CN111273038A

CN111273038A - Application of PFOR protein specific IgA antibody as ulcerative colitis diagnosis marker

Info

Publication number: CN111273038A
Application number: CN202010157344.9A
Authority: CN
Inventors: 李铭; 王楷若
Original assignee: Individual
Current assignee: Shandong University
Priority date: 2020-03-09
Filing date: 2020-03-09
Publication date: 2020-06-12
Anticipated expiration: 2040-03-09
Also published as: CN111273038B

Abstract

The invention provides an application of a PFOR protein specific IgA antibody as a diagnosis marker for ulcerative colitis, belonging to the technical field of disease diagnosis. The invention performs clone expression and purification on PFOR protein by screening surface antigen of the clostridium pralatum, and detects the IgA antibody with PFOR protein specificity in the feces of patients according to the ELISA experimental principle. Research finds that the PFOR protein specific IgA antibody in the excrement of the ulcerative colitis patient is obviously increased compared with a healthy patient, and has a significant difference. Therefore, the compound can be used as a diagnostic marker of ulcerative colitis, thereby facilitating clinical diagnosis and treatment and curative effect evaluation and having good practical application value.

Description

Application of PFOR protein specific IgA antibody as ulcerative colitis diagnosis marker

Technical Field

The invention belongs to the technical field of disease diagnosis, and particularly relates to application of a PFOR protein-specific IgA antibody as a diagnostic marker for ulcerative colitis.

Background

The information in this background section is only for enhancement of understanding of the general background of the invention and is not necessarily to be construed as an admission or any form of suggestion that this information forms the prior art that is already known to a person of ordinary skill in the art.

Ulcerative Colitis (UC) is a chronic and recurrent disease of the digestive tract that is characterized by a continuous, diffuse inflammation of the colonic mucosa. Its incidence is escalating worldwide, creating a heavy socio-economic burden. However, the diagnosis of ulcerative colitis lacks gold standards and requires extensive comprehensive analysis, including: clinical manifestations, endoscopy, histopathological manifestations. However, many patients have difficulty in endoscopic examination such as intestinal stenosis and weakness due to advanced age and disease, so that clinical diagnosis and evaluation of disease severity are greatly limited. The etiology and pathogenesis of UC are not completely understood, and studies have shown that genetic, environmental, microbial and immune factors may be involved. The diagnosis of UC pathogenesis and the exploration of diagnosis markers have important significance.

The human intestinal tract hosts a large number of microbial populations of diverse species. Patients with ulcerative colitis have significant changes in the composition of the intestinal flora, with a decrease in the content of the bacterium clostridium prausnitzii (f.prausnitzii) being the main feature. Clostridium pralatanolyticum can relieve the inflammatory response of the gut in a number of ways. The research combined with flow sorting and high-throughput sequencing shows that clostridium prasuum in the feces of UC patients is largely wrapped by IgA. The filtration shows that the Pyruvate Ferrodoxin Oxidases (PFOR) protein is the outer membrane protein of the clostridium pralatum. PFOR is an important metabolic enzyme catalyzing the key process of pyruvate decarboxylation in anaerobe. PFOR is mainly distributed on cell membranes, and is also the target of various antibacterial drugs, such as nitazoxanide and the like. However, the inventor finds that the application of the specific IgA of the surface antigen PFOR of the clostridium pralatum in the diagnosis of the ulcerative colitis is not reported.

Disclosure of Invention

Aiming at the defects of the prior art, the invention provides the application of the PFOR protein-specific IgA antibody as a diagnostic marker for ulcerative colitis. According to the invention, research shows that the PFOR protein-specific IgA antibody of an ulcerative colitis patient, particularly the PFOR protein-specific IgA antibody in excrement is obviously increased compared with a healthy patient, and has significant difference. Therefore, the compound can be used as a diagnostic marker of ulcerative colitis, thereby facilitating clinical diagnosis and treatment and curative effect evaluation and having good practical application value.

In order to achieve the purpose, the invention relates to the following technical scheme:

in a first aspect of the invention, there is provided a diagnostic marker for ulcerative colitis, which comprises a PFOR protein-specific IgA antibody.

