouse is more serious than knocking out mouse, and survival rate is lower.The present invention is the novel medicine of research treatment UC Object provides a new target spot, also provides detection target for the diagnosis of ulcerative colitis, and application prospect is good.
Detailed description of the invention
Fig. 1 is that NCBI provided rna level expression of the NOC4L in each histoorgan of Healthy People in 2016.
Fig. 2 is the rna level expression situation of change that WT mouse induces mouse colorectal carcinoma NOC4L during UC.In figure, 0, 1,3,5 respectively refers to carry out the rna level detection of expression of NOC4L for killing mouse and taking tissue within the 0th day, the 1st day, the 3rd day, the 5th day, ties The mouse Noc4lRNA expression that fruit illustrates that health does not induce is relatively low, after starting induction, the Noc4l RNA water of mouse The flat raising having sharply.
Fig. 3 is the knockout strategy schematic diagram of KO mouse model.
Fig. 4 is OE mouse model construction strategy schematic diagram.
Fig. 5 is the situation of change that WT mouse, KO mouse and OE mouse induce weight during UC.
Fig. 6 is the death rate situation that WT mouse, KO mouse and OE mouse induce UC.
Fig. 7 is that WT mouse, KO mouse and OE mouse induce the Colon and rectum morphological result figure after UC.
Fig. 8 is that WT mouse, KO mouse and OE mouse induce the Colon and rectum statistical result after UC.
Fig. 9 is the statistical result that WT mouse, KO mouse and OE mouse induce spleen weight after UC.
Figure 10 is that WT mouse, KO mouse and OE mouse induce HE after UC to dye pathological examination figure.
Specific embodiment
The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention..If not specified, embodiment Method used is it is known in the art that biochemical reagents used in embodiment are commercially available.
Embodiment 1
About 8 weeks C57BL/6 hero mouse (purchased from Si Beifu) 30 are taken, control group and experimental group is arranged in the equal 20g or more of weight, Experimental group be drinking water in add 2.5% dextran sulfate sodium (dextran sulfate sodium, DSS) (MP company, the U.S., Article No. 0216011080), it freely drinks 5 days building UC models by mouse, observes hematochezia situation, respectively in induction the 0th day, the It kills mouse and takes tissue within 1 day, the 3rd day, the 5th day, carry out the rna level detection of expression of NOC4L, as the result is shown after DSS is induced, knot The rna expression level of the NOC4L of intestines raises, and sees Fig. 2.
Embodiment 2
It is higher that inventor studies expression of the discovery NOC4L in inflammatory cell, thus it is speculated that and NOC4L is related with diseases associated with inflammation, In order to further study NOC4L in the intracorporal effect of mouse, is knocked out and overexpressed small by Nanjing model animal center preparation NOC4L Mouse.The both ends mouse exon3 are added into the site loxp, mates with the lyz-cre tool mouse that macrophage specifically knocks out, obtains macrophage The LKO mouse that cell-specific knocks out.Lyz promoter will be inserted into before the Noc4l gene of mouse (for special enhancing medullary system The element of the expression of gene), and it is inserted into insulator (original part that the specifically expressing of regulation Noc4l plays a crucial role) in two sides, Special Noc4l overexpression mouse (OE) of macrophage is obtained by way of procaryotic injection, is prepared strategy and is seen Fig. 3 and Fig. 4.
Identify primer:
LKO mouse identifies primer:
LoxptF:GCCTTGTCATAGACCATGCGATCTG,
LoxptR:TAAGATGCCAGACCGGGGCTTG；
FRTtR:ACAGAACTTGGCTTGAGGCATGTAC；
Cre-f:GCCTGCATTACCGGTCGATGC；
Cre-r:CAGGGTGTTATAAGCAATCCC.
PCR program, 95 DEG C of 5min；95 DEG C of 30s, 62.3 DEG C of 45s, 72 DEG C of 60s, 35 circulations；72℃10min.
OE mouse identifies primer:
Insulator-tF1:TCCAGGACGGAGTCAGTGAGGCG
Lyz-promo-tR1:CTCCCAAAATGCTTGGATTAC
PCR program, 95 DEG C of 5min；95 DEG C of 30s, 58 DEG C of 45s, 72 DEG C of 45s, 35 circulations；72℃10min.
Embodiment 3
Inventor takes about 8 weeks C57BL/6 hero mouse (purchased from Si Beifu) 5, and NOC4L macrophage specifically knocks out mouse, and (LKO is small Mouse) 5, NOC4L macrophage specifically overexpresses mouse (OE mouse) 5, equal 20 grams of weight or more, adds in drinking water 2.5% dextran sulfate sodium (dextran sulfate sodium, DSS) (MP company, the U.S., article No. 0216011080), passes through Mouse freely drinks 5 days building UC models, records weight, the death rate daily and observes hematochezia situation, changes into or not the 6th day in induction The common drinking water for adding DSS killed mouse at the 8th day and takes tissue, records Colon and rectum length, spleen weight, and did HE dyeing observation pathology Situation.
