CN109609479B

CN109609479B - Aspergillus usamii epoxide hydrolase mutant with improved enantioselectivity

Info

Publication number: CN109609479B
Application number: CN201811633720.6A
Authority: CN
Inventors: 邬敏辰; 苏永君; 王婷婷; 徐雄峰; 文正; 胡博淳; 胡蝶; 李剑芳
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2018-12-29
Filing date: 2018-12-29
Publication date: 2021-07-27
Anticipated expiration: 2038-12-29
Also published as: CN109609479A

Abstract

The invention discloses an aspergillus usamii epoxide hydrolase mutant with improved enantioselectivity, belonging to the technical field of enzyme engineering and biocatalysis. The invention carries out molecular modification on Aspergillus usamii epoxide hydrolase (AuEH2) based on rational design, and combines a fixed-point saturation mutation method of genes to obtain a plurality of epoxide hydrolase mutants with improved enantioselectivity. The 9 mutants with improved enantioselectivity obtained by the invention catalyze the enantiomer ratios (E values) of racemic p-methylphenyl glycidyl ether (rac-pMPGE) to be respectively improved from 12.7 to 32.4, 31.1, 27.8, 25.8, 23.5, 22.4, 20.2, 14.1 and 13.6 compared with the wild type.

Description

Aspergillus usamii epoxide hydrolase mutant with improved enantioselectivity

Technical Field

The invention relates to an aspergillus usamii epoxide hydrolase mutant with improved enantioselectivity, belonging to the technical field of enzyme engineering and biocatalysis.

Background

The chiral epoxide and the vicinal diol are important intermediates for synthesizing various active substances in the industries of chiral drugs, agriculture, spices, fine chemical engineering and the like, and have wide application prospect and market demand. The chiral compound with optical activity has unique property different from raceme, and has different metabolic path, metabolic rate, pharmacology, toxicity, etc. in organism, so that it has new and special use in chemical and life science industry. The "stop response" of the world in the 20 th century, the 60 s, has fully demonstrated the necessity to obtain optically pure compounds. The traditional chemical method for separating epoxide usually needs heavy metal toxic substances as catalysts, so that the method not only faces huge environmental challenges, but also is difficult to obtain chiral pure compounds with high yield. Epoxide Hydrolases (EHs) are a class of hydrolases that catalyze the stereoselective hydrolysis of addition epoxides of water molecules to the corresponding 1, 2-diols, a typical alpha/beta sheet hydrolase. However, EHs from different sources have very different properties, and microorganisms with EHs activity screened from nature often have the defects of low enzyme-producing activity, low enantioselectivity, poor stability and the like, and often cannot meet the requirements of industrial application.

Currently, the most studied microorganisms EH are mainly from Aspergillus niger (Aspergillus niger), Rhodotorula glutinis (Rhodotorula glutinis), Agrobacterium radiobacter (Agrobacterium radiobacter AD1), Sphingomonas sp, and Bacillus sp, and these EHs have high catalytic activity and high enantioselectivity for some specific substrates. In recent years, molecular biology techniques such as site-directed mutagenesis, saturation mutagenesis, error-prone PCR, and DNA shuffling have also been used to modify EHs for its catalytic activity, stability, enantioselectivity, etc., and to obtain superior mutant enzymes by high-throughput screening.

A technical scheme for realizing heterologous expression of an epoxide hydrolase (AuEH2) derived from Aspergillus usamii (Aspergillus usamii) in Escherichia coli E.coli BL21(DE3) is available (disclosed in the patent application with the publication number CN 102994470A), and the epoxide hydrolase can catalyze a plurality of epoxides to prepare chiral epoxides with high optical purity by enantioselective hydrolysis kinetics (J Ind Microbiol Biotechnol,2015, 42(5): 671-680). However, the recombinase has low enantioselectivity to epoxide, thereby limiting the application potential of the recombinase in chiral synthesis of high value-added prodrugs.

Disclosure of Invention

In view of the above-mentioned drawbacks of the prior art, the first technical problem to be solved by the present invention is to provide an epoxide hydrolase (AuEH2) mutant with improved enantioselectivity, wherein the mutant is (a) or (b):

(a) on the basis of the sequence shown in SEQ ID NO.1, alanine (A) at position 250 is mutated into histidine (H), arginine (R), glycine (G), lysine (K), asparagine (N), aspartic acid (D), glutamic acid (E), glutamine (Q) or proline (P);

(b) and (b) a protein derived from (a) by substituting, deleting or adding one or more amino acids in the amino acid sequence defined in (a) and having epoxide hydrolase activity.

It is a second object of the present invention to provide a gene encoding the mutant.

