CN109609479A - A kind of Aspergillus usamii epoxide hydrolase mutant that enantioselectivity improves - Google Patents
A kind of Aspergillus usamii epoxide hydrolase mutant that enantioselectivity improves Download PDFInfo
- Publication number
- CN109609479A CN109609479A CN201811633720.6A CN201811633720A CN109609479A CN 109609479 A CN109609479 A CN 109609479A CN 201811633720 A CN201811633720 A CN 201811633720A CN 109609479 A CN109609479 A CN 109609479A
- Authority
- CN
- China
- Prior art keywords
- mutant
- aueh2
- epoxide hydrolase
- leu
- enantioselectivity
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P41/00—Processes using enzymes or microorganisms to separate optical isomers from a racemic mixture
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
- C12P7/22—Preparation of oxygen-containing organic compounds containing a hydroxy group aromatic
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y303/00—Hydrolases acting on ether bonds (3.3)
- C12Y303/02—Ether hydrolases (3.3.2)
- C12Y303/02003—Epoxide hydrolase (3.3.2.3)
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses the Aspergillus usamii epoxide hydrolase mutant that a kind of enantioselectivity improves, and belong to enzyme engineering and biocatalysis technology field.The present invention is based on design and rationals to carry out molecular modification to Aspergillus usamii (Aspergillus usamii) epoxide hydrolase (AuEH2), in conjunction with the fixed point saturation mutation method of gene, the epoxide hydrolase mutant that multiple enantioselectivities improve is obtained.The enantiomer ratio (E value) for mutant catalysis racemic p-methylphenyl glycidol ether (rac-pMPGE) that 9 enantioselectivities that the present invention obtains improve compares wild type, is respectively increased from 12.7 to 32.4,31.1,27.8,25.8,23.5,22.4,20.2,14.1,13.6.
Description
Technical field
The present invention relates to the Aspergillus usamii epoxide hydrolase mutant that a kind of enantioselectivity improves, and belong to enzyme work
Journey and biocatalysis technology field.
Background technique
Chiral epoxides and vicinal diamines are the various activity of the industries such as synthesis of chiral drug, agricultural, fragrance and fine chemistry industry
The important intermediate of substance, has broad application prospects and the market demand.Photoactive chipal compounds have different from outer
The peculiar property of raceme, the difference of metabolic pathway, metabolic rate, pharmacology and toxicity in vivo etc., makes it
There is brand-new and special purposes in chemistry and life sciences industry.In the 1960s, world-shaking " reaction stops event "
The necessity for obtaining optical pure compound is absolutely proved.Traditional chemical method splits epoxides and generally requires heavy metal classes
Noxious material is not only faced with the huge challenge of environment as catalyst, and is difficult to obtain the chiral purity compound of high yield.Ring
Oxide hydrolase (Epoxide hydrolases, EHs) is the addition epoxides of a kind of catalytic water molecular stereo selectivity
It is hydrolyzed to the hydrolase of corresponding 1,2- glycol, is a kind of typical α/β folded form hydrolase.However, the EHs of separate sources
There is very big difference in property, what nature screened there is the active microorganism of EHs often there is producing enzyme low, mapping choosing living
The defects of selecting property is lower and stability is poor, tends not to meet the needs of industrial applications.
Currently, studying more microorganism EH mostlys come from aspergillus niger (Aspergillus niger), glutinous rhodotorula
(Rhodotorula glutinis), agrobacterium radiobacter (Agrobacterium radiobacter AD1), sphingol list
Born of the same parents Pseudomonas (Sphingomonas sp.) and bacillus (Bacillus sp.), these EH have some specific substrates
There are higher catalytic activity and high enantioselectivity.In recent years, Protocols in Molecular Biology, easily such as rite-directed mutagenesis, saturation mutation, mistake
PCR and DNA shuffling etc. is also used for the properties such as catalytic activity, stability, the enantioselectivity of transformation EHs, and passes through height
Flux screening obtains excellent mutant enzyme.
The epoxide hydrolase (AuEH2) in existing source Aspergillus usamii (Aspergillus usamii) is big at present
Realize that the technical solution of heterogenous expression (is disclosed in the special of publication number CN102994470A in enterobacteria E. coli BL21 (DE3)
In benefit application), the epoxide hydrolase can enantioselective hydrolysis dynamics be catalyzed a variety of epoxides and prepare high optical voidness
Chiral epoxides (J Ind Microbiol Biotechnol, 2015,42 (5): 671-680).But the recombinase is to ring
The enantioselectivity of oxide is not high, so that it is latent to limit its application in the chiral synthesis of high added value prodrug
Power.