The sample to be detected of the PFOR protein specificity IgA antibody is feces. The inventor of the invention discovers that the sequencing result of the fecal flora of the ulcerative colitis patient shows that the abundance of the clostridium pralatum is obviously reduced after earlier experiments. And (3) detecting the feces supernatant of the ulcerative colitis patient to see a clear IgA binding band, and confirming that the PFOR protein can be used as an antigen to activate IgA production. The detection of PFOR protein specific IgA in feces according to the ELISA principle is obviously higher than that of healthy controls. Therefore, the diagnosis of ulcerative colitis can be diagnosed or assisted by detecting PFOR protein-specific IgA antibody in excrement.

In a second aspect of the invention, the invention provides an application of a detection reagent for the PFOR protein-specific IgA antibody in preparing a product for diagnosing or assisting in diagnosing ulcerative colitis.

In a third aspect of the invention, there is provided a product comprising reagents for detecting the level of expression of PFOR protein-specific IgA antibodies in a sample from a subject.

In a fourth aspect of the invention, there is provided a method of diagnosing or aiding in the diagnosis of ulcerative colitis, the method comprising: detecting PFOR protein-specific IgA antibodies in the sample of the subject.

The beneficial technical effects of one or more technical schemes are as follows:

the technical scheme provides the application of the PFOR protein specific IgA antibody in the excrement as a diagnostic marker for ulcerative colitis, thereby effectively perfecting the existing diagnostic method for the ulcerative colitis and providing a noninvasive, convenient and sensitive diagnostic method.

The technical scheme can effectively diagnose or assist in diagnosing the ulcerative colitis, so that a doctor can conveniently diagnose and evaluate the curative effect of a patient with the ulcerative colitis, and the method is worthy of further popularization and application.

Drawings

The accompanying drawings, which are incorporated in and constitute a part of this specification, are included to provide a further understanding of the invention, and are incorporated in and constitute a part of this specification, illustrate exemplary embodiments of the invention and together with the description serve to explain the invention and not to limit the invention.

FIG. 1 is a graph showing the results of the content of Clostridium pralatum in the intestine of the healthy control patients in the treatment of ulcerative colitis in example 1 of the present invention.

FIG. 2 is an electrophoretogram of PFOR proteins purified from Ni Sepharose 6Fast Flow proteins in example 2 of the present invention.

FIG. 3 is a graph showing the results of the PFOR protein-specific IgA antibody content in feces of ulcerative colitis and healthy control patients in example 3 of the present invention.

FIG. 4 is a ROC curve measured by PFOR protein-specific IgA antibodies in example 3 of the present invention.

Detailed Description

It is to be understood that the following detailed description is exemplary and is intended to provide further explanation of the invention as claimed. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

It is noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of exemplary embodiments according to the invention. As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, and it should be understood that when the terms "comprises" and/or "comprising" are used in this specification, they specify the presence of stated features, steps, operations, devices, components, and/or combinations thereof, unless the context clearly indicates otherwise. It is to be understood that the scope of the invention is not to be limited to the specific embodiments described below; it is also to be understood that the terminology used in the examples is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention.

As mentioned earlier, the incidence of ulcerative colitis has escalated worldwide, creating a heavy socio-economic burden. However, the diagnosis of ulcerative colitis lacks gold criteria and is therefore of great interest for the study of diagnostic markers thereof.

According to the invention, the sequencing result of the fecal flora of the ulcerative colitis patient shows that the abundance of the clostridium pralatanorum is obviously reduced. And (3) detecting the feces supernatant of the ulcerative colitis patient to see a clear IgA binding band, and confirming that the PFOR protein can be used as an antigen to activate IgA production. The detection of PFOR protein specific IgA in feces according to the ELISA principle is obviously higher than that of healthy controls. Therefore, the PFOR protein specific IgA antibody in the excrement can be detected for diagnosing or assisting in diagnosing the ulcerative colitis.

It should be noted that, since there are many strains of Clostridium pralatum in the natural environment, there may be differences in the sequence of PFOR genes or PFOR proteins among different strains, and it is within the scope of the present invention that the PFOR genes or PFOR proteins function as an immunizing antigen as they are.

In view of this, in one or more embodiments of the invention, there is provided a diagnostic marker for ulcerative colitis comprising a PFOR protein-specific IgA antibody.

