CN109593698A - A kind of adsorbed water body heavy metal Escherichia coli transformant and its application - Google Patents

A kind of adsorbed water body heavy metal Escherichia coli transformant and its application Download PDF

Info

Publication number
CN109593698A
CN109593698A CN201811558589.1A CN201811558589A CN109593698A CN 109593698 A CN109593698 A CN 109593698A CN 201811558589 A CN201811558589 A CN 201811558589A CN 109593698 A CN109593698 A CN 109593698A
Authority
CN
China
Prior art keywords
ompa
lpp
escherichia coli
isca
heavy metal
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201811558589.1A
Other languages
Chinese (zh)
Other versions
CN109593698B (en
Inventor
王伍
章丽和
姜风英
程荣
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Wenzhou Medical University
Original Assignee
Wenzhou Medical University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Wenzhou Medical University filed Critical Wenzhou Medical University
Priority to CN201811558589.1A priority Critical patent/CN109593698B/en
Publication of CN109593698A publication Critical patent/CN109593698A/en
Application granted granted Critical
Publication of CN109593698B publication Critical patent/CN109593698B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • C07K14/245—Escherichia (G)
    • C—CHEMISTRY; METALLURGY
    • C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F3/00—Biological treatment of water, waste water, or sewage
    • C02F3/34—Biological treatment of water, waste water, or sewage characterised by the microorganisms used
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F2101/00—Nature of the contaminant
    • C02F2101/10—Inorganic compounds
    • C02F2101/20—Heavy metals or heavy metal compounds

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Hydrology & Water Resources (AREA)
  • Environmental & Geological Engineering (AREA)
  • Water Supply & Treatment (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

A kind of adsorbed water body heavy metal Escherichia coli transformant and its application, the transformant is obtained by plasmid pET-Lpp-OmpA-IscA conversion Escherichia coli, the plasmid includes expression vector pET-28b, lipoprotein signal peptide Lpp gene and Escherichia coli memebrane protein OmpA gene before Escherichia coli IscA protein gene, Escherichia coli.By technique for gene engineering, obtain the plasmid and be building up to surface of the expression in escherichia coli fusion protein Lpp-OmpA-IscA outside Bacillus coli cells film, construct can in efficient absorption water various heavy bacterial strain.

Description

A kind of adsorbed water body heavy metal Escherichia coli transformant and its application
Technical field
The invention belongs to technical field of bioengineering, and in particular to a kind of adsorbed water body heavy metal Escherichia coli transformant and It is applied.
Background technique
As process of industrialization is accelerated, heavy metal wastewater thereby discharge amount is huge, and heavy metal pollution is got worse.Heavy metal in water Pollution has become one of current main environmental problem, therefore being effectively treated to it has been current work urgently to be resolved.
Biological adsorption is adsorbed and is accumulated using the chemical component and architectural characteristic of the biomaterials such as bacterium, fungi, algae Heavy metal in waste water, to achieve the purpose that remove heavy metal in waste water.In recent years, more and more effectively to adsorb a huge sum of money The full cell microorganism bacterial strain belonged to is developed, such as the absorption engineered strain of mercury, lead, copper, cadmium, arsenic etc..Large intestine bar Bacterium IscA albumen is a kind of important iron-sulfur cluster assembling albumen.Other than it can combine iron-sulfur cluster, it has been found that it also has knot Close the ability of iron ion and copper ion.
Traditional physico-chemical method its adsorbent itself is likely to result in secondary pollution, and at high cost, and energy consumption is high.Biology is inhaled Attached dose because it is easy, safety, it is at low cost the advantages that, be rapidly developed in recent years.But most of heavy metal adsorption bacterial strain tables What is reached is metal Specific adsorption albumen, so certain specific heavy metal can only be adsorbed.However environment water especially trade effluent In often simultaneously contain a large amount of various heavy, if using single heavy metal adsorb bacterial strain, need successively to every kind of huge sum of money Category is purged, and time-consuming, low efficiency.
Summary of the invention
In view of the deficiencies of the prior art, the purpose of the present invention is to provide a kind of conversions of adsorbed water body heavy metal Escherichia coli Body and its application, especially the conversion physical efficiency efficient absorption various water bodies heavy metal.