Summary of the invention
In view of the foregoing defects the prior art has, the invention solves first technical problem be to provide a kind of mapping
Epoxide hydrolase (AuEH2) mutant selectively improved, the mutant are (a) or (b):
(a) in the sequence basis shown in SEQ ID NO.1, the 250th alanine (A) is sported into histidine (H), smart ammonia
Sour (R), glycine (G), lysine (K), asparagine (N), aspartic acid (D), glutamic acid (E), glutamine (Q) or dried meat
Propylhomoserin (P)；
(b) by replacing, lacking or add one or several amino acid and having in the amino acid sequence that (a) is limited
The protein as derived from (a) of epoxide hydrolase activity.
A second object of the present invention is to provide the genes for encoding the mutant.
Third object of the present invention is to provide the carriers or cell that carry the gene.
Fourth object of the present invention is to provide a kind of genetic engineering bacterium for expressing the AuEH2 mutant, with pET series
Plasmid is carrier, is host with Escherichia coli, expresses the epoxide hydrolase mutant.
In one embodiment of the invention, the expressive host is E.coli BL21 (DE3).
Fifth object of the present invention is to provide the methods for constructing the genetic engineering bacterium, will encode the mutant
Gene is connect with carrier, is converted into host cell.
In one embodiment of the invention, the recombinant plasmid of the gene for carrying coding Aspergillus usamii AuEH2
It is the pET-28a (+) for carrying the gene of coding Aspergillus usamii AuEH2, which has been disclosed in publication number
In the patent application of CN102994470A.
It is that will express the AuEH2 to dash forward sixth object of the present invention is to provide the method for preparing the AuEH2 mutant
IPTG induction is added with the LB culture medium culture containing kalamycin resistance to logarithm middle and later periods in the genetic engineering bacterium seed liquor of variant
The high efficient expression AuEH2 mutant of recombination.
In one embodiment of the invention, the method is that the genetic engineering bacterium is seeded in LB culture medium,
IPTG induces 6~8h under the conditions of 25~28 DEG C.
In one embodiment of the invention, the method is that the genetic engineering bacterium is seeded in LB culture medium,
IPTG induces 8h under the conditions of 25 DEG C.
The present invention also provides a kind of sides of application AuEH2 mutant production (R)-p-methylphenyl glycidol ether
Method is that racemic is catalyzed in buffer system using the genetic engineering bacterium of the mutant or the expression mutant as catalyst
P-methylphenyl glycidol ether generates (R)-p-methylphenyl glycidol ether.
In one embodiment of the invention, the buffer system can be single water phase or water phase and organic phase is constituted
Diphasic system.
In one embodiment of the invention, the AuEH2 mutant is with 0.4~1mg thallus/mM p-methylphenyl contracting
The additive amount of water glycerin ether is added into reaction system.
In one embodiment of the invention, the conversion condition is to react 5~40min at 20~28 DEG C.
The mutant is also claimed in the product of preparation glycidol ether Han (R)-p-methylphenyl in the present invention
Using.
The utility model has the advantages that the present invention is based on design and rationals to Aspergillus usamii (Aspergillus usamii) epoxides water
It solves enzyme (AuEH2) and carries out molecular modification, in conjunction with the fixed point saturation mutation method of gene, obtain the ring that multiple enantioselectivities improve
Oxide hydrolyzes enzyme mutant.The mutant that 9 enantioselectivities that the present invention obtains improve: AuEH2A250H、AuEH2A250R、
AuEH2A250G、AuEH2A250K、AuEH2A250N、AuEH2A250D、AuEH2A250E、AuEH2A250QAnd AuEH2A250PIt is catalyzed racemic pair
The enantiomer ratio (E value) of methylphenylglycidyl ether (rac-pMPGE) is respectively 32.4,31.1,27.8,25.8,
23.5,22.4,20.2,14.1,13.6.It contracts using the AuEH2 mutant hydrolytic kinetic resolution racemic p-methylphenyl
The enantiomeric excess rate (ee value) > 99% of water glycerin ether production (R)-p-methylphenyl glycidol ether.The invention provides prominent
The characteristics of variant high enantioselectivity, be conducive to the enantiomeric purity and the production that improve its catalysate chiral epoxides and vicinal diamines
Rate has larger application potential to reduce production cost.
Detailed description of the invention
Fig. 1 is AuEH2 (WT) compared with the enzyme activity of AuEH2 mutant.