Wherein the PFOR protein is a protein having the following characteristics (a1) or (a 2):

(a1) the amino acid sequence of the polypeptide is consistent with the amino acid sequence shown in SEQ ID NO. 1;

(a2) and (a1) is subjected to substitution and/or deletion and/or addition of one or more amino acid residues to obtain a mutant, and the mutant has the immunogenicity identical to that of the protein sequence shown in SEQ ID NO. 1.

Further, the gene encoding the PFOR protein has a nucleotide sequence as described in any one of (b1) to (b3) below:

(b1) a nucleotide sequence shown as SEQ ID NO. 2;

(b2) a nucleotide sequence complementary to (b 1);

(b3) a nucleotide sequence which has > 90% (e.g. 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% (complete) sequence) identity to the nucleotide sequence set forth in (b1) or (b2) and which does not affect the immunogenicity of the protein encoded thereby.

In one or more embodiments of the invention, the sample to be tested for PFOR protein-specific IgA antibodies is a body fluid sample or a fecal sample, wherein the body fluid sample comprises blood and/or serum and the fecal sample comprises urine and/or feces, preferably feces.

In one or more specific embodiments, the invention provides application of a detection reagent of PFOR protein-specific IgA antibody in preparation of products for diagnosing or assisting in diagnosing ulcerative colitis.

In one or more embodiments of the present invention, the detection reagent includes a reagent for detecting the expression of the PFOR protein-specific IgA antibody described above based on an immunoassay method.

In one or more embodiments of the invention, the immunoassay methods include, but are not limited to, Westernblot, ELISA, colloidal gold, and protein chip technology.

In one or more embodiments of the invention, the product comprises a test kit.

In one or more embodiments of the invention, there is provided a product comprising reagents for detecting the expression level of PFOR protein-specific IgA antibodies in a sample from a subject.

In one or more embodiments of the present invention, the detection reagent includes a reagent for detecting the expression of the PFOR protein-specific IgA antibody based on an immunoassay method.

In one or more embodiments of the invention, the immunoassay method includes, but is not limited to, Westernblot, ELISA, colloidal gold test strips, and protein chips.

In one or more embodiments of the invention, the subject sample is a sample comprising a bodily fluid sample or a fecal sample of the subject, wherein the bodily fluid sample comprises blood and/or serum and the fecal sample comprises urine and/or feces, preferably feces.

The product has at least any one or more of the following uses:

a) diagnosing or aiding in diagnosing whether a subject has ulcerative colitis;

b) prognostic assessment of subjects with ulcerative colitis;

c) and evaluating the curative effect of the ulcerative colitis treatment medicine.

In one or more embodiments of the invention, the product comprises a test kit.

In one or more embodiments of the present invention, there is provided a method of diagnosing or aiding in the diagnosis of ulcerative colitis, the method comprising: detecting PFOR protein-specific IgA antibodies in the sample of the subject.

The invention is further illustrated by the following examples, which are not to be construed as limiting the invention thereto. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention.

Example 1

This example illustrates that the content of clostridium prasukii in the intestinal tract of ulcerative colitis is significantly reduced compared to healthy controls. A total of 35 healthy controls and 35 ulcerative colitis patients were collected and subjected to 16s RNA high throughput sequencing to analyze the C.pralatum content in the feces. The results are shown in figure 1, where it can be seen that the content of clostridium pralatanorum in the faeces of ulcerative colitis patients is significantly reduced compared to the healthy controls.

Example 2

A preparation method of a recombinant protein of a clostridium pralatum PFOR comprises the following steps:

1. connecting the amplified PFOR gene to a P-P1 vector to obtain an expression vector, and introducing the expression vector into DH5a escherichia coli competent cells to obtain an expression strain; the expression strain was inoculated in LB medium containing ampicillin, cultured with shaking at 37 ℃ and positive clones were confirmed by PCR and subjected to sequencing verification. Wherein the PFOR gene sequence is shown as SEQ ID NO. 1.

2. The normal clones were sequenced, extracted with the kit and transformed into Rosetta2(DE3) competent cells (transformation procedure supra).

3. And selecting the transformed plate for monoclone to 1.5ml of LB liquid culture medium containing ampicillin, adding ITPG with the mass concentration of 0.1% when the LB liquid culture medium is proliferated to OD600 of 0.6-0.8, and inducing expression. Collecting thallus, cracking to obtain protein, and detecting by electrophoresis.