The present invention is achieved through the following technical solutions: first aspect is to provide a kind of adsorbed water body heavy metal large intestine bar Bacterium transformant, the transformant are obtained by plasmid pET-Lpp-OmpA-IscA conversion Escherichia coli, and the plasmid includes expression vector Lipoprotein signal peptide Lpp gene and Escherichia coli memebrane protein before pET-28b, Escherichia coli IscA protein gene, Escherichia coli OmpA gene.
Second aspect is to provide a kind of adsorbed water body heavy metal Escherichia coli conversion preparation, comprising the following steps:
(1) one section of encoding gene lpp-ompA is subjected to PCR amplification, while transfers Escherichia coli by template PCR of Escherichia coli IscA gene prepares mosaic gene Lpp-OmpA-IscA using technique for gene engineering, by the mosaic gene construction recombination plasmid；
(2) recombinant plasmid is transferred in Escherichia coli and obtains transformant.
In the above method, the encoding gene lpp-ompA is lipoprotein signal peptide 1-9 ammonia of Lpp before Escherichia coli The encoding gene of base acid and transmembrane protein OmpA 46-159 amino acids fusion sequence.The gene is directly synthesized by company, by Company is cloned in pUC50-lpp-ompA, using pUC50-lpp-ompA as template, utilizes primer Lpp-ompA-F and Lpp- OmpA-R, PCR amplification lpp-ompA gene.Primer Lpp-ompA-F and Lpp-ompA-R are as follows:
Lpp-ompA-F
5'-TTTAAGAAGGAGATATACCATGAAAAAGACAGCTATCGCGATTGCAG-3'；
Lpp-ompA-R
5’-GCACTGTCGCTCAGTGTAATCGACATACGGGTAGCGATTTCAGGAGTG-3’。
Escherichia coli iscA gene is to transfer Escherichia coli iscA gene, specific steps by template PCR of Escherichia coli are as follows: Using primer I scA-F and IscA-R, PCR transfers iscA gene, reaction condition are as follows: 95 DEG C of initial denaturations 5 min, 95 DEG C of 40 s, 50 DEG C of 40 s, 72 DEG C of 2 min, totally 35 recycle, 10 min of last 72 DEG C of extensions.Primer I scA-F and IscA-R are as follows:
IscA-F
5'-CACTCCTGAAATCGCTACCCGTATGTCGATTACACTGAGCGACAGTGC-3'；
IscA-R
5’-TGCTCGAGTGCGGCCGCAAGTCAAACGTGGAAGCTTTCGCCGCAACCACAC -3’。
The preparation step of mosaic gene Lpp-OmpA-IscA is to massage encoding gene lpp-ompA and iscA genetic fragment New PCR system is added than 1:1 for you, using primer Lpp-ompA-F and IscA-R, is connected two segments by recombinant PCR method Get up.Recombinant PCR method are as follows: 95 DEG C of initial denaturation 5 min, 95 DEG C of 40 s, 50 DEG C of 40 s, 72 DEG C of 2 min, totally 35 are followed Ring, 10 min of last 72 DEG C of extensions.Primer Lpp-ompA-F and IscA-R are as follows:
Lpp-ompA-R2
5'-TGCTCGAGTGCGGCCGCAAGACGGGTAGCGATTTCAGGAGTG-3'；
IscA-R
5’-TGCTCGAGTGCGGCCGCAAGTCAAACGTGGAAGCTTTCGCCGCAACCACAC -3’。
The lpp-ompA-IscA segment come be would pick up after running gel recycles, and after Nco I and HindIII double digestion PET28b linear carrier carry out seamless clone, final building obtains Escherichia coli IscA Membrane surface expression recombinant plasmid pET- Lpp-OmpA-IscA.The Escherichia coli that recombinant plasmid is transferred to are BL21 (DE3).
The construction method of recombinant expression plasmid of the present invention is molecule clone technology commonly used in the art, prokaryotic expression used Plasmid can be the plasmid (such as pET series plasmids) containing T7 promoter originally, be also possible to other prokaryotic expression plasmids (pQE Series plasmids, pUC series plasmids, pGEM series plasmids and pTrc series plasmids etc.) in numerous prokaryotic expression plasmids, preferably PET series plasmids.