The position Fig. 2 AuEH2 (WT) and AuEH2 mutant enantiomer ratio (E).
Specific embodiment
(R, S)-pMPGE is purchased from Shanghai TCI company；(S)-pMPGE and (R)-pMPGE is purchased from Shanghai Ann Kyrgyzstan company；Its
His reagent is that analysis is pure.Chiral liquid chromatography column 0D-H (4.6mm × 250mm × 5 μm) is the production of U.S. Waters scientific & technical corporation
Product.
Analysis condition are as follows: chiral column OD-H, chromatographic condition 90:10,220nm, (R)-p-methylphenyl glycidol ether and
(S)-p-methylphenyl glycidol ether retention time is respectively 7.556 and 8.811min.Substrate e.e.s=[(R-S)/(R
+ S)] × 100%；Product e.e.p=[(S-R)/(R+S)] × 100%；E=ln [(1-e.e.s)×(1+e.e.s/
e.e.p)]/ln[(1+e.e.s)/(1+e.e.s/ e.e.p)].Wherein: it is sweet that R and S indicates that (R)-and (S)-p-methylphenyl shrink
Oily ether.
Embodiment 1: fixed point saturation mutation
(1) with recombinant plasmid pET-28a (+)-Aueh2, (construction method is special referring to patent publication No. CN102994470A's
Benefit application) it is template, A250X-F and pET28-R are primer, are carried out using PrimeSTAR archaeal dna polymerase (being purchased from TaKaRa)
First round PCR amplification (95 DEG C of 4min；98 DEG C of 10s, 55 DEG C of 5s, 72 DEG C of 3min, 30 circulations；72 DEG C of 10min) obtain one section greatly
Primer A250X-1st；Using big primer A250X-1st as primer, recombinant plasmid pET-28a (+)-Aueh2 is that template carries out the
Two wheel PCR amplification (95 DEG C of 4min；98 DEG C of 10s, 55 DEG C of 15s, 72 DEG C of 3min, 25 circulations；72℃10 min)；A250X-2st
PCR product Transformed E .coli BL21 (DE3) competence after Dpn I digestion (25 DEG C, overnight) template pET-28a (+)-Aueh2
Cell is coated with 37 DEG C of culture 12-16h of kalamycin resistance LB plate, obtains recombination sublibrary.
A250X-F:
PET28-R:GCCTTACTGGTTAGCAGAATG
Wherein N represents any base of A, T, C and G, and K represents T or G base, and simultaneously random 20 kinds of codon codified of the simplicity
Amino acid need to only screen the coverage rate that 94 recons may include > 95%.
(2) 96 single bacteriums of the above-mentioned LB plate of picking fall within 37 DEG C of culture 12h in kalamycin resistance LB culture medium, a part
Culture solution adds 20% (v/v) glycerol conservation, -80 DEG C of preservations, and another part culture solution is forwarded to fresh dress with 2% inoculum concentration
In the deep-well plates for there are 96 holes of the LB culture medium of 1mL containing kalamycin resistance, after cultivating 2h under the conditions of 37 DEG C, 0.2mM is added
25 DEG C of culture 8h of IPTG inducer, induce the high efficient expression of recombination, bacterium is collected by centrifugation through 8 000rpm, 5min in recombinant cell
Body, -80 DEG C of preservations.Using same abductive approach acquisition E.coli/pET-28a (+)-Aueh2 recombination thallus as positive control,
E.coli/pET-28a recombinates thallus as blank control.
(3) the 50mM kaliumphosphate buffer (pH=7.0) that 1mL is added in the recombination thallus of acquisition is suspended, 500 μ L bacteria suspensions
For being catalyzed racemic p-methylphenyl glycidol ether, enzyme activity is carried out using the spectrophotometry of nitrobenzylpyridine (NBP)
Property carry out preliminary screening, obtain 36 mutons with epoxide hydrolase activity (result is as shown in Figure 1).
Embodiment 2
Using the enantioselectivity of 36 mutons prepared by Chiral liquid chromatography measurement embodiment 1.It prepared by embodiment 1
With epoxide hydrolase muton bacteria suspension centrifugation, collect thallus.In 1.5mL EP pipe be added 5mg wet thallus and
900 μ L kaliumphosphate buffers (pH 7.0), 25 DEG C of heat preservation 10min add 100 μ L rac-pMPGE (final concentration 20mmol/
L it) is reacted.100 μ L of timing sampling is extracted into 1mL ethyl acetate, and sample analysis uses liquid chromatograph Waters-
2695 (Waters, USs), Chiral liquid chromatography column and UV detector.