After induction, the weight of WT, LKO and OE mouse is reduced, and sees Fig. 5, but the death rate of OE mouse be apparently higher than WT and LKO mouse, sees Fig. 6.OE mouse colon lengths are short compared with LKO mouse, see Fig. 7 and Fig. 8, and spleen weight LKO and OE mouse all reduces, and sees Fig. 9.
Staining pathologic section shows that OE mouse colon structure disorder, fluff structures are lost, and colon thickness is obviously thinning, sees Figure 10.
Although above the present invention is described in detail with a general description of the specific embodiments, On the basis of the present invention, it can be made some modifications or improvements, this will be apparent to those skilled in the art.Cause This, these modifications or improvements, fall within the scope of the claimed invention without departing from theon the basis of the spirit of the present invention.
Sequence table
<110>China Agricultural University
<120>application of a kind of ulcerative colitis biomarker and therapy target
<130> KHP181116633.0
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 516
<212> PRT
<213>artificial sequence (Artificial Sequence)
<400> 1
Met Glu Arg His Pro Ala Ser Ala Ser Ser Arg Gln Glu Leu Gly Arg
1 5 10 15
Leu Leu Glu Ala Val Leu Thr Ser Arg Gly Gln Ala Asn Ala Val Phe
20 25 30
Asp Ile Leu Ala Val Leu Gln Ser Glu Glu Pro Glu Glu Ile Glu Glu
35 40 45
Gly Val Arg Thr Cys Ser Arg Leu Phe Gly Thr Leu Leu Glu Arg Glu
50 55 60
Glu Leu Phe Val Gly Ser Leu Pro Ser Glu Asp Thr Ala Leu Ala Gly
65 70 75 80
Ser Gln Gly Ala Thr Tyr Lys Tyr Lys Val Trp Ile Arg His Arg Tyr
85 90 95
His Ser Cys Cys Asn Arg Leu Glu Glu Leu Leu Ala His Pro Thr Phe
100 105 110
Gln Val Lys Glu Leu Ala Leu Lys Thr Leu Met Lys Phe Val Gln Leu
115 120 125
Glu Gly Ala Lys Pro Leu Glu Lys Pro Gln Trp Glu Ser His Tyr Leu
130 135 140
Phe Pro Arg Thr Leu Phe Arg Ala Val Val Gly Gly Leu Leu Thr Pro
145 150 155 160
Glu Asp Asp His Ser Leu Leu Ile Ser His Phe Cys Glu Tyr Leu Glu
165 170 175
Tyr Asp Asp Ile Arg Tyr His Thr Met Gln Val Ala Thr Ser Ile Met
180 185 190
Ala Arg Ala Thr Ser Gln Gln Pro Glu Val Ser Leu Thr Leu Trp Asn
195 200 205
Asn Ala Phe Thr Leu Leu Ser Ala Val Ser Leu Pro Leu Gln Glu Cys
210 215 220
Glu Leu Thr Asn Phe Tyr Val Lys His Ala Gln Thr Ser Asp Lys Trp
225 230 235 240
Lys Val Val His Leu Lys Glu His Lys Lys Ala Phe Gln Glu Met Trp
245 250 255
Leu Gly Phe Leu Lys His Lys Leu Pro Leu Ser Leu Tyr Lys Lys Val
260 265 270
Leu Val Ala Met His Asp Ser Ile Leu Pro His Leu Ala Gln Pro Thr
275 280 285
Leu Met Ile Asp Phe Leu Thr Ser Ala Cys Asp Val Gly Gly Ala Ile
290 295 300
Ser Leu Leu Ala Leu Asn Gly Leu Phe Ile Leu Ile His Lys His Asn
305 310 315 320
Leu Glu Tyr Pro Asp Phe Tyr Gln Lys Leu Tyr Gly Leu Leu Asp Pro
325 330 335
Ser Ile Phe His Val Lys Tyr Arg Ala Arg Phe Phe His Leu Ala Asp
340 345 350
Leu Phe Leu Ser Ser Ser His Leu Pro Ala Tyr Leu Val Ala Ala Phe
355 360 365
Ala Lys Arg Leu Ala Arg Leu Ala Leu Thr Ala Pro Pro Glu Ala Leu
370 375 380
Leu Met Val Leu Pro Leu Ile Cys Asn Leu Leu Arg Arg His Pro Ala
385 390 395 400
Cys Arg Val Met Val His Arg Pro Gln Gly Pro Glu Leu Asp Ala Asp
405 410 415
Pro Tyr Asp Pro Thr Glu Lys Asp Pro Ala Arg Ser Arg Ala Leu Glu
420 425 430
Ser Cys Leu Trp Glu Leu Gln Thr Leu Gln Gln His Tyr His Pro Glu
435 440 445
Val Ser Lys Ala Ala Ser Val Ile Asn Gln Val Leu Ser Val Pro Glu
450 455 460
Val Ser Ile Ala Pro Leu Leu Glu Leu Thr Ala Tyr Glu Ile Phe Glu
465 470 475 480
Gln Asp Leu Lys Lys Lys Met Pro Glu Ser Val Pro Leu Glu Phe Ile
485 490 495
Pro Ala Lys Gly Leu Leu Gly Arg Gln Asp Asp Leu Cys Thr Gln Phe
500 505 510
Phe Cys Leu Ser
515
<210> 2
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
gccttgtcat agaccatgcg atctg 25
<210> 3
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
taagatgcca gaccggggct tg 22
<210> 4
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
acagaacttg gcttgaggca tgtac 25
<210> 5
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
gcctgcatta ccggtcgatg c 21
<210> 6
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
cagggtgtta taagcaatcc c 21
<210> 7
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
tccaggacgg agtcagtgag gcg 23
<210> 8
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
ctcccaaaat gcttggatta c 21