4. And (3) carrying out mass expression on the viable bacteria, then carrying out centrifugation to collect bacteria, crushing the bacteria by using ultrasonic waves, carrying out centrifugation at 12000rpm for 10min, then collecting supernatant, carrying out protein purification by using Ni Sepharose 6Fast Flow, eluting and collecting protein, and obtaining PFOR protein.

The electrophoresis result of the PFOR protein obtained by purification is shown in figure 2, and the molecular weight is about 130 kDa. Therefore, the PFOR protein prepared by the method has the advantages of less impurities, high purity and the like.

Example 3

PFOR protein prepared in example 2 was used for plating, and 23 ulcerative colitis patients and 14 healthy controls were examined by the following steps:

1. preparation of feces supernatant: human fecal samples were diluted with PBS, mixed well, centrifuged at 12000rpm4 ℃ for 15min, and fecal supernatants were taken for BCA assay for total protein concentration, adjusted to 50 ng/. mu.l.

2. Coating: diluting PFOR protein with PBS to 1 mu g/ml, adding 100 mu l of diluted PFOR protein into each hole of a 96-hole enzyme label plate, and standing overnight at 4 ℃; the coating solution was discarded, and the plate was washed 3 times with PBS and soaked for 2 minutes.

3. Sample adding: adding 100 μ l of diluted feces supernatant into the coated reaction well, and incubating at 37 deg.C for 1 hr; the plates were washed 3 times with PBS and soaked for 2 minutes.

4. Adding an enzyme-labeled antibody: fresh dilutions (1: 1000) of HRP-labeled anti-human IgA were added to each well and incubated at 37 ℃ for 1 hour; the plates were washed 3 times with PBS and soaked for 2 minutes.

5. Color development: a new 100. mu.l of TMB substrate solution was added to each well for 15 minutes at 37 ℃.

6. And (3) terminating the reaction: add 1N H to each well₃PO₄100μl。

7. And (4) judging a result: read the absorbance at 450nm on an ELISA detector.

The results of 23 patients with ulcerative colitis and 14 healthy controls are shown in FIG. 3. It can be seen that the PFOR protein-specific IgA content in the feces of ulcerative colitis patients is higher than that of healthy controls, with significant difference. A ROC curve is drawn according to the PFOR protein-specific IgA antibody as shown in figure 4, and it can be seen that the area under the ROC curve (AUC) of the PFOR protein-specific IgA antibody content is 0.862, and the cut-off value determined by the Youden index indicates that the sensitivity of the method reaches 78.3% and the specificity reaches 91.7%.

It should be noted that the above examples are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to the examples given, those skilled in the art can modify the technical solution of the present invention as needed or equivalent substitutions without departing from the spirit and scope of the technical solution of the present invention.

SEQUENCE LISTING

<110> Liming Wang regular script

Application of <120> PFOR protein specific IgA antibody as ulcerative colitis diagnosis marker