As a result as shown in Figure 2.Mutant AuEH2A250H、AuEH2A250R、AuEH2A250G、AuEH2A250K、AuEH2A250N、
AuEH2A250D、AuEH2A250E、AuEH2A250QAnd AuEH2A250PIt is catalyzed racemic p-methylphenyl glycidol ether (rac-pTO)
Enantiomer ratio (E value) be respectively increased to 32.4 from 12.7,31.1,27.8,25.8,23.5,22.4,20.2,14.1,
13.6.Wherein, AuEH2A250ECompared with the enzyme that sets out, enzyme activity improves 13%.
Although the present invention has been described by way of example and in terms of the preferred embodiments, it is not intended to limit the invention, any to be familiar with this skill
The people of art can do various change and modification, therefore protection model of the invention without departing from the spirit and scope of the present invention
Enclosing subject to the definition of the claims.
SEQUENCE LISTING
<110>Southern Yangtze University
<120>the Aspergillus usamii epoxide hydrolase mutant that a kind of enantioselectivity improves
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 395
<212> PRT
<213>Aspergillus usamii
<400> 1
Met Ala Leu Ala Tyr Ser Asn Ile Pro Leu Gly Ala Thr Val Ile Pro
1 5 10 15
Ser Pro Phe Gln Val His Ile Ser Asp Glu Gln Ile Glu Glu Leu Gln
20 25 30
Leu Leu Val Lys Leu Ser Lys Leu Ala Pro Pro Thr Tyr Glu Gly Leu
35 40 45
Gln Gln Asp Arg Arg Tyr Gly Ile Thr Asn Glu Trp Leu Ala Asn Ala
50 55 60
Lys Glu Ala Trp Lys Ser Phe Asp Trp Arg Pro Ala Glu Ser Arg Ile
65 70 75 80
Asn Ser Phe Pro Gln Phe Thr Tyr Asp Ile Glu Gly Leu Thr Ile His
85 90 95
Phe Val Ala Leu Phe Ser Glu Lys Lys Asp Ala Ile Pro Ile Val Leu
100 105 110
Leu His Gly Trp Pro Gly Ser Phe Leu Glu Phe Leu Pro Val Leu Thr
115 120 125
Ser Ile Arg Asp Lys Tyr Ser Pro Glu Thr Leu Pro Tyr His Ile Val
130 135 140
Val Pro Ser Leu Pro Gly Tyr Thr Phe Ser Ser Gly Pro Pro Leu Asp
145 150 155 160
Val Asn Phe Asn Gly Glu Asp Thr Ala Arg Val Ile Asn Lys Val Met
165 170 175
Leu Asn Leu Gly Phe Glu Asp Gly Tyr Val Ala Gln Gly Gly Asp Ile
180 185 190
Gly Ser Lys Ile Gly Arg Ile Leu Ala Val Asp His Asp Ala Cys Lys
195 200 205
Ala Val His Leu Asn Ala Cys Tyr Met Gly Lys Pro Ser Ser Ile Pro
210 215 220
Asp Thr Ala Ile Thr Glu Glu Asp Lys Arg Ala Leu Ala Arg Ala Gln
225 230 235 240
Trp Phe Ala Thr Phe Gly Ser Gly Tyr Ala Val Glu His Gly Thr Arg
245 250 255
Pro Ser Thr Ile Gly Asn Ala Leu Ser Thr Ser Pro Val Ala Leu Leu
260 265 270
Ser Trp Ile Gly Glu Lys Phe Leu Asp Trp Ala Gly Glu Thr Ile Pro
275 280 285
Leu Glu Thr Ile Leu Glu Ser Val Thr Leu Tyr Trp Phe Thr Glu Thr
290 295 300
Phe Pro Arg Ser Ile Tyr His Tyr Arg Glu Asn Phe Pro Pro Pro Lys
305 310 315 320
Leu Arg His Thr Glu Asp Pro Arg Trp Tyr Ile Arg Lys Pro Phe Gly
325 330 335
Phe Ser Tyr Tyr Pro Met Glu Leu Val Pro Thr Pro Arg Ala Trp Val
340 345 350
Glu Thr Thr Gly Asn Leu Val Phe Trp Gln Ala His Glu Lys Gly Gly
355 360 365
His Phe Ala Ala Leu Glu Arg Pro Gln Asp Tyr Leu Asp Asp Leu Thr
370 375 380
Ala Phe Cys Glu Gln Val Trp Ala Gly Arg Lys
385 390 395
<210> 2
<211> 32
<212> DNA
<213>artificial sequence
<220>
<221> misc_feature
<222> (16)..(17)
<223> n is a, c, g, or t
<400> 2
tttggcagtg gttacnnkgt cgagcatggt ac 32
<210> 3
<211> 21
<212> DNA
<213>artificial sequence
<400> 3
gccttactgg ttagcagaat g 21
Claims (10)
1. the epoxide hydrolase AuEH2 mutant that a kind of enantioselectivity improves, which is characterized in that the mutant is
(a) or (b):
(a) in the sequence basis shown in SEQ ID NO.1, the 250th alanine (A) is sported into histidine (H), arginine
(R), glycine (G), lysine (K), asparagine (N), aspartic acid (D), glutamic acid (E), glutamine (Q) or dried meat ammonia
Sour (P)；
(b) by replacing, lacking or add one or several amino acid and there is epoxy in the amino acid sequence that (a) is limited
The protein as derived from (a) of compound hydrolytic enzyme activities.