Host strain used in the present invention can be e. coli bl21 (DE3), be also possible to other host strains (Rosetta (DE3), OrigamiB (DE3) and ER2566 etc.) if selecting the plasmid of T7 promoter, host strain must contain The region DE3, if it is other promoters, host strain is necessary for Escherichia coli.In numerous host strains, Escherichia coli are preferentially selected BL21(DE3)。
The third aspect is to provide a kind of Escherichia coli transformant and is preparing the application in adsorbed water body Heavy Metal Reagent, makes Preparation Method be pET-Lpp-OmpA-IscA/BL21 bacterial strain is transferred in M9 culture medium expand culture to OD600 be 0.8, be added eventually Concentration is the IPTG of 200 μm of ol/L, induces 24 h under the conditions of 25 DEG C.Culture medium will be discarded after bacterium solution centrifugation after induction, used PBS solution is resuspended again after washing 2 times, and by bacterium solution, all centrifugation is discarded supernatant, and precipitating is used as a kind of adsorbed water body Heavy Metal Reagent.
The beneficial effects of the invention are as follows technique for gene engineering is utilized, fusion protein Lpp-OmpA-IscA is expressed in large intestine Surface outside bacilli-cell film, construct can in efficient absorption water various heavy bacterial strain.
Detailed description of the invention
Fig. 1 is the inducing expression of IscA Membrane surface expression bacterial strain and the SDS-PAGE of trypsin digestion experiment in the present invention Electroresis appraisal；
Fig. 2 is that IscA film expression bacterial strain tests the maximum adsorption ability and concentration dependant of heavy metal in the present invention；
Fig. 3 is the Time Dependent experiment that IscA film expression bacterial strain removes heavy metal ion in solution in the present invention；
Fig. 4 is the concentration mensuration that IscA film expression bacterial strain removes heavy metal in trade effluent in the present invention.
Specific embodiment
To make the objectives, technical solutions, and advantages of the present invention clearer, below in conjunction with specific embodiment, and reference Attached drawing, the present invention is described in further detail.
1. material
1.1. bacterial strain
E.coli BL21 (DE3) [F-ompT hsdS (rB-mB-) gal dcm (DE3)], hereinafter referred to as BL21 bacterial strain, You Benshi Test room preservation.
1.2. plasmid
PET28b [Kanar] is saved containing His label and T7 terminator by this laboratory.
1.3. M9 culture medium
20 kinds of natural amino acid mixed aqueous solutions (10 mg/L/ kind), vitamin B1 water are added on the basis of M9 basal medium Solution (5 μ g/mL), 4 DEG C save backup.
1.4. main agents
PCR amplification 2 × phanta of polymerase, is purchased from Vazyme company；Seamless cloning reaction kit is purchased from and first biotechnology (Shanghai) Co., Ltd..
Cobalt chloride (CoCl2), nickel sulfate (NiSO4), cadmium sulfate (CdSO4), mercury chloride (HgCl2), sodium arsenite (NaAsO2), the metal reagents such as potassium bichromate (K2Cr2O7), plumbi nitras (Pb (NO3) 2), copper sulphate (CuSO4) are purchased from Sigma company is dissolved in deionized water and is made into various solution；Resolution is purchased from Merck company with nitric acid；Other reagents are domestic analysis It is pure.