Claims (10)

  1. Application of the 1.NOC4L albumen as ulcerative colitis biomarker.
  2. Application of the 2.NOC4L albumen in preparation ulcerative colitis detection kit.
  3. 3. a kind of ulcerative colitis detection kit, which is characterized in that the reagent containing detection NOC4L expressing quantity.
  4. 4. detecting application of the method for NOC4L expressing quantity in preparation ulcerative colitis diagnosis system.
  5. 5.NOC4L albumen is as the application in treatment of ulcerative colitis target spot.
  6. Application of the 6.NOC4L protein expression inhibitor in the drug of preparation treatment ulcerative colitis.
  7. 7. application as claimed in claim 6, which is characterized in that the NOC4L protein expression inhibitor can reduce NOC4L egg White expression quantity.
  8. 8. application as claimed in claim 6, which is characterized in that the NOC4L protein expression inhibitor is able to suppress NOC4L egg White expression expresses that NOC4L albumen not.
  9. 9. a kind of drug for treating ulcerative colitis, which is characterized in that the drug contains targeting NOC4L and can reduce The biological agent or chemicals of the expression of NOC4L expression quantity or inhibition NOC4L.
  10. The application of 10.NOC4L albumen or its expression promotor in preparation Animal Model of Ulcerative Colitis.
CN201811533001.7A 2018-12-14 2018-12-14 A kind of application of ulcerative colitis biomarker and therapy target Pending CN109613258A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201811533001.7A CN109613258A (en) 2018-12-14 2018-12-14 A kind of application of ulcerative colitis biomarker and therapy target

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201811533001.7A CN109613258A (en) 2018-12-14 2018-12-14 A kind of application of ulcerative colitis biomarker and therapy target

Publications (1)

Publication Number Publication Date
CN109613258A true CN109613258A (en) 2019-04-12