<130>

<160>2

<170>PatentIn version 3.3

<210>1

<211>1181

<212>PRT

<213> PFOR proteins

<400>1

Met Pro Arg Ala Lys Gln Thr Met Asp Gly Asn Thr Ala Ala Ala His

1 5 10 15

Val Ala Tyr Ala Tyr Thr Asp Val Ala Ala Ile Tyr Pro Ile Thr Pro

20 25 30

Ser Ser Pro Met Ala Asp Ser Val Asp Gln Trp Ser Ala Ala Gly Gln

35 40 45

Lys Asn Ile Phe Gly Asn Gln Val Lys Val Val Glu Met Glu Ser Glu

50 55 60

Ala Gly Ala Ala Gly Ala Val His Gly Ser Leu Gly Ala Gly Ala Val

65 70 75 80

Thr Thr Thr Phe Thr Ala Ser Gln Gly Leu Leu Leu Met Ile Pro Asn

85 9095

Met Tyr Lys Ile Ala Ala Glu Gln Leu Pro Cys Val Phe Asp Val Ser

100 105 110

Ala Arg Thr Val Ala Thr Gln Ser Leu Asn Ile Phe Gly Asp His Ser

115 120 125

Asp Val Met Ala Cys Arg Gln Thr Gly Phe Ala Met Leu Val Glu Ser

130 135 140

Ser Val Gln Glu Val Met Asp Leu Ser Pro Val Ala His Leu Ala Ala

145 150 155 160

Ile Glu Gly Arg Val Pro Phe Leu Asn Phe Phe Asp Gly Phe Arg Thr

165 170 175

Ser His Glu Tyr Gln Lys Ile Glu Lys Trp Asp Tyr Ala Asp Leu Lys

180 185 190

Glu Met Cys Asn Met Lys Ala Val Glu Glu Phe Arg Ala Lys Ala Leu

195 200 205

Asn Pro Glu His Pro Lys Met Arg Gly Ser His Glu Asn Gly Asp Val

210 215 220

Phe Phe Gln His Arg Glu Ala Cys Asn Ser Ala Tyr Asp Ala Leu Pro

225 230 235 240

Ala Val Val Glu Lys Tyr Met Ala Lys Ile Asn Glu Lys Leu Gly Thr

245 250255

Asn Tyr Asp Leu Phe Asn Tyr Tyr Gly Ala Pro Asp Ala Asp Arg Val

260 265 270

Met Ile Ala Met Gly Ser Val Cys Asp Val Ala Asp Glu Val Ile Asp

275 280 285

Tyr Leu Asn Ala Lys Gly Glu Lys Val Gly Ile Val Lys Val Arg Leu

290 295 300

Tyr Arg Pro Trp Val Ser Ser Ala Leu Leu Lys Val Leu Pro Lys Thr

305 310 315 320

Ala Lys Lys Val Ala Val Leu Asp Arg Thr Lys Glu Pro Gly Ser Leu

325 330 335

Gly Glu Pro Leu Tyr Leu Asp Val Ala Ala Thr Leu Arg Glu Ala Gly

340 345 350

Leu Asn Asp Val Val Leu Thr Gly Gly Arg Tyr Gly Leu Gly Ser Lys

355 360 365

Asp Thr Pro Pro Ser Ser Ile Phe Ala Leu Phe Lys Glu Leu Glu Lys

370 375 380

Asp Gln Pro Lys Glu Arg Phe Thr Leu Gly Ile Thr Asp Asp Val Thr

385 390 395 400

Gly Leu Ser Leu Pro Glu Val Lys Pro Ala Pro Ile Thr Ala Ala Ala

405 410 415

Gly Thr Lys Glu Cys Lys Phe Trp Gly Leu Gly Gly Asp Gly Thr Val

420 425 430

Gly Ala Asn Lys Asn Ser Val Lys Ile Ile Gly Asp His Thr Asp Lys

435 440 445

Tyr Val Gln Ala Tyr Phe Gln Tyr Asp Ser Lys Lys Thr Gly Gly Val

450 455 460

Thr Ile Ser His Leu Arg Phe Gly Asp Lys Pro Ile Arg Ser Pro Tyr

465 470 475 480

Tyr Ile Asn Gln Ala Asp Phe Val Ala Cys His Asn Pro Ala Tyr Ile

485 490 495

His Met Gly Met Lys Met Val Gln Asp Val Lys Pro Gly Gly Val Phe

500 505 510

Met Ile Asn Cys Gln Trp Thr Asp Glu Glu Leu Gly Gln His Leu Asn

515 520 525

Ala Glu Ala Lys Lys Tyr Ile Ala Asp Asn Asn Ile Gln Leu Tyr Thr

530 535 540

Ile Asn Ala Ile Asp Lys Ala Ile Glu Ile Gly Met Gly Lys Arg Thr

545 550 555 560

Asn Thr Ile Leu Gln Ser Ala Phe Phe Lys Leu Ala Asp Val Met Pro

565 570 575

Ile Glu Asp Ala Val Asn Phe Met Lys Gln Ala Ala Gln Lys Ser Tyr

580 585 590