2. encoding the gene of mutant described in claim 1.
3. carrying the carrier of gene described in claim 2 or expressing the cell of mutant described in claim 1.
4. a kind of genetic engineering bacterium, which is characterized in that be host with Escherichia coli using pET series plasmids as carrier, express right
It is required that the 1 epoxide hydrolase AuEH2 mutant.
5. the composition containing cell described in epoxide hydrolase AuEH2 mutant described in claim 1 or claim 3.
6. a kind of method for preparing AuEH2 mutant described in claim 1, which is characterized in that cultivate base as claimed in claim 4
Because of engineering bacteria, IPTG induces 6~8h under the conditions of 25~28 DEG C.
7. a kind of method for producing (R)-p-methylphenyl glycidol ether, which is characterized in that with mutation described in claim 1
Composition described in body or genetic engineering bacterium as claimed in claim 4 or claim 5 is catalyst, is urged in buffer system
Outside the pale of civilization racemization p-methylphenyl glycidol ether.
8. the method according to the description of claim 7 is characterized in that the buffer system is single water phase or water phase and organic phase
The diphasic system of composition.
9. method according to claim 7 or 8, which is characterized in that AuEH2 mutant is with 0.4~1mg thallus/mM to first
The additive amount of base phenyl glycidyl ether is added into reaction system.
10. application of the AuEH2 mutant described in claim 1 in terms of chiral biocatalysis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811633720.6A CN109609479B (en) | 2018-12-29 | 2018-12-29 | Aspergillus usamii epoxide hydrolase mutant with improved enantioselectivity |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811633720.6A CN109609479B (en) | 2018-12-29 | 2018-12-29 | Aspergillus usamii epoxide hydrolase mutant with improved enantioselectivity |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109609479A true CN109609479A (en) | 2019-04-12 |
| CN109609479B CN109609479B (en) | 2021-07-27 |
Family
ID=66011021
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811633720.6A Active CN109609479B (en) | 2018-12-29 | 2018-12-29 | Aspergillus usamii epoxide hydrolase mutant with improved enantioselectivity |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109609479B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114891763A (en) * | 2022-05-31 | 2022-08-12 | 安徽工程大学 | Streptomyces fisheri-derived epoxy hydrolase, gene, vector, engineering bacterium, preparation method and application |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102994470A (en) * | 2012-12-24 | 2013-03-27 | 江南大学 | Pronucleus expression of epoxide hydrolase gene (EH-B) and preparation of chiral epichlorohydrin |
| CN104450641A (en) * | 2014-09-17 | 2015-03-25 | 华东理工大学 | Epoxide hydrolase as well as encoding gene and application thereof |
| CN106047834A (en) * | 2016-07-07 | 2016-10-26 | 江南大学 | Aspergillus usamii epoxide hydrolase mutants with improved enantioselectivity |
-
2018
- 2018-12-29 CN CN201811633720.6A patent/CN109609479B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102994470A (en) * | 2012-12-24 | 2013-03-27 | 江南大学 | Pronucleus expression of epoxide hydrolase gene (EH-B) and preparation of chiral epichlorohydrin |
| CN104450641A (en) * | 2014-09-17 | 2015-03-25 | 华东理工大学 | Epoxide hydrolase as well as encoding gene and application thereof |
| CN106047834A (en) * | 2016-07-07 | 2016-10-26 | 江南大学 | Aspergillus usamii epoxide hydrolase mutants with improved enantioselectivity |
Non-Patent Citations (3)
| Title |
|---|
| DIE HU等: "Expression of a novel epoxide hydrolase of Aspergillus usamii E001 in Escherichia coli and its performance in resolution of racemic styrene oxide", 《J IND MICROBIOL BIOTECHNOL》 * |
| RUI WANG等: "Enantioconvergent hydrolysis of racemic styrene oxide at high concentration by a pair of novel epoxide hydrolases into (R)-phenyl-1,2-ethanediol", 《BIOTECHNOL. LETT.》 * |