It is a third object of the present invention to provide a vector or cell carrying the gene.

The fourth purpose of the invention is to provide a genetic engineering bacterium for expressing the AuEH2 mutant, which expresses the epoxide hydrolase mutant by taking pET series plasmids as a vector and taking escherichia coli as a host.

In one embodiment of the invention, the expression host is e.coli BL21(DE 3).

The fifth purpose of the invention is to provide a method for constructing the genetic engineering bacteria, which is to connect the gene for coding the mutant with a vector and transform the gene into a host cell.

In one embodiment of the present invention, the recombinant plasmid carrying the gene encoding Aspergillus usamii AuEH2 is pET-28a (+) carrying the gene encoding Aspergillus usamii AuEH2, which is disclosed in patent application publication No. CN 102994470A.

The sixth purpose of the invention is to provide a method for preparing the AuEH2 mutant, which is to culture the seed liquid of the genetically engineered bacteria expressing the AuEH2 mutant in LB culture medium containing kanamycin resistance to the middle and later logarithmic phase, and add IPTG to induce the highly efficient expression of the AuEH2 mutant of the recombinant gene.

In one embodiment of the invention, the method is to inoculate the genetically engineered bacteria into LB culture medium and induce IPTG for 6-8 h at 25-28 ℃.

In one embodiment of the invention, the method is to inoculate the genetically engineered bacteria into LB culture medium and induce IPTG for 8h under the condition of 25 ℃.

The invention also provides a method for producing (R) -p-methylphenyl glycidyl ether by using the AuEH2 mutant, which is to catalyze racemic p-methylphenyl glycidyl ether to generate (R) -p-methylphenyl glycidyl ether in a buffer system by using the mutant or genetic engineering bacteria expressing the mutant as a catalyst.

In one embodiment of the present invention, the buffer system may be a single aqueous phase or a biphasic system of aqueous and organic phases.

In one embodiment of the present invention, the AuEH2 mutant is added to the reaction system in an amount of 0.4 to 1mg of bacterial cells/mM of p-methylphenyl glycidyl ether.

In one embodiment of the invention, the conversion condition is that the reaction is carried out at 20-28 ℃ for 5-40 min.

The invention also claims the application of the mutant in preparing products containing (R) -p-methylphenyl glycidyl ether.

Has the advantages that: the invention carries out molecular modification on Aspergillus usamii epoxide hydrolase (AuEH2) based on rational design, and combines a fixed-point saturation mutation method of genes to obtain a plurality of epoxide hydrolase mutants with improved enantioselectivity. The invention obtains 9 mutants with improved enantioselectivity: AuEH2^A250H、AuEH2^A250R、 AuEH2^A250G、AuEH2^A250K、AuEH2^A250N、AuEH2^A250D、AuEH2^A250E、AuEH2^A250QAnd AuEH2^A250PThe catalytic racemic p-methylphenyl glycidyl ether (rac-pMPGE) has enantiomer ratios (E values) of 32.4, 31.1, 27.8, 25.8, 23.5, 22.4, 20.2, 14.1 and 13.6 respectively. Application of the AuEH2 mutant in producing enantiomeric excess (ee value) of (R) -p-methylphenyl glycidyl ether by splitting racemic p-methylphenyl glycidyl ether through hydrolysis kinetics>99 percent. The mutant provided by the invention has high enantiomerThe selectivity is favorable for improving the enantiomeric purity and the yield of the catalytic products of the chiral epoxide and the vicinal diol, thereby reducing the production cost and having larger application potential.

Drawings

FIG. 1 shows a comparison of enzyme activities of AuEH2(WT) and AuEH2 mutant.

FIG. 2 AuEH2(WT) and AuEH2 mutant enantiomer ratios (E).

Detailed Description

(R, S) -pMPGE was purchased from Shanghai TCI; (S) -pMPGE and (R) -pMPGE were purchased from Shanghai' an Ji-resistant company; other reagents were analytically pure. Chiral liquid chromatography column 0D-H (4.6 mm. times.250 mm. times.5 μm) is a product of Waters technologies, USA.

The analysis conditions were: chiral column OD-H, chromatographic conditions 90:10,220nm, retention times of (R) -p-methylphenyl glycidyl ether and (S) -p-methylphenyl glycidyl ether were 7.556 min and 8.811min, respectively. Substrate e.e._s＝[(R-S)/(R+S)]X is 100%; product e.e._p＝[(S-R)/(R+S)]×100％；E＝ln[(1-e.e._s)×(1+e.e._s/e.e._p)]/ln[(1+e.e._s)/(1+e.e._s/ e.e._p)]. Wherein: r and S represent (R) -and (S) -p-methylphenyl glycidyl ether.