2. the building of Escherichia coli IscA Membrane surface expression carrier
2.1. before Escherichia coli according to the literature lipoprotein signal peptide Lpp and transmembrane protein OmpA fusion sequence (i.e. Lpp 1-9 amino acids and OmpA 46-159 amino acids are merged), by Nanjing, Jin Sirui biotechnology company is directly synthesized The encoding gene lpp-ompA of this fusion sequence, this gene fragment clone is in pUC50-lpp-ompA.It is with this synthetic plasmid Template utilizes primer Lpp-ompA-F and Lpp-ompA-R, PCR amplification lpp-ompA gene.Above-mentioned primer are as follows:
Lpp-ompA-F
5'-TTTAAGAAGGAGATATACCATGAAAAAGACAGCTATCGCGATTGCAG-3'；
Lpp-ompA-R
5’-GCACTGTCGCTCAGTGTAATCGACATACGGGTAGCGATTTCAGGAGTG-3’。
2.2. simultaneously using the genomic DNA of e. coli strain bl21 as template, using primer I scA-F and IscA-R, Expand Escherichia coli iscA gene.PCR reaction condition: 95 DEG C of initial denaturation 5 min, 95 DEG C of 40 s, 50 DEG C of 40 s, 72 DEG C 2 Min, totally 35 recycle, 10 min of last 72 DEG C of extensions.Electrophoresis verify fragment amplification success after, by above-mentioned two segment by mole New PCR system is added than 1:1, using primer Lpp-ompA-F and IscA-R, is connected two segments by recombinant PCR method Come, PCR reaction condition is same as above.Above-mentioned primer are as follows:
IscA-F
5'-CACTCCTGAAATCGCTACCCGTATGTCGATTACACTGAGCGACAGTGC-3'；
IscA-R
5’-TGCTCGAGTGCGGCCGCAAGTCAAACGTGGAAGCTTTCGCCGCAACCACAC -3’。
2.3 by the lpp-ompA-IscA segment connected after running gel recycles, said according to seamless Cloning Kit The operation of bright book carries out seamless clone with the pET28b linear carrier after Nco I and HindIII double digestion, and connection product turns Competent cell is dissolved into, the picking positive colony after double digestion is identified, sequencing analysis (Shanghai Sani Biotechnology Co., Ltd), Final building obtains Escherichia coli IscA Membrane surface expression carrier pET-Lpp-OmpA-IscA.Meanwhile only expressing Lpp-OmpA film The albumen but control background carrier pET-Lpp-OmpA for not expressing IscA albumen is also constructed according to above-mentioned same procedure, difference It is only use primer Lpp-ompA-F and Lpp-ompA-R2 when PCR amplification, without carrying out recombinant PCR.Above-mentioned primer Are as follows:
Lpp-ompA-R2
5'-TGCTCGAGTGCGGCCGCAAGACGGGTAGCGATTTCAGGAGTG-3'；
IscA-R
5’-TGCTCGAGTGCGGCCGCAAGTCAAACGTGGAAGCTTTCGCCGCAACCACAC -3’。
3. Escherichia coli IscA is in the inducing expression and trypsin digestion experimental identification of bacterium film surface
3.1. pET-Lpp-OmpA-IscA and pET-Lpp-OmpA plasmid is transformed into BL21 competent cell respectively, is obtained PET-Lpp-OmpA-IscA/BL21 bacterial strain (Escherichia coli IscA Membrane surface expression bacterial strain) and pET-Lpp-OmpA/BL21 bacterial strain (control background bacterial strain).
3.2. the above-mentioned bacterium solution for drawing appropriate overnight growth is added in the fresh M9 fluid nutrient medium of 10 mL, makes starter bacteria Liquid OD600 value is 0.02 or so, and is separately added into kanamycins, in 37 DEG C of 250 r/min shaken cultivations of constant temperature, monitors it OD600 to 0.8 or so, the bacterium solution for drawing 2-3 mL give over to SDS-PAGE electroresis appraisal, and final concentration of 200 μ is added in remaining bacterium solution The IPTG of mol/L induces 24 h under the conditions of 25 DEG C.The bacterium solution of induction front and back is centrifuged respectively, culture medium is discarded, is buffered with PBS Liquid (pH 8.0) is resuspended to buffer after washing 2 times again, makes bacterial density OD600 10 or so.Every kind of bacteria liquid sample is about drawn 10 μ L carry out SDS-PAGE electroresis appraisal protein expression situation.
3.3. in addition, drawing bacterium solution (OD600 is about 10) after the induction that 50 μ L have been resuspended in PBS buffer solution respectively, The trypsase of final concentration of 100 μ g/mL is added, 37 DEG C of 3 h of digestion are resuspended in buffer again after washing 3 times, draw phase With bacterium amount and remaining sample electroresis appraisal simultaneously.Fig. 1 is the inducing expression and trypsase enzyme of IscA Membrane surface expression bacterial strain Solve the SDS-PAGE electrophoretic identification of experiment.
As a result: as shown in Figure 1, sample is after IPTG is induced, in the position on the upper side 25 KDa visible one with not plus compared with IPTG Expected 27 KDa of size of the protein band of the significant thickening of item, this protein band size and Lpp-OmpA-IscA fusion protein is close, This preliminary fusion protein successful expression.Similarly, Lpp-OmpA expresses bacterial strain and induces through IPTG, in 16 KDa size positions Obvious band has been also shown, has shown that Lpp-OmpA albumen also expresses success.Expression has the full cell bacterium of Lpp-OmpA-IscA albumen After body and trypsase are incubated for, the protein band of 27 positions KDa almost disappears, and a protein band occurs in 16 positions KDa, This stripe size and Lpp-OmpA memebrane protein are in the same size.This shows that the IscA peptide fragment in Lpp-OmpA-IscA fusion protein is Outside cell membrane, therefore can be by trypsin degradation, and remaining Lpp-OmpA peptide fragment is incorporated on film, it cannot be by pancreas egg White enzyme continues to digest.And pET-Lpp-OmpA/BL21 is as control strain, the Lpp-OmpA albumen on film cannot directly with pancreas egg White enzyme contact, so Lpp-OmpA albumen is not degraded.