Gly Lys Lys Gly Gln Asp Val Val Glu Met Asn Trp Lys Ala Ile Asp

595 600 605

Ala Gly Val Asp Ala Ile His Lys Val Asp Val Pro Ala Ser Trp Ser

610 615 620

Asn Pro Glu Ala Asp Pro Ala Pro Lys Ala Leu Thr Gly Arg Pro Glu

625 630 635 640

Leu Val Lys Gln Ile Arg Asp Val Met Glu Pro Ile Ala Arg Met Asp

645 650 655

Gly Asp Ser Leu Pro Val Ser Ala Phe Val Ala Asn Ala Asn Gly Glu

660 665 670

Trp Glu Gln Gly Ala Ser Ala Tyr Glu Lys Arg Gly Thr Ala Val Asn

675 680 685

Val Pro Glu Trp Asp Ala Ser Lys Cys Val Gly Cys Asn Gln Cys Ala

690 695 700

Phe Val Cys Ser His Ala Thr Ile Arg Pro Phe Gln Leu Thr Ala Asp

705 710 715 720

Glu Leu Ala Ala Ala Pro Ala Gln Thr Lys Ser Arg Asp Asn Arg Pro

725 730 735

Ala Asn Glu Tyr Lys Phe Val Met Ala Val Ser Pro Leu Asp Cys Met

740 745 750

Gly Cys Gly Glu Cys Val Thr Val Cys Pro Thr Lys Ala Ile Ala Met

755 760 765

Val Pro Gln Glu Ser Gln Ala Asp Gln Gln Ala Val Phe Asp Tyr Cys

770 775 780

Val Ala Asn Ile Ser Lys Lys Pro Ser Lys Phe Ala Asp Asp Thr Val

785 790 795 800

Ile Gly Ser Gln Phe Asn Gln Pro Leu Leu Glu Phe Ser Gly Ser Cys

805 810 815

Ala Gly Cys Ala Glu Thr Ser Tyr Ala Arg Leu Ile Thr Gln Leu Phe

820 825 830

Gly Glu Lys Met Tyr Ile Ser Asn Ala Thr Gly Cys Ser Ser Ile Trp

835 840 845

Gly Gly Thr Ala Ser Ile Ser Pro Tyr Thr Val Asn Lys Asp Ser Gly

850 855 860

His Gly Pro Ala Trp Cys Asn Ser Leu Phe Glu Asp Asn Ala Glu His

865 870 875 880

Gly Leu Gly Leu Tyr Leu Gly Gln Lys Thr Val Arg Glu Asn Leu Ile

885 890 895

Lys Arg Ile Ala Glu Val Ala Gly Ser Asp Lys Ala Ser Ala Glu Leu

900 905 910

Lys Ala Ala Phe Asp Lys Phe Met Glu Thr Lys Asn Asn Thr Lys Ala

915 920 925

Asn Asp Glu Pro Ala Lys Ala Leu Ile Ala Glu Leu Glu Lys Ala Ala

930 935 940

Ala Ala Gly Cys Thr Glu Ser Ala Glu Ile Leu Lys Ser Lys Glu Phe

945 950 955 960

Ile Ala Lys Lys Ser Val Trp Ile Phe Gly Gly Asp Gly Trp Ala Tyr

965 970 975

Asp Ile Gly Phe Gly Gly Leu Asp His Val Leu Ala Ser Gly Glu Asp

980 985 990

Val Asn Val Met Val Phe Asp Thr Glu Met Tyr Ser Asn Thr Gly Gly

995 1000 1005

Gln Ala Ser Lys Ala Ser Asn Ile Gly Glu Val Cys Gln Phe Ala

1010 1015 1020

Ala Ala Gly Lys Glu Ile Ser Lys Lys Ser Leu Ser Glu Ile Ala

1025 1030 1035

Met Thr Tyr Gly Tyr Ile Tyr Val Ala Gln Ile Ala Leu Gly Ala

1040 1045 1050

Asn Met Asn Gln Ala Val Lys Ala Ile Ala Glu Ala Glu Ala Tyr

1055 1060 1065

Pro Gly Pro Ser Leu Ile Ile Gly Tyr Ala Pro Cys Glu Leu His

1070 1075 1080

Gly Val Lys Gly Gly Met Thr Asn Cys Gln Asn Glu Met Lys Lys

1085 1090 1095

Ala Val Glu Ala Gly Tyr Trp Asn Leu Phe Thr Phe Asn Pro Ala

1100 1105 1110

Asn Lys Ala Gln Gly Lys Asn Pro Phe Thr Leu Thr Ser Lys Ala

1115 1120 1125

Val Asp Ala Glu Lys Tyr Gln Ala Leu Leu Ala Asn Glu Thr Arg

1130 1135 1140

Tyr Ser Arg Leu Thr Arg Ala Phe Pro Glu Arg Ala Lys Ala Leu

1145 1150 1155

Phe Ala Arg Asn Glu Gln Val Ala Asn Asp Arg Tyr Glu His Leu

1160 1165 1170

Thr Arg Leu Val Glu Leu Tyr Lys

1175 1180

<210>2

<211>3546

<212>DNA

<213> PFOR Gene

<400>2

atgcctagag caaagcaaac catggatggc aataccgctg ccgctcatgt agcatacgcc 60