Example 1: site-directed saturation mutagenesis

(1) Using recombinant plasmid pET-28a (+) -Aueh2 (the construction method is disclosed in the patent application of the patent publication No. CN 102994470A) as a template, and A250X-F and pET28-R as primers, carrying out a first round of PCR amplification (95 ℃ for 4 min; 98 ℃ for 10s, 55 ℃ for 5s, 72 ℃ for 3min, 30 cycles; 72 ℃ for 10min) by using PrimeSTAR DNA polymerase (purchased from TaKaRa) to obtain a section of large primer A250X-1 st; carrying out second round PCR amplification (95 ℃ for 4min, 98 ℃ for 10s, 55 ℃ for 15s, 72 ℃ for 3min, 25 cycles, 72 ℃ for 10min) by using the large primer A250X-1st as a primer and the recombinant plasmid pET-28a (+) -Aueh2 as a template; A250X-2st PCR product is digested by Dpn I (25 ℃, overnight) template pET-28a (+) -Aueh2, E.coli BL21(DE3) competent cells are transformed, and kanamycin-resistant LB plate is coated to be cultured for 12-16h at 37 ℃, so as to obtain a recombinant sub-library.

A250X-F：

pET28-R：GCCTTACTGGTTAGCAGAATG

Where N represents A, T, C and G arbitrary bases and K represents T or G bases, the codon can encode 20 random amino acids, and only 94 recombinants need to be screened for > 95% coverage.

(2) Selecting 96 single colonies of the LB plate, culturing at 37 ℃ for 12h in a kanamycin-resistant LB culture medium, adding 20% (v/v) glycerol into one part of culture solution for seed preservation, preserving at-80 ℃, transferring the other part of culture solution into a fresh 96-well deep-well plate containing 1mL of LB culture medium containing kanamycin resistance in an inoculation amount of 2%, culturing at 37 ℃ for 2h, adding 0.2mM IPTG inducer, culturing at 25 ℃ for 8h, inducing high-efficiency expression of recombinant genes, centrifuging the recombinant cells at 8000 rpm for 5min, collecting the bacteria, and preserving at-80 ℃. E.coli/pET-28a (+) -Aueh2 recombinant bacteria were obtained by the same induction method as a positive control, and E.coli/pET-28a recombinant bacteria were obtained as a blank control.

(3) The obtained recombinant cells were suspended in 1mL of 50mM potassium phosphate buffer (pH 7.0), 500. mu.L of the suspension was used to catalyze racemic p-methylphenyl glycidyl ether, and the enzyme activity was preliminarily screened by spectrophotometry using nitrobenzyl pyridine (NBP), whereby 36 mutants having epoxide hydrolase activity were obtained (the results are shown in FIG. 1).

Example 2

The enantioselectivity of the 36 mutants prepared in example 1 was determined by chiral liquid chromatography. The bacterial suspension having the epoxide hydrolase mutant prepared in example 1 was centrifuged to collect bacterial cells. 5mg of wet cells and 900. mu.L of potassium phosphate buffer (pH 7.0) were added to a 1.5mL EP tube, and the mixture was incubated at 25 ℃ for 10min, followed by addition of 100. mu.L of rac-pMPGE (final concentration: 20mmol/L) for reaction. Samples were taken periodically from 100. mu.L to 1mL of ethyl acetate and extracted by liquid chromatography, Waters-2695 (Waters corporation, USA), chiral liquid chromatography and UV detector.

The results are shown in FIG. 2. Mutant AuEH2^A250H、AuEH2^A250R、AuEH2^A250G、AuEH2^A250K、AuEH2^A250N、 AuEH2^A250D、AuEH2^A250E、AuEH2^A250QAnd AuEH2^A250PThe enantiomer ratio (E value) of the catalytic racemic p-methylphenyl glycidyl ether (rac-pTO) is increased from 12.7 to 32.4, 31.1, 27.8, 25.8, 23.5, 22.4, 20.2, 14.1 and 13.6 respectively. Among them, AuEH2^A250ECompared with the starting enzyme, the enzyme activity is improved by 13 percent.