4.IscA film expression bacterial strain tests the concentration dependant of heavy metal adsorption
4.1. pET-Lpp-OmpA-IscA/BL21 bacterial strain and pET-Lpp-OmpA/BL21 bacterial strain are trained in the M9 of 4 L respectively Supporting expansion in base and cultivating to OD600 is about 0.8, and the IPTG of final concentration of 200 μm of ol/L is added, induces 24 h under the conditions of 25 DEG C.
4.2. culture medium is discarded after the bacterium solution centrifugation after inducing, is resuspended again after washing 2 times with PBS solution, adjustment thallus is close Spending OD600 is about 50.Bacterium solution is dispensed to 5 mL EP and is managed, and every pipe dispenses 2 mL.Every kind of bacterium solution dispenses 56 pipes or more.It will packing All centrifugation discards supernatant bacterium solution afterwards, is then respectively adding 2 mL final concentration of 1,5,25,125,1 000,5 000,10 000 μm of ol/L 8 heavy metal species aqueous solutions (CoCl2, NiSO4, CdSO4, HgCl2, NaAsO2, K2Cr2O7, Pb (NO3) 2, CuSO4), every heavy metal species solution is all provided with above-mentioned 7 concentration gradients.
4.3. after above-mentioned thallus is resuspended with heavy metal solution, 25 DEG C of 100 r/min of constant-temperature table mixing oscillations 30 are placed in After min, centrifugation is discarded supernatant, then is washed with deionized 2 times, to wash away the heavy metal ion not in conjunction with thallus.Finally will Whole thallus in every pipe are resuspended with 2 mL concentrated nitric acids and are transferred in new centrifuge tube, are settled to 10 mL with deionized water.Often A sample, which is placed in microwave dissolver, to be cleared up, and resolution program (temperature, time, pressure) is provided that 120 DEG C, 1 min, and 10 apm；150 DEG C, 1 min, 20 apm；180 DEG C, 15 min, 30 apm.Resolution finishes after nitric acid volatilization is clean, prompt using peace 8800 type icp ms (ICP-MS) of human relations company are measured the various content of beary metal in solution. In addition, thallus after the centrifugation of one pipe equivalent of preparation, is placed in -80 DEG C of refrigerator freezings and stays overnight, and dry 36 h in vacuum drier More than, then with assay balance accurate weighing dry cell weight.Thallus can measure the adsorption capacity of heavy metal with μm ol/g, i.e., often The heavy metal molal quantity that gram dry weight thallus can adsorb.Experimental result is the average value ± SD value of independent experiment three times, n=3. Fig. 2 is that IscA film expression bacterial strain tests the maximum adsorption ability and concentration dependant of heavy metal.
As a result: as shown in Fig. 2, increase of two kinds of bacterial strains with heavy metal ions concentration in solution, the heavy metal of absorption Content increases therewith.In addition, IscA can make it to Cu2+, Ni2 in Escherichia coli Membrane surface expression compared with control strain +, the maximal absorptive capacity of Cd2+, Pb2+, As3+, Co2+, Hg2+ this 7 kinds of ions increase 2-6 times and differ, and not can increase substantially pair The adsorbance of Cr6+.This illustrates that IscA albumen can cannot combine Cr6+ in conjunction with 7 kinds of front ion.Due to being added when experiment Thalline quantity and IscA protein quantity be almost the same, the heavy metal adsorption content of IscA film expression bacterial strain and control strain Ratio is higher, shows that IscA is also more to the binding capacity of this heavy metal species, this may be due to IscA albumen and different heavy metals Binding affinity it is variant caused by.