tacacggacg tggctgctat ctaccccatt accccgtctt ctccgatggc tgactctgtg 120

gaccagtggt ccgcagccgg tcagaagaac atcttcggca accaggtcaa ggtcgtcgag 180

atggagtctg aggccggcgc tgccggcgct gtgcacggct ctctgggtgc aggtgctgtt 240

accaccacct tcaccgcttc tcagggcctg ctgctgatga tccccaacat gtacaagatc 300

gctgctgagc agctgccctg cgtgttcgat gtttctgcac gtaccgttgc tacccagtcc 360

ctgaacatct tcggtgatca cagcgacgtt atggcatgcc gccagaccgg cttcgcaatg 420

ctggtcgaga gcagcgtgca ggaagttatg gatctgtccc ctgttgccca tctggcagca 480

atcgagggcc gggttccctt cctgaacttc ttcgatggct tccgtacttc tcacgagtac 540

cagaagatcg agaagtggga ctacgctgat ctgaaggaaa tgtgcaacat gaaggctgtt 600

gaggagttcc gtgccaaggc tctgaacccc gagcacccca agatgcgcgg ttcccacgag 660

aacggcgacg tgttcttcca gcaccgtgag gcctgcaact ccgcttacga cgcactgccc 720

gcagtggtcg agaagtacat ggccaagatc aacgagaagc tgggcaccaa ctacgatctg 780

ttcaactact acggcgcacc cgatgctgac cgtgttatga tcgctatggg ctctgtctgc 840

gacgttgctg acgaagtcat cgattacctg aacgccaagg gcgagaaggt cggtatcgtc 900

aaggtccgcc tgtaccgtcc ctgggtgtcc tccgctctgc tgaaggtcct gcccaagact 960

gccaagaagg ttgcagttct ggatcgtacc aaggagcccg gctccctggg cgagcccctg 1020

tacctggatg ttgctgctac cctgcgtgag gctggcctga acgatgtcgt cctgaccggc 1080

ggccgttacg gcctgggcag caaggacact cccccgtcct ccatcttcgc tctgttcaag 1140

gagctggaga aggatcagcc caaggagcgc ttcactctgg gcatcaccga tgatgtcacc 1200

ggtctgtccc tgcccgaggt caagcccgct cccatcaccg cagctgctgg caccaaggag 1260

tgcaagttct ggggtctggg cggcgacggt actgtcggcg caaacaagaa ctccgtcaag 1320

atcatcggcg accacactga taagtatgtt caggcatact tccagtatga ctccaagaag 1380

accggcggcg tgaccatcag ccacctgcgt ttcggcgaca agcccatccg cagcccctac 1440

tacatcaacc aggctgactt cgtggcctgc cacaaccccg cttacatcca catgggcatg 1500

aagatggtcc aggatgtcaa gcccggcggc gtgttcatga tcaactgcca gtggaccgat 1560

gaggagctgg gccagcacct gaacgctgag gccaagaagt acattgctga caacaacatt 1620

cagctgtaca ccatcaacgc catcgataag gcaatcgaaa tcggtatggg caagcgcacc 1680

aataccatcc tgcagtccgc tttcttcaag ctggctgacg ttatgcccat cgaggacgct 1740

gtcaacttca tgaagcaggc agctcagaag agctacggca agaagggcca ggacgttgtt 1800

gagatgaact ggaaggccat cgatgctggt gttgacgcga tccacaaggt cgacgttccc 1860

gcttcctggt ccaaccccga ggctgatccc gctcccaagg ctctcaccgg ccgtccggag 1920

ctggtcaagc agatccgtga tgtcatggag cccatcgctc gtatggacgg cgacagcctg 1980

cccgtttccg ctttcgttgc aaatgcaaac ggcgagtggg agcagggcgc atccgcatac 2040

gagaagcgcg gcaccgctgt gaacgttccc gagtgggatg cttccaagtg cgtcggctgc 2100

aaccagtgtg cattcgtctg ctctcatgct accatccgtc ccttccagct gaccgctgac 2160

gagctggcag ctgctcctgc tcagaccaag agccgtgaca accgccccgc aaacgagtac 2220

aagtttgtga tggctgtttctcctctggac tgcatgggct gcggcgagtg cgtcaccgtc 2280

tgccccacca aggcaattgc tatggttcct caggagagcc aggccgatca gcaggcagtc 2340

ttcgactact gcgtcgccaa catctccaag aagcccagca agtttgctga tgacaccgtt 2400

attggttctc agttcaacca gcccctgctg gagttctctg gctcctgtgc aggctgtgct 2460

gagacctctt acgctcgcct gatcactcag ctgttcggcg agaagatgta catctccaac 2520

gctaccggct gctcctctat ctggggcggt accgcttcca tctctccgta caccgtcaac 2580

aaggacagcg gccatggtcc tgcatggtgc aactccctgt tcgaggataa cgctgagcat 2640

ggtctgggcc tgtacctcgg ccagaagacc gttcgtgaga acctgatcaa gcgcattgct 2700

gaggttgctg gttctgacaa ggcttccgct gagctgaagg ctgccttcga caagttcatg 2760

gagaccaaga acaacaccaa ggcaaacgac gaacccgcca aggctctgat cgctgagctg 2820

gagaaggctg ctgccgctgg ctgcaccgag tccgctgaga tcctgaagag caaggagttc 2880

atcgccaaga agtccgtctg gatcttcggt ggtgacggct gggcatacga catcggcttc 2940

ggcggcctgg atcacgtcct ggcttccggc gaggatgtca acgtcatggt cttcgatact 3000

gagatgtact ccaacaccgg tggacaggca tccaaggctt ccaacattgg tgaggtctgc 3060

cagttcgctg ctgctggtaa ggaaatcagc aagaagagcc tgtccgagat cgcaatgacc 3120

tacggttaca tctatgttgc tcagatcgct ctgggcgcta acatgaacca ggctgtcaag 3180

gcaatcgctg aggctgaggc ttatcccggc ccctctctga tcatcggcta cgctccctgc 3240

gagctgcacg gtgtgaaggg cggcatgacc aactgccaga acgagatgaa gaaggcagtt 3300

gaggctggtt actggaacct gttcaccttc aaccccgcca acaaggctca gggcaagaac 3360

cccttcaccc tgacctccaa ggctgtggat gccgagaagt atcaggcact gctggcaaac 3420

gagacccgtt acagccgcct gacccgtgca ttccccgagc gtgcaaaggc tctgttcgca 3480

cgcaacgagc aggttgcaaa cgatcgttac gagcacctga cccgtctggt cgagctgtac 3540

aagtaa 3546

Claims

1. A diagnostic marker for ulcerative colitis, comprising a PFOR protein-specific IgA antibody.

2. The diagnostic marker for ulcerative colitis according to claim 1, wherein said PFOR protein is a protein having the following characteristics (a1) or (a 2):

3. Diagnostic marker for ulcerative colitis according to claim 2, wherein said test sample of PFOR protein-specific IgA antibodies is a body fluid sample or a faecal sample, wherein the body fluid sample comprises blood and/or serum and the faecal sample comprises urine and/or faeces, preferably faeces.

Application of a detection reagent for the PFOR protein-specific IgA antibody in preparation of products for diagnosing or assisting in diagnosing ulcerative colitis.

5. The use of claim 4 wherein the detection reagents comprise reagents for detecting the expression of PFOR protein-specific IgA antibodies based on an immunoassay.

6. The use of claim 5, wherein the immunodetection methods comprise Western blot, ELISA, colloidal gold and protein chip techniques.

7. The use of claim 4, wherein the product comprises a test kit.

8. A product comprising reagents for detecting the expression level of an IgA antibody specific for PFOR protein in a sample from a subject.

9. The product of claim 8, wherein the subject sample is a bodily fluid sample or a fecal sample, wherein the bodily fluid sample comprises blood and/or serum and the fecal sample comprises urine and/or feces, preferably feces.

10. The product of claim 8, wherein the product has at least one or more of the following uses:

a) diagnosing or aiding in diagnosing whether a subject has ulcerative colitis;

b) prognostic assessment of subjects with ulcerative colitis;

c) evaluating the curative effect of the ulcerative colitis treatment medicine;

preferably, the product comprises a test kit.