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

SEQUENCE LISTING

<110> university of south of the Yangtze river

<120> A Aspergillus usamii epoxide hydrolase mutant with improved enantioselectivity

<160> 3

<170> PatentIn version 3.3

<210> 1

<211> 395

<212> PRT

<213> Aspergillus usamii

<400> 1

Met Ala Leu Ala Tyr Ser Asn Ile Pro Leu Gly Ala Thr Val Ile Pro

1 5 10 15

Ser Pro Phe Gln Val His Ile Ser Asp Glu Gln Ile Glu Glu Leu Gln

20 25 30

Leu Leu Val Lys Leu Ser Lys Leu Ala Pro Pro Thr Tyr Glu Gly Leu

35 40 45

Gln Gln Asp Arg Arg Tyr Gly Ile Thr Asn Glu Trp Leu Ala Asn Ala

50 55 60

Lys Glu Ala Trp Lys Ser Phe Asp Trp Arg Pro Ala Glu Ser Arg Ile

65 70 75 80

Asn Ser Phe Pro Gln Phe Thr Tyr Asp Ile Glu Gly Leu Thr Ile His

85 90 95

Phe Val Ala Leu Phe Ser Glu Lys Lys Asp Ala Ile Pro Ile Val Leu

100 105 110

Leu His Gly Trp Pro Gly Ser Phe Leu Glu Phe Leu Pro Val Leu Thr

115 120 125

Ser Ile Arg Asp Lys Tyr Ser Pro Glu Thr Leu Pro Tyr His Ile Val

130 135 140

Val Pro Ser Leu Pro Gly Tyr Thr Phe Ser Ser Gly Pro Pro Leu Asp

145 150 155 160

Val Asn Phe Asn Gly Glu Asp Thr Ala Arg Val Ile Asn Lys Val Met

165 170 175

Leu Asn Leu Gly Phe Glu Asp Gly Tyr Val Ala Gln Gly Gly Asp Ile

180 185 190

Gly Ser Lys Ile Gly Arg Ile Leu Ala Val Asp His Asp Ala Cys Lys

195 200 205

Ala Val His Leu Asn Ala Cys Tyr Met Gly Lys Pro Ser Ser Ile Pro

210 215 220

Asp Thr Ala Ile Thr Glu Glu Asp Lys Arg Ala Leu Ala Arg Ala Gln

225 230 235 240

Trp Phe Ala Thr Phe Gly Ser Gly Tyr Ala Val Glu His Gly Thr Arg

245 250 255

Pro Ser Thr Ile Gly Asn Ala Leu Ser Thr Ser Pro Val Ala Leu Leu

260 265 270

Ser Trp Ile Gly Glu Lys Phe Leu Asp Trp Ala Gly Glu Thr Ile Pro

275 280 285

Leu Glu Thr Ile Leu Glu Ser Val Thr Leu Tyr Trp Phe Thr Glu Thr

290 295 300

Phe Pro Arg Ser Ile Tyr His Tyr Arg Glu Asn Phe Pro Pro Pro Lys

305 310 315 320

Leu Arg His Thr Glu Asp Pro Arg Trp Tyr Ile Arg Lys Pro Phe Gly

325 330 335

Phe Ser Tyr Tyr Pro Met Glu Leu Val Pro Thr Pro Arg Ala Trp Val

340 345 350

Glu Thr Thr Gly Asn Leu Val Phe Trp Gln Ala His Glu Lys Gly Gly

355 360 365

His Phe Ala Ala Leu Glu Arg Pro Gln Asp Tyr Leu Asp Asp Leu Thr

370 375 380

Ala Phe Cys Glu Gln Val Trp Ala Gly Arg Lys

385 390 395

<210> 2

<211> 32

<212> DNA

<213> Artificial sequence

<220>

<221> misc_feature

<222> (16)..(17)

<223> n is a, c, g, or t

<400> 2

tttggcagtg gttacnnkgt cgagcatggt ac 32

<210> 3

<211> 21

<212> DNA

<213> Artificial sequence

<400> 3

gccttactgg ttagcagaat g 21

Claims

1. A process for producingR) A method for preparing p-methylphenyl glycidyl ether, which is characterized in that racemic p-methylphenyl glycidyl ether is catalyzed in a buffer system by an epoxide hydrolase AuEH2 mutant with improved enantioselectivity or a genetically engineered bacterium expressing an epoxide hydrolase AuEH2 mutant with improved enantioselectivity;

the epoxide hydrolase AuEH2 mutant with improved enantioselectivity is obtained by mutating alanine at position 250 to glutamic acid on the basis of a sequence shown in SEQ ID NO. 1;

the genetic engineering bacteria express the epoxide hydrolase AuEH2 mutant by taking pET series plasmids as a vector and taking escherichia coli as a host.

2. The method according to claim 1, wherein the buffer system is a single aqueous phase or a biphasic system of an aqueous phase and an organic phase.

3. The method of claim 1 or 2, wherein racemic p-methylphenyl glycidyl ether is chirally biocatalytically producedR) -p-methylphenyl glycidyl ether.