| 胡蝶: "宇佐美曲霉环氧化物水解酶的基因克隆、分子改造及在手性化合物合成中的应用", 《中国博士学位论文全文数据库 基础科学辑》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114891763A (en) * | 2022-05-31 | 2022-08-12 | 安徽工程大学 | Streptomyces fisheri-derived epoxy hydrolase, gene, vector, engineering bacterium, preparation method and application |
| CN114891763B (en) * | 2022-05-31 | 2023-10-20 | 安徽工程大学 | Streptomyces fei-derived cyclooxygenase, gene, vector, engineering bacteria, preparation method and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109609479B (en) | 2021-07-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106119220B (en) | A kind of Kidney bean epoxide hydrolase mutant of catalytic activity and the raising of mapping regression nature | |
| CN108359651A (en) | A kind of monoamine oxidase and its gene and application | |
| Xue et al. | Enantioselective biocatalytic hydrolysis of (R, S)-mandelonitrile for production of (R)-(−)-mandelic acid by a newly isolated mutant strain | |
| CN106047834B (en) | A kind of Aspergillus usamii epoxide hydrolase mutant that enantioselectivity improves | |
| CN104894148A (en) | Omega-aminotransferase mutant gene and application thereof | |
| CN104781410A (en) | Process for producing alpha, omega-diols from alkanes or 1 -alkanols employing a CYP153 alkane hydroxylase | |
| CN112481224A (en) | Baeyer-Villiger monooxygenase and application thereof | |
| CN107164342A (en) | A kind of epoxide hydrolase in Kidney bean source and its application | |
| KR100803093B1 (en) | Enantioselective epoxide hydlrolase and method for preparing an enantiopure epoxide using the same | |
| CN104109659A (en) | Carboxylesterase as well as coding gene and application thereof | |
| Oelschlägel et al. | Immobilization of an integral membrane protein for biotechnological phenylacetaldehyde production | |
| CN107937364B (en) | Kidney bean epoxide hydrolase mutant with improved enantioselectivity | |
| CN109609479A (en) | A kind of Aspergillus usamii epoxide hydrolase mutant that enantioselectivity improves | |
| CN109072215A (en) | A kind of Cephalosporin C acylase mutant and its application | |
| CN105734028A (en) | Epoxide hydrolase mutant and application thereof | |
| CN112175919B (en) | Lactone hydrolase mutant and application thereof | |
| CN108410831A (en) | Ketone acid reductase, gene, engineering bacteria and the application in synthesis of chiral fragrance 2- hydroxy acids | |
| CN108048423B (en) | Kidney bean epoxide hydrolase mutant with improved catalytic activity and application thereof | |
| CN107201349A (en) | A kind of engineering bacteria for expressing Kidney bean epoxide hydrolase and application | |
| CN103131659A (en) | Organic solvent-resistant lipase, as well as encoding gene, producing strain and application thereof | |
| CN105296513A (en) | Marine esterase as well as coding gene E22 and application thereof | |
| CN110257352A (en) | A kind of epoxide hydrolase and application thereof | |
| CN105969837B (en) | Method for preparing (S) -styrene oxide by enzyme method | |
| CN108034646A (en) | The PvEH3 mutant that a kind of catalytic activity and mapping regression nature improve | |
| CN108559737B (en) | Soybean epoxy hydrolase mutant with improved stereoselectivity |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| CB03 | Change of inventor or designer information | ||
| CB03 | Change of inventor or designer information |
Inventor after: Wu Minchen Inventor after: Su Yongjun Inventor after: Wang Tingting Inventor after: Xu Xiongfeng Inventor after: Wen Zheng Inventor after: Hu Bochun Inventor after: Hu Die Inventor after: Li Jianfang Inventor before: Su Yongjun Inventor before: Wang Tingting Inventor before: Xu Xiongfeng Inventor before: Wen Zheng Inventor before: Hu Bochun Inventor before: Hu Die Inventor before: Li Jianfang Inventor before: Wu Minchen |
|
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |