CN102115732B - Anti-rat ATF3 (activating transcription factor 3) monoclonal antibody secreted by hybridoma cell strain WXR - Google Patents
Anti-rat ATF3 (activating transcription factor 3) monoclonal antibody secreted by hybridoma cell strain WXR Download PDFInfo
- Publication number
- CN102115732B CN102115732B CN201010278755XA CN201010278755A CN102115732B CN 102115732 B CN102115732 B CN 102115732B CN 201010278755X A CN201010278755X A CN 201010278755XA CN 201010278755 A CN201010278755 A CN 201010278755A CN 102115732 B CN102115732 B CN 102115732B
- Authority
- CN
- China
- Prior art keywords
- atf3
- monoclonal antibody
- rat
- mouse
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
The invention relates to a monoclonal antibody, in particular to a monoclonal antibody secreted by a hybridoma cell strain WXR, a hybridoma cell strain WXRCCTCC C201034, an monoclonal antibody of anti-rat activating transcription factor 3 (ATF3) secreted by the hybridoma cell strain WXR, and a preparation kit thereof. The invention not only lays the foundation to experimentally research the biological function and the action mechanism of the ATF3, but also offers a valuable reference material to research the therapeutic drug for the tumor resistance, the diabetes, the nerve system disease, the inflammation and the kidney disease.
Description
Technical field
The present invention relates to monoclonal antibody, the monoclonal antibody of particularly a kind of hybridoma cell strain WXR excretory mouse ATF3 of the Chinese People's Anti-Japanese Military and Political College.
Background technology
Activating transcription factor 3 (activating transcription factor 3; ATF3) be that (its DNA total length is 32229bp for the nuclear factor of a kind of cAMP response element binding protein (CREB) family of finding of people such as Hai in 1989; 4 exons are arranged); Its mRNA sequence is seen Seq NO.1, has transcriptional regulatory effect widely.People such as Okamoto find, ATF3 can with other transcription factor, like C-Jun, Jun B, Jun D waits to combine to form heterodimer, mostly its function is the regulon of transcriptional activation.ATF3 level under the physiological status is lower, and mitogenstimulated is arranged or stress signal the time, ATF3 expresses and raises at once, as the nuclear factor of cellular stress, participates in the proliferation response of multiple tissue.Known ATF3 belongs to that a kind of stimulation induces and the response gene of early expression, and whether its function depends on as the transcriptional activation regulon stimulates former kind, cell type, cell background and binding partner etc.With regard to the relation between ATF3 and the disease, at present in research fields such as mellitus, tumour, inflammation, nervous system disorders, growth (mainly being congenital hypospadias) and pain, the report of relevant ATF3 comparatively more to be seen.
1. tumour
But in the Hela clone of the abduction delivering ATF3 that receives the tsiklomitsin regulation and control, induce ATF3 to express through the Tet-off/Tet-on gene expression system, find that ATF3 albumen can slow down cell and advance to the S phase from the G1 phase, the proteic over-expresses of ATF3 can cell growth inhibiting.ATF3 is high expression level in prostate cancer tissue, uses the siRNA scientific discovery, and reticent Kruppel like factor 6 (KLF6) can suppress the expression of ATF3, thereby has suppressed to be grown by sodium azide inductive prostate cancer cell.In people's epithelium squamous cell carcinoma, cross expression ATF3 and can strengthen the Caspase activity, promote Etoposide and NSC 94600 inductive apoptosis.The green tea element can be induced the human colon carcinoma apoptosis of tumor cells, and apoptogene nonsteroidal antiinflammatory drug activated gene is urged in this and its rise ATF3 mediation, and (non-steroidal anti-inflammatory drug-activated gene, NAG-1) expression is relevant.In human colon cancer cell, can induce ATF3 to express with antitumor drug and increase, promote the apoptosis of tumour cell.Then can suppress LY294002 inductive HCT-116 apoptosis with the reticent ATF3 gene of siRNA technology.The antitumous effect of LY294002 in colorectal carcinoma is to express through raising early growth response factor 1 (Egr-1), and Egr-1 acts on the ATF3 promotor, causes that genetic transcription activates, final cancer cell specific induction of apoptosis.In human colon cancer cell, berberine can induce ATF3 to express, and promotes apoptosis.And this rise is to carry out with the mode that the p53 gene relies on.In brief, ATF3 albumen cell growth has the negativity regulating and controlling effect, and is inhibited to tumour cell when ATF3 albumen is crossed statement, and can promote the apoptosis of tumour cell.
2. mellitus
(insulin receptor substrate 2, IRS2) gene is a gene of keeping cell survival to IRS 2.Discover through transgenic mice and clpp gene deratization, on the one hand, ATF3 transgenic mice pancreas islet developmental defect; The islet tissue textural anomaly; Cause beta Cell of islet quantity to reduce, on the other hand, ATF3 knock out mice anti-stress inductive apoptosis capacity strengthens.Adiponectin significantly downward modulation is a notable feature of obesity and diabetes animal model.Kim etc. stimulate 3T3-L1 mouse adipocyte, human embryo kidney (HEK) 293 cell induction er stress with thapsigargin; Find through luciferase reporter gene and electrophoretic mobility test; Inside and outside ATF3 and T cell activation nf 4 (nuclear factor of activated T-cellscalcineurin-dependent 4; NFATc 4) all can be attached to the adiponectin promoter region jointly, work to transcribe inhibition, the expression of downward modulation adiponectin.Therefore, ATF3 can promote the beta Cell of islet apoptosis through directly suppressing the IRS2 expression of gene.Diabetic beta Cell of islet ATF3 abnormal gene expression increases, so downward modulation ATF3 genetic expression has realistic meaning to treating diabetes.