5. the Time Dependent experiment that IscA film expression bacterial strain removes heavy metal ion in solution
5.1. pET-Lpp-OmpA-IscA/BL21 bacterial strain and pET-Lpp-OmpA/BL21 bacterial strain are lured as described in step 3 Processing is led, cell density is adjustedOD 600About 50.Bacterium solution is dispensed to 15 mL EP and is managed, and every pipe dispenses 15 mL, and every kind of bacterium solution is at least 8 pipe of packing.
5.2. by the bacterium solution after packing, all centrifugation is discarded supernatant, and is then respectively adding 8 heavy metal species solution, every kind of weight Metallic solution final concentration is as follows: Cu2+ (2.5 mg/L)、Ni2+ (5.0 mg/L)、Cd2+ (0.5 mg/L)、Pb2+ (5.0 mg/ L)、As3+ (2.5 mg/L)、Co2+ (5.0 mg/L)、Hg2+ (0.25 mg/L)、Cr6+ (2.5 mg/L).Solution is added to be resuspended Afterwards, bacterium solution is placed in 25 DEG C of 100 r/min of constant-temperature table mixing oscillations, and draws every kind at 5,10,20,30,60 min time points 1.5 mL of bacterium solution.The bacterium solution of absorption leaves and takes the supernatant solution constant volume of 1.0 mL to 10 mL after high speed centrifugation, straight with ICP-MS Connect the concentration of remaining heavy metal ion in measurement supernatant.With initial heavy metal solution concentration for 0 moment concentration, drawn according to result The Time Dependent curve of solution content of beary metal after thallus absorption is removed.Experimental result is the average value of independent experiment three times ± SD value, n=3.Fig. 3 is the Time Dependent experiment that IscA film expression bacterial strain removes heavy metal ion in solution.
As a result: as shown in figure 3, pET-Lpp-OmpA-IscA/BL21 bacterial strain and the equal energy of pET-Lpp-OmpA/BL21 bacterial strain Enough content of beary metal reduced in various solution in various degree.And compared with control strain, IscA film expression bacterial strain is identical Time in can make 7 heavy metal species solution (Cu2+, Ni2+, Cd2+, Pb2+, As3+, Co2+, Hg2+) concentration reduce more It is more；By the suction-operated of 30 min, exceeded 5 times of heavy metal solution is substantially all and can be reduced to sewage highest and allow to discharge Concentration is hereinafter, more particularly to reduce Cu2+, Cd2+, Hg2+ solution to 10% or less initial concentration.But IscA film expression bacterium Strain is close to the Scavenging activity and background bacterial strain of the solution containing Cr6+.This data is consistent with Fig. 2 result, shows that IscA albumen can be tied 7 kinds of front ion is closed, and Cr6+ cannot be combined.Furthermore it can be seen that IscA film expression bacterial strain to a huge sum of money from Time Dependent curve The scavenging effect for belonging to solution substantially achieves saturation in 30 min or so, this also illustrates that this bacterial strain can be completed in a short time weight The removing of metal, efficiency are higher.Its principle is one of the significant components that Escherichia coli IscA is iron-sulfur cluster synthesis, the large intestine of purifying Bacillus IscA exists with dimer or tetramer, wherein three conservative cysteine residues (Cys-35, Cys-99, Cys-101 it) stretches out and forms one " cysteine pocket ", single iron ion or iron-sulfur cluster can be combined.Rite-directed mutagenesis research Prove that these three conservative cysteine residues are required for the iron combination activity of its specificity in IscA.IscA simultaneously It is found to combine copper ion.This research by IscA protein expression in outside Bacillus coli cells film, according to fig. 2, Fig. 3 result can Know IscA in addition to can adsorb it has been reported that several metals other than, can also adsorb Ni2+, Cd2+, Pb2+, As3+, Co2+, Hg2+ these types heavy metal ion, this may have good " flexibility " to have with tri- conservative cysteine residues of IscA It closes, can be bonded with different metal ions.
6. the practical application experiment that IscA film expression bacterial strain removes heavy metal in trade effluent
6.1. primary dcreening operation is carried out to the content of beary metal in the surrounding area environmental water sample of acquisition seminar's early period, chooses 3 huge sum of moneys Belong to the relatively serious water sample of pollution and (acquires the river and ground from Wenzhou City, Lantian industrial area, Longwan District Guo Haogang industry company periphery Table runoff water sample) be used as experimental subjects, water sample is centrifuged it is spare, thoroughly to remove the solid particles such as silt.
6