Family

ID=66008631

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201811533001.7A Pending CN109613258A (en) 2018-12-14 2018-12-14 A kind of application of ulcerative colitis biomarker and therapy target

Country Status (1)

Country Link
CN (1) CN109613258A (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111273038A (en) * 2020-03-09 2020-06-12 李铭 Application of PFOR protein specific IgA antibody as ulcerative colitis diagnosis marker
CN112587654A (en) * 2020-12-18 2021-04-02 安徽医科大学 Application of mesencephalon astrocyte-derived neurotrophic factor in treatment of ulcerative colitis
CN114887046A (en) * 2022-06-15 2022-08-12 中山大学附属第一医院 Application of SPINK4 in treating inflammatory bowel disease

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111273038A (en) * 2020-03-09 2020-06-12 李铭 Application of PFOR protein specific IgA antibody as ulcerative colitis diagnosis marker
CN112587654A (en) * 2020-12-18 2021-04-02 安徽医科大学 Application of mesencephalon astrocyte-derived neurotrophic factor in treatment of ulcerative colitis
CN112587654B (en) * 2020-12-18 2022-10-14 安徽医科大学 Application of mesencephalon astrocyte-derived neurotrophic factor in treatment of ulcerative colitis
CN114887046A (en) * 2022-06-15 2022-08-12 中山大学附属第一医院 Application of SPINK4 in treating inflammatory bowel disease

Similar Documents

Publication Publication Date Title
Ho et al. Egr-1 deficiency protects from renal inflammation and fibrosis
Phillipson et al. The gastric mucus layers: constituents and regulation of accumulation
CN109613258A (en) A kind of application of ulcerative colitis biomarker and therapy target
Li et al. Effect of curcumin on p38MAPK expression in DSS-induced murine ulcerative colitis
Jia et al. Periostin in chronic liver diseases: Current research and future perspectives
Cui et al. The suppressor of cytokine signaling SOCS1 promotes apoptosis of intestinal epithelial cells via p53 signaling in Crohn's disease
Fernandes et al. Exercise training delays cardiac remodeling in a mouse model of cancer cachexia
Liu et al. Soybean-derived gma-miR159a alleviates colon tumorigenesis by suppressing TCF7/MYC in mice
Wang et al. Polysaccharopeptide from Trametes versicolor blocks inflammatory osteoarthritis pain-morphine tolerance effects via activating cannabinoid type 2 receptor
Li et al. ACE2 suppresses the inflammatory response in LPS-induced porcine intestinal epithelial cells via regulating the NF-κB and MAPK pathways
CN109709335A (en) Application of the heat shock protein HSPA4 in metastases prediction, prognosis evaluation and treatment
CN103251931A (en) Application of Cyr61 in psoriasis medicine
CN106177953B (en) Application of the TLR3 inhibitor in preparation prevention and treatment metastases product
CN103908679B (en) The application of serum amyloid A protein 1
Luo et al. Inhibition of miR-423-5p exerts neuroprotective effects in an experimental rat model of cerebral ischemia/reperfusion injury
CN103550790B (en) Periostin antibody and application thereof in preparation of medicine
Huang et al. Effects of ischemic post-conditioning on the expressions of LC3-II and Beclin-1 in the hippocampus of rats after cerebral ischemia and reperfusion
Chen et al. The potential role of Krüppel-like factor 13 (Aj-klf13) in the intestine regeneration of sea cucumber Apostichopus japonicus
Zheng et al. Nogo-B inhibition restricts ulcerative colitis via inhibiting p68/miR-155 signaling pathway
CN111926071A (en) Molecular marker related to aging and healthy aging and application of molecular marker in improving healthy aging
CN102115732B (en) Anti-rat ATF3 (activating transcription factor 3) monoclonal antibody secreted by hybridoma cell strain WXR
Vohnoutka et al. Knockout of murine Lyplal1 confers sex-specific protection against diet-induced obesity
CN107929302A (en) The medical usage of the anti-enteritis of Geniposidic acid
CN113893348B (en) Application of PTH1R as target in treating or preventing nonalcoholic fatty liver fibrosis
CN101890172B (en) Application of S100A16 gene in preparing drug for treating obesity

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20190412