3. nervous system disorders
Peripheral nerve injury is different with central nervous system injury, can activate neuron regeneration behind the peripheral nerve injury.People such as Seijffers find that ATF3 expresses and increases behind the peripheral nerve injury, does not then find its rising behind the central nervous system injury.Other has bibliographical information, after the dorsal root ganglion neurons damage, and the transgenic mice of constitutive expression ATF3, its neuron regeneration ability obviously strengthens than wild-type.Yet, also there is experiment to find, can protect low potassium inductive apoptosis of rat cerebellar granule neurons with indolone GW-5074.Further research shows that GW-5074 plays a role through the MEK-ERK path.Can induce ATF3 to express because of low potassium and increase, promote apoptosis, GW-5074 then can suppress the expression of ATF3.Have found that GW-5074 can activate B-Raf, activatory B-Raf acts on its downstream target gene ATF3, suppresses it and transcribes, thereby suppress low potassium inductive Neuron Apoptosis.In addition, also have the scholar to confirm, low potassium is to express through JNK/c-Jun mediation ATF3 to increase, and then promotes apoptosis of rat cerebellar granule neurons.Prompting ATF3 plays the effect of protectiveness in the nerve injury model, it can promote the regeneration of nerve fiber.
4. inflammation
Recently, the effect of ATF3 in body inherent immunity system obtained many investigators' great attention.The mouse of ATF3 gene knockout suffers from tangible SOA, shows as airway hyperreactivity, inflammation, airway remodeling etc.ATF3 can obviously suppress the supersensitivity airway inflammation.Chromatin immunoprecipitation (ChIP) analysis finds that ATF3 can directly be attached on IL-4, IL-5 and the IL-13 promotor, the inhibition of histone acetylize, and then suppress transcribing of Th2 cytokine.Recently, systems biology mathematical modeling and experiment confirm, ATF3, NF-κ B and C/EBP interact, and form generegulation property network, and reaction controls inflammation.In this regulating loop, NF-κ B is startup person, and C/EBP is an intensifier booster, and ATF3 has then played the effect of losser.Other discovers that (Toll-like receptor's ATF3 4 TLR-4) shields in the inductive inflammation at Toll appearance acceptor 4.Show that ATF3 plays a protective role in inflammatory reaction, be the negativity regulatory factor.
5.ATF3 the research in nephropathy
ATF3 participated in the to be correlated with generation and the development of kidney disease.For example, utilize biochip technology, people such as Yoshida find, use H
2O
2Stimulating people's proximal tubule cell can induce ATF3 to express rapidly increases.ATF3 possibly play the effect of protection cell.In the chmice acute renal injury model, cross expression ATF3 with the Adenovirus Transfection technology and can reduce creatinine, improve renal function, pathologic finding finds that the uriniferous tubules ischemical reperfusion injury obviously alleviates.In addition, with the method for Western blot, people such as Zhou find, in acute injury of kidney model and patient, FSGS disease patient's urine, the content that can detect ATF3 raises.Prompting, ATF3 can be used as a kind of biomarker that detects early stage acute injury of kidney.
In view of the importance of ATF3 nuclear factor, for further studying and use ATF3, the present invention adopts the earlier synthetic rat ATF3 polypeptide of manual method, has prepared the monoclonal antibody of the mouse ATF3 of the Chinese People's Anti-Japanese Military and Political College then.
Summary of the invention
Technical purpose
The present invention provides a kind of hybridoma cell strain WXR;
The present invention provides the monoclonal antibody of a kind of hybridoma cell strain WXR excretory mouse ATF3 of the Chinese People's Anti-Japanese Military and Political College;
The present invention provides a kind of mouse ATF3 of Chinese People's Anti-Japanese Military and Political College immunohistochemical staining test kit.
Summary of the invention
A kind of hybridoma cell strain WXR is in China's typical culture collection center preservation, and preserving number is CCTCC NO:C201034,
Preservation date is on June 9th, 2010, Chinese Wuhan Wuhan University.
A kind of hybridoma cell strain WXR excretory mouse ATF3 of Chinese People's Anti-Japanese Military and Political College monoclonal antibody.
The described mouse ATF3 of Chinese People's Anti-Japanese Military and Political College monoclonal antibody, to rat ATF3 168-181 amino acids polypeptide NLFIQQIKEGTLQSC,
Corresponding to 502-543bp base sequence (seeing the Seq NO.1 in the sequence table).
A kind of mouse ATF3 of Chinese People's Anti-Japanese Military and Political College immunohistochemical staining test kit contains the monoclonal antibody of the described mouse ATF3 of the Chinese People's Anti-Japanese Military and Political College.
A kind of mouse ATF3 of Chinese People's Anti-Japanese Military and Political College MONOCLONAL ANTIBODIES SPECIFIC FOR method is characterized in that following steps:
1. the foundation of hybridoma
Immune animal: with Freund's complete adjuvant and 1: 1 ratio mixing of rat ATF3 polypeptide antigen, every Balb/c mouse peritoneal injection 0.3mL (70 μ g) repeated at a distance from 3 weeks, and dosage is identical, and adjuvant is used Freund instead; After 3 weeks every injected in mice purifying antigen 0.3mL, merge after 3 days, merge the same day, the eye socket blood sampling, indirect ELISA is surveyed serum antibody titer; Immune mouse spleen cell and murine myeloma cell merged with 8: 1, behind the centrifugal 8min of 1000r/min, slowly added the PEG 1mL mediates fusion of 0.5 times of volume; The indirect elisa method screening, monoclonal antibody secretion positive colony is cloned with limiting dilution assay.To use the mouse boosting cell and the SP2/0 cytogamy of rat ATF3 polypeptide immune, and merge altogether 4 times (16 96 well culture plates), cloning efficiency is about 70%, and verification and measurement ratio is more than 90%.Behind clone and subclone repeatedly, obtain a strain can stably excreting the hybridoma cell strain of mouse anti rat ATF3mAb, called after WXR.Hybridoma cell strain WXR is China's typical culture collection center preservation in Wuhan, and preserving number is CCTCC C201034, and preservation date is on June 9th, 2010.The dyed body karyotyping of WXR shows chromosome number between 80～100 (Fig. 3).This strain of hybridoma is cultivated through external continuous passage (40 generation), recovers well-grown still, antibody that can the stably excreting mouse ATF3 of the Chinese People's Anti-Japanese Military and Political College behind the liquid nitrogen cryopreservation.
Above-mentioned rat ATF3 polypeptide is through the information biology software prediction; Promptly adopt the online antigen peptide forecasting software that provides of Harvard University's molecular immune foundation to dope the proteic antigenic determinant of ATF3 20 (table 1) arranged; Adopt the β-corner of the aminoacid sequence of the module analysis ATF3 that DNAStar Protean software provides then; Alpha-helix, wetting ability, antigenicity and in the scoring of protein surface possibility.Garnier-Robson method prediction ATF3 albumen contains 5 α spiral centers, 3 βZhe Die sections; Chou-Fasman method prediction ATF3 albumen contains 7 α spiral centers, 6 βZhe Die sections; Karplus-Schulz method prediction ATF3 albumen contains 7 flexible regions, and Kyte-Doolittle method prediction B cell antigen epi-position result shows that ATF3 albumen hydrophilic region (>=0) distributes wider; Wherein the wetting ability upper zone is mainly at 78-98,100-118 and 155-172 section.The demonstration that predicts the outcome of Plot-Emini method, the proteic 86-98 of ATF3,102-112 and 160-171 section appear at proteinic surperficial possibility bigger (>=1) (see figure 1).Therefore; Factors such as the predicting the outcome of synthetic antigen determinant, secondary structure, wetting ability, protein surface possibility; This experimental design has also been synthesized ATF3 168-181 amino acids polypeptide NLFIQQIKEGTLQSC, corresponding to the 502-543bp base sequence, comprises the antigenic determinant (shown in black matrix part in the table 1) of the 18th, 19,20 predictions; And coupling protein KLH, molecular weight are 1722KD.The synthetic polypeptide of ATF3 is simple spike through efficient liquid phase chromatographic analysis from the visible synthetic peptide of HPLC tomographic map, and the purity of polypeptide is about 97.58%, and the result sees Fig. 2.
The proteic antigenic determinant of rat ATF3 of table 1 software prediction
2. the evaluation of subclass
With mono-clonal positive hybridoma ascites with PBS with 1: 300 dilution proportion; Get 150 μ L; The specification sheets of measuring test kit according to the mouse monoclonal antibody subclass of Roche company carries out rapid determination, and the qualification result of Ig subclass shows that the hypotype of ATF3mAb is the IgG1 type, and light chain is κ chain (Fig. 4).
3. a large amount of preparations and the purifying of monoclonal antibody
Adopt ascites to induce method manufacture order clonal antibody, the positive rate that ascites forms is more than 95%, and the output of ascites is average every mouse 5.0mL.Get female Balb/c mouse peritoneal injection in 6-8 age in week 0.5mL Yellow Protopet 2A, pneumoretroperitoneum was injected well-grown hybridoma about 5 * 10 in 10 days
6/ only, mouse web portion increases after 3-5 days, from aspiration of abdominal cavity ascites; With the centrifugal 5min of 1000-2000r/min; Draw supernatant, with the little filter filtration sterilization of 0.45 μ m, ATF3 antibody ascites concentration behind milliipore Protein A/G-PlusBeads antibody purification column purification is 0.375mg/mL.After the packing ,-70 ℃ of storages.
4. the specificity of monoclonal antibody is identified
4.1 indirect ELISA detects antibody titer
The monoclonal anti body and function PBS of titration after with purifying be doubling dilution according to a certain percentage respectively, with indirect EILSA method mensuration A
450, can immunoreactive monoclonal antibody greatest dilution take place with target antigen be it and tire.ELISA method analysis revealed, the Chinese People's Anti-Japanese Military and Political College's mouse ATF3 monoclonal antibody behind the purifying is tired >=1: 100000 (see figure 5).
Use the synthetic polypeptide, every hole adds 100 μ L (the about 2 μ g/mL of concentration) and encapsulates elisa plate, and 4 ℃ are spent the night.Discard liquid in the hole, with washings (1 * PBS contains 0.05%Tween-20) washing 3 times, each 3min.Leave and take 1 hole and add 100 μ L diluents and do outside the blank, all the other each holes add the antibody to be measured of the certain dilution of 100 μ L, and (diluent is 1 * PBS to 37 ℃ of incubation 1h, contains 0.05%Tween-20,0.1%BSA).After the washing (method is the same), every hole adds each 100 μ L of ELIAS secondary antibody (dilution in 1: 1000) of dilution, 37 ℃ of incubation 1h.The ABTS that every hole, washing back adds the new preparation of 100 μ L uses liquid, 37 ℃ of incubation 20min.Every hole adds 50 μ L 2mol/L H
2SO
4Termination reaction. survey each hole reading with the ELISA readout instrument.
4.2Western?blot
Respectively with the albumen of the rat mesangial cell in vitro (GMCs) that do not stimulate and human mesangial cell (HRMCs) and with 100 μ M H
2O
2The albumen of collecting behind GMCs that stimulates and the HRMCs 3h carries out 12%SDS-PAGE electrophoresis and Western blot; Mouse anti rat ATF3 monoclonal antibody (1: 500) is anti-as one, and the goat anti-mouse igg of HRP mark (1: 2000) resists the specificity that detects the ATF3 monoclonal antibody as two.The mouse ATF3 of the Chinese People's Anti-Japanese Military and Political College monoclonal antibody ability and the H of preparation
2O
2The protein-specific that post-stimulatory rat GMCs extracts combines, and forms positive band (Fig. 6), shows that this strain monoclonal antibody has the good proteic ability of specific recognition rat ATF3.
4.3 immunohistochemical staining
Preparation rat Thy-1N model is promptly got normal male SD rat, heavy 160-200g.The disposable injection anti-Thy-1Ab of rat tail vein, dosage are 0.75ml/100g (establishing normal rabbit serum in addition is the contrast of NS group, and dosage is with anti-Thy-1 antibody).Respectively at 0h, 3h and 6h behind injection anti-Thy-1Ab and the NS, put to death rat, get renal cortex, sample is put in 4% Paraformaldehyde 96 fixedly paraffin embedding, makes the thick paraffin section of 4 μ m, dewaxes, and section is dipped in 3%H
2O
2In the liquid, in soaking at room temperature 30min deactivating endogenous peroxydase, with distillation washing 3 times.4 ℃ of incubated overnight of ATF3 monoclonal antibody (1: 50) of purifying.Add goat anti-mouse igg HRP after PBS develops a film, hatch 20min for 37 ℃, carry out the DAB colour developing after PBS develops a film, Hematorylin is redyed, row dehydration then, transparent, mounting processing.Microscopy amplifies 400 times and takes pictures, the record result.Immunohistochemical staining detection NS group and Thy-1N rat 0h, 3h, the proteic expression of 6h nephridial tissue ATF3.The result shows, Thy-1N 3h group, and the dyeing of ATF3 monoclonal antibody is positive; Thy-1N 6h group; Positive staining intensity obviously strengthens (Fig. 7), and the endochylema karyon all is tangible pale brown look, especially nucleus dyeing comparatively significantly (like the arrow indication); And each stage of control group is not seen the ATF3 positive staining, shows that this monoclonal antibody can be used for detecting the expression amount of ATF3 in rat tissue's specimens paraffin embedding slices.
In addition, the immunohistochemical methods test kit that uses the present invention to measure rat ATF3 detects ATF3 expression in the GMCs cell climbing sheet of cultivating, and is about to the GMCs cell inoculation in the 3.5mm plate, will not use H respectively
2O
2The GMCs that stimulates and with 100 μ M H
2O
2Take out behind the GMCs 3h that stimulates, sample detects the proteic expression of ATF3 among two groups of GMCs by above-mentioned tissue paraffin section de step after fixing with cold acetone again.
In the above-mentioned experiment, laboratory animal: 6-8 week mouse male Balb/c mouse in age and 160-200g male (Sprague-Dawley) SD rat are all available from Nanjing Medical University's Experimental Animal Center.The experimental cell strain: murine myeloma cell strain SP2/0 is provided by antibody technique key lab of the Ministry of Health of Nanjing Medical University; Rat GMCs (HBZY-1) is available from Wuhan University China typical culture collection center.
Main agents: immunogen rat ATF3-KLH coupled complex; Be specificity rat ATF3 polypeptide and keyhole suede hemocyanin (key hole limpet hemocyanin; KLH) coupling is synthetic by the living worker's biotechnology in Shanghai ltd, and Freund's complete adjuvant and Freund's incomplete adjuvant are available from U.S. Sigma company.Multi-clone rabbit Chinese People's Anti-Japanese Military and Political College mouse thymocyte serum (Thy-1Ab, 1:320 tires), uses behind 56 ℃ of 30min deactivation complements by this prepared in laboratory according to document.The goat-anti mouse immuning ball protein of peroxidase labelling, mouse Ig hypotype are measured test kit (Isotrip Kit) available from Hbt company.Other chemical reagent are analytical pure, available from Nanjing Sheng Xing Bioisystech Co., Ltd.
Beneficial effect
The invention provides the hybridoma cell strain WXR excretory mouse ATF3 of a kind of Chinese People's Anti-Japanese Military and Political College monoclonal antibody.This antibody can combine with the epitope specificity of ATF3 gene aacctttttatccaacagataaaagaaggaacattgcagagctaa (502-543) (the Seq NO.1 in the sequence table) coding; Because the ATF3 gene is all obviously relevant with illnesss such as tumour, mellitus, nervous system disorders, inflammation, nephropathys; So the mouse ATF3 of Chinese People's Anti-Japanese Military and Political College monoclonal antibody provided by the invention; Be not merely further research ATF3 gene function experiment material is provided, and can also be for further exploitation or the screening medicine relevant with ATF3 provide reference reagent.
Description of drawings
Figure 1A TF3 carboxyl terminal albumen secondary structure and the prediction of B cell antigen epi-position, wherein A: alpha-helix section; B: beta sheet section; T: corner area; C: random coil zone; F: flexible region.
(purity is Fig. 2 efficient liquid phase chromatographic analysis purity of protein: 97.58%).
The chromosome number of Fig. 3 hybridoma cell strain (* 1000).
The monoclonal subgroup identification of Fig. 4 ATF3.
The different Dilution ratio mouse anti rat monoclonal antibody ATF3 of Fig. 5 tire.
Fig. 6 Western blot detects the expression of ATF3 in people's kidney mesangial cell HRMC and kidney of rats mesangial cell GMCs cell.
Fig. 7 Thy-1 Glomerulonephritis Rats and normal control mouse nephridial tissue ATF3 protein expression situation (immunohistochemical staining); The SD rat is got the representative photo (DAB method) of the immunohistochemical staining of Thy-1 Glomerulonephritis Rats and normal control mouse nephridial tissue row ATF3 respectively through tail vein injection cause a disease 0h behind the anti-Thy-1Ab, 3h and 6h; Wherein Thy-1N 6h organizes, and cell dyeing intensity is significantly higher than other each control groups; ATF3 mainly is distributed in nucleus and nuclear week (shown in the arrow); A:Thy-1N (0h, * 400); B:Thy-1N (3h, * 400) C:Thy-1N (6h, * 400); D-F: normal serum (NS) control rats 0h, 3h and 6h immunohistochemical methods picture.
Fig. 8 immunohistochemical methods detects the expression of ATF3 in kidney of rats mesangial cell (GMCs); A: the GMCs (* 400) that does not stimulate, B:100 μ M H
2O
2Stimulate the GMCs (* 400) of 3h.
Embodiment
The preparation method of a kind of Chinese People's Anti-Japanese Military and Political College mouse ATF3 monoclonal antibody and verivate thereof is characterized in that following steps:
1. the foundation of hybridoma
Immune animal: Freund's complete adjuvant and 1: 1 ratio mixing of rat ATF3 polypeptide antigen, every Balb/c mouse peritoneal injection 0.3mL (70 μ g) repeated at a distance from 3 weeks, and dosage is identical, and adjuvant is used Freund instead; After 3 weeks every injected in mice purifying antigen 0.3mL, merge after 3 days, merge the same day, the eye socket blood sampling, indirect ELISA is surveyed serum antibody titer; Immune mouse spleen cell and murine myeloma cell merged with 8: 1, behind the centrifugal 8min of 1000r/min, slowly added the PEG 1mL mediates fusion of 0.5 times of volume; The indirect elisa method screening, monoclonal antibody secretion positive colony is cloned with limiting dilution assay.To use the mouse boosting cell and the SP2/0 cytogamy of ATF3 polypeptide immune, and merge altogether 4 times (16 96 well culture plates), cloning efficiency is about 70%, and verification and measurement ratio is more than 90%.Behind clone and subclone repeatedly, obtain a strain can stably excreting the hybridoma cell strain of mouse anti rat ATF3mAb, called after WXR.This cell strain is China's typical culture collection center preservation in Wuhan, and preserving number is CCTCC C201034, and preservation date is on June 9th, 2010.The dyed body karyotyping of WXR shows chromosome number between 80～100 (Fig. 3).This strain of hybridoma is cultivated through external continuous passage (40 generation), recovers well-grown still, antibody that can the stably excreting mouse ATF3 of the Chinese People's Anti-Japanese Military and Political College behind the liquid nitrogen cryopreservation.Above-mentioned rat ATF3 polypeptide is through the information biology software prediction; Promptly adopt the online antigen peptide forecasting software that provides of Harvard University's molecular immune foundation to dope the proteic antigenic determinant of ATF3 20 (tables-1) are arranged; Adopt the β-corner of the aminoacid sequence of the module analysis ATF3 that DNAStarProtean software provides then; Alpha-helix, wetting ability, antigenicity and in the scoring of protein surface possibility.Garnier-Robson method prediction ATF3 albumen contains 5 α spiral centers, 3 βZhe Die sections; Chou-Fasman method prediction ATF3 albumen contains 7 α spiral centers, 6 βZhe Die sections; Karplus-Schulz method prediction ATF3 albumen contains 7 flexible regions, and Kyte-Doolittle method prediction B cell antigen epi-position result shows that ATF3 albumen hydrophilic region (>=0) distributes wider; Wherein the wetting ability upper zone is mainly at 78-98,100-118 and 155-172 section.The demonstration that predicts the outcome of Plot-Emini method, the proteic 86-98 of ATF3,102-112 and 160-171 section appear at proteinic surperficial possibility bigger (>=1) (Fig. 1).Therefore; Factors such as the predicting the outcome of synthetic antigen determinant, secondary structure, wetting ability, protein surface possibility; This experimental design has also been synthesized ATF3 168-181 amino acids polypeptide NLFIQQIKEGTLQSC, corresponding to the 502-543bp base sequence, comprises the antigenic determinant (shown in black matrix part in the table 1) of the 18th, 19,20 predictions; And coupling protein KLH, molecular weight are 1722KD.The synthetic polypeptide of ATF3 is simple spike through efficient liquid phase chromatographic analysis from the visible synthetic peptide of HPLC tomographic map, and the purity of polypeptide is about 97.58%, and the result sees Fig. 2.
The proteic antigenic determinant of rat ATF3 of table 1 software prediction
2. the evaluation of subclass
With mono-clonal positive hybridoma ascites with PBS with 1: 300 dilution proportion; Get 150 μ L, the specification sheets of measuring test kit according to the mouse monoclonal antibody subclass of Roche company carries out rapid determination, and the qualification result of Ig subclass shows; The hypotype of ATF3mAb is the IgG1 type, and light chain is κ chain (Fig. 4).
3. a large amount of preparations and the purifying of monoclonal antibody
Adopt ascites to induce method manufacture order clonal antibody, the positive rate that ascites forms is more than 95%, and the output of ascites is average every mouse 5.0mL.Get female Balb/c mouse peritoneal injection in 6-8 age in week 0.5mL Yellow Protopet 2A, pneumoretroperitoneum was injected well-grown hybridoma about 5 * 10 in 10 days
6/ only, mouse web portion increases after 3-5 days, from aspiration of abdominal cavity ascites; With the centrifugal 5min of 1000-2000r/min; Draw supernatant, with the little filter filtration sterilization of 0.45 μ m, ATF3 antibody ascites concentration behind milliipore Protein A/G-PlusBeads antibody purification column purification is 0.375mg/mL.After the packing ,-70 ℃ of storages.
4. the specificity of monoclonal antibody is identified
4.1 indirect ELISA detects antibody titer
The monoclonal anti body and function PBS of titration after with purifying be doubling dilution according to a certain percentage respectively, with indirect EILSA method mensuration A450, can immunoreactive monoclonal antibody greatest dilution take place with target antigen and be it and tire.ELISA method analysis revealed, the Chinese People's Anti-Japanese Military and Political College's mouse ATF3 monoclonal antibody behind the purifying is tired >=1: 100000 (see figure 5).
Use the synthetic polypeptide, every hole adds 100 μ L (the about 2 μ g/mL of concentration) and encapsulates elisa plate, and 4 ℃ are spent the night.Discard liquid in the hole, with washings (1 * PBS contains 0.05%Tween-20) washing 3 times, each 3min.Leave and take 1 hole and add 100 μ L diluents and do outside the blank, all the other each holes add the antibody to be measured of the certain dilution of 100 μ L, and (diluent is 1 * PBS to 37 ℃ of incubation 1h, contains 0.05%Tween-20,0.1%BSA).After the washing (method is the same), every hole adds each 100 μ L of ELIAS secondary antibody (dilution in 1: 1000) of dilution, 37 ℃ of incubation 1h.The ABTS that every hole, washing back adds the new preparation of 100 μ L uses liquid, 37 ℃ of incubation 20min.Every hole adds 50 μ L 2mol/L H
2SO
4Termination reaction. survey each hole reading with the ELISA readout instrument.
4.2Western?blot
Respectively with the albumen of the rat mesangial cell in vitro (GMCs) that do not stimulate and human mesangial cell (HRMCs) and with 100 μ M H
2O
2The albumen of collecting behind GMCs that stimulates and the HRMCs 3h carries out 12%SDS-PAGE electrophoresis and Western blot; Mouse anti rat ATF3 monoclonal antibody (1: 500) is anti-as one, and the goat anti-mouse igg of HRP mark (1: 2000) resists the specificity that detects the ATF3 monoclonal antibody as two.The mouse ATF3 of the Chinese People's Anti-Japanese Military and Political College monoclonal antibody ability and the H of preparation
2O
2The protein-specific that post-stimulatory rat GMCs extracts combines, and forms positive band (Fig. 6), shows that this strain monoclonal antibody has the good proteic ability of specific recognition rat ATF3.
4.3 immunohistochemical staining
Preparation rat Thy-1N model is promptly got normal male SD rat, heavy 160-200g.The disposable injection anti-Thy-1Ab of rat tail vein, dosage are 0.75ml/100g (establishing normal rabbit serum in addition is the contrast of NS group, and dosage is with Thy-1 antibody).Respectively at 0h, 3h and 6h behind injection anti-Thy-1Ab and the NS, put to death rat, get renal cortex, sample is put in 4% Paraformaldehyde 96 fixedly paraffin embedding, makes the thick paraffin section of 4 μ m, dewaxes, and section is dipped in 3%H
2O
2In the liquid, in soaking at room temperature 30min deactivating endogenous peroxydase, with distillation washing 3 times.4 ℃ of incubated overnight of ATF3 monoclonal antibody (1: 50) of purifying.Add goat anti-mouse igg HRP after PBS develops a film, hatch 20min for 37 ℃, carry out the DAB colour developing after PBS develops a film, Hematorylin is redyed, row dehydration then, transparent, mounting processing.Microscopy amplifies 400 times and takes pictures, the record result.Immunohistochemical staining detection NS group and Thy-1N rat 0h, 3h, the proteic expression of 6h nephridial tissue ATF3.The result shows; Thy-1N 3h group, the dyeing of ATF3 monoclonal antibody is positive, Thy-1N 6h group; Positive staining intensity obviously strengthens (Fig. 7); And the endochylema karyon all is tangible pale brown look, especially nucleus dyeing comparatively significantly (like the arrow indication) and each stage of control group is not all seen the ATF3 positive staining, shows that this monoclonal antibody can be used for detecting the expression amount of ATF3 in rat tissue's specimens paraffin embedding slices.
Embodiment 2
A kind of preparation method of the mouse ATF3 of Chinese People's Anti-Japanese Military and Political College immunohistochemical staining test kit is characterized in that following steps:
According to the Monoclonal Antibody immunohistochemical staining test kit of aforementioned invention, supply to detect rat tissue's specimens paraffin embedding slices, the expression amount of ATF3 in frozen section and the rat cell creep plate.After this test kit adopts the mouse ATF3 of the Chinese People's Anti-Japanese Military and Political College monoclonal antibody (1: 50) of purifying among the present invention to dilute the back and corresponding target antigen combines; Use the HRP two anti-and anti-specific combination that test kit provided; Add the DAB colour developing then, can infer antigenic existence of rat ATF3 and distribution.But the expression of the present invention's specific detection rat ATF3, this immunohistochemical methods test kit is applicable to specimens paraffin embedding slices and cultured cells creep plate.This test kit comprises that goat-anti mouse HRPIgG two is anti-, stationary liquid, confining liquid, washings, DAB liquid.
Test kit operation instruction of the present invention is following:
1. make the thick tissue paraffin section de of 4 μ m, dewaxing;
2. section is dipped in 3%H
2O
2In the liquid, in soaking at room temperature 30min deactivating endogenous peroxydase, zero(ppm) water is washed till few 3 times; (as being the cultured cells creep plate, step is: at first with develop a film 3min * 3 time of pH7.40.01mol/L PBS, cold acetone is 8min fixedly, and 0.2%Triton x-100 changes cell 4min thoroughly, and PBS washes creep plate (or bottle 3min * 3 time; Seal 30min with 3%BSA again, surplus same paraffin section)
3. add one and resist, i.e. the mouse ATF3 of the Chinese People's Anti-Japanese Military and Political College antibody dilution in 1: 50 (containing the PBS dilution of 3%BSA) that the present invention is prepared is covered full scale originally, 4 ℃ of incubated overnight.Wash sample 3 times with washings, each 5 minutes.
4. add goat anti-mouse igg HRP two and resist 1: 2000, room temperature 30 minutes.Wash 3 times each 5 minutes with washings.
5. colour developing: drip an amount of DAB liquid on sample, develop the color 10 minutes (mirror is observed down, and pale brown color marker appears in after birth or endochylema) washes down with tap water, dries.
6. Hematorylin was redyed 5 minutes, and tap water washes down; Dry.
7. sample such as need prolonged preservation are please with neutral gum or gelatin glycerine mounting.
8. observe and judge: observation of cell under the high power lens, Taking Pictures recording result.
In addition, the immunohistochemical methods test kit that uses the present invention to measure rat ATF3 detects ATF3 expression in the GMCs cell climbing sheet of cultivating, and is about to the GMCs cell inoculation in the burnt ware of 3.5mm copolymerization, will not use H respectively
2O
2The GMCs that stimulates and with 100 μ M H
2O
2Take out behind the GMCs 3h that stimulates, sample detects the proteic expression of ATF3 among two groups of GMCs by above-mentioned tissue paraffin section de step after fixing with cold acetone again.The result shows, H
2O
2Stimulating group, positive staining intensity is higher than not stimulating group, and the endochylema karyon all is tangible pale brown look, and especially nucleus dyeing is comparatively remarkable, sees that (A is not for using H for Fig. 8
2O
2The GMCs that stimulates, B is for using H
2O
2The GMCs that stimulates).
Claims (3)
1. a hybridoma cell strain is characterized in that said hybridoma is preserved in Chinese typical culture collection center, and deposit number is CCTCC NO:C201034, and preservation date is on June 9th, 2010.
2. the monoclonal antibody of the hybridoma cell strain excretory mouse ATF3 of the Chinese People's Anti-Japanese Military and Political College according to claim 1.
3. the mouse ATF3 of Chinese People's Anti-Japanese Military and Political College immunohistochemical staining test kit is characterized in that containing the monoclonal antibody of the mouse ATF3 of the described Chinese People's Anti-Japanese Military and Political College of claim 2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201010278755XA CN102115732B (en) | 2010-09-10 | 2010-09-10 | Anti-rat ATF3 (activating transcription factor 3) monoclonal antibody secreted by hybridoma cell strain WXR |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201010278755XA CN102115732B (en) | 2010-09-10 | 2010-09-10 | Anti-rat ATF3 (activating transcription factor 3) monoclonal antibody secreted by hybridoma cell strain WXR |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102115732A CN102115732A (en) | 2011-07-06 |
| CN102115732B true CN102115732B (en) | 2012-05-30 |
Family
ID=44214658
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201010278755XA Expired - Fee Related CN102115732B (en) | 2010-09-10 | 2010-09-10 | Anti-rat ATF3 (activating transcription factor 3) monoclonal antibody secreted by hybridoma cell strain WXR |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102115732B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103122032B (en) * | 2012-12-13 | 2014-05-28 | 中国科学院生物物理研究所 | Anti-mouse-EID1 monoclonal antibody 1G10.7 and hybridoma cell line for secreting same |
| EP3601294A4 (en) * | 2017-03-22 | 2020-09-30 | Taipei Medical University | Atf3 induction compounds |
-
2010
- 2010-09-10 CN CN201010278755XA patent/CN102115732B/en not_active Expired - Fee Related
Non-Patent Citations (3)
| Title |
|---|
| 姜孝明等.大鼠ATF3 基因shRNA 真核表达质粒的构建及鉴定.《南京医科大学学报（自然科学版）》.2009,第29卷(第5期),600-604. * |
| 谢仰民等.激活转录因子3的过表达对食管癌细胞生长的抑制作用.《癌变.畸变.突变》.2009,第21卷(第4期),258-267. * |
| 马利民等.转录因子ATF/CERB家族成员———ATF3.《医学分子生物学杂志》.2007,第4卷(第2期),147-149. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102115732A (en) | 2011-07-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Choa et al. | Thymic stromal lymphopoietin induces adipose loss through sebum hypersecretion | |
| CN107149679A (en) | The aP2 and its suppressing method of secretion | |
| CN102816235B (en) | Preparation method of hybrid tumor of monoclonal antibody inhibiting common bacillus thuringiensis CryI, and application of monoclonal antibody thereof | |
| Yang et al. | Erythropoietin and erythropoietin receptor in hepatocellular carcinoma: correlation with vasculogenic mimicry and poor prognosis | |
| CN108367049A (en) | The combination preparation of PKM2 conditioning agents and HMGB1 | |
| CN102115732B (en) | Anti-rat ATF3 (activating transcription factor 3) monoclonal antibody secreted by hybridoma cell strain WXR | |
| CN113584173B (en) | Application of lncRNA SLC25A21-AS1 AS esophageal squamous cell carcinoma marker | |
| CN109468380A (en) | IL1R2 is in Prognosis in Breast Cancer assessment and the application in targeted therapy | |
| CN102796707A (en) | Monoclonal antibody hybrid tumor cell strain KGH-R1 of broad spectrum anti-human p21Ras protein and monoclonal antibody | |
| CN103626865B (en) | Secreted protein with chemotactic activity, as well as coding sequence and medicament usage thereof | |
| WO2017201448A1 (en) | Animal models for psoriasis and screening methods | |
| Zhang et al. | TL1A/DR3 Axis, A Key Target of TNF-a, Augments the Epithelial–Mesenchymal Transformation of Epithelial Cells in OVA-Induced Asthma | |
| CN106380522A (en) | Eukaryotic recombinant protein for specifically inhibiting activity of STAT3, and preparation method and application thereof | |
| CN103382220A (en) | Cell factor FAM19A4 with anti-infection and antineoplastic activity and application thereof | |
| CN103204921A (en) | Secretory protein with chemotactic activity, and coding sequence and application thereof | |
| CN102818896B (en) | Detection method of nitration modification sites based on specific antibodies and antibody capable of specifically recognizing succinyl-CoA: 3-oxoacid CoA transferase (SCOT) nitration sites | |
| CN111066727B (en) | Method for constructing mouse model of action mechanism in permeability of hypoxic blood testis barrier | |
| CN111996251B (en) | Application of malignant glioma biomarker | |
| CN103947606A (en) | Non-human mammal model with input UCP1-1cuiferase (uncoupling protein 1-1cuiferase) gene as well as construction method and application thereof | |
| CN101041820A (en) | Macrophagocyte transfer inhibition factor monoclonal antibody and method for making same | |
| CN101161283B (en) | New use of CMTM1-v17 and its antagon | |
| CN108118061A (en) | Epinephelus coioides innate immunity receptor TLR22 genes and its carrier for expression of eukaryon and application | |
| CN103172744A (en) | Monoclonal antibodies for specifically identifying B-Raf mutant proteins, preparation method and applications thereof | |
| Marchbank et al. | Human pancreatic secretory trypsin inhibitor stabilizes intestinal mucosa against noxious agents | |
| Li et al. | Salidroside Inhibits Ganglion Cell Apoptosis by Suppressing the Müller Cell Inflammatory Response in Diabetic Retinopathy |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120530 Termination date: 20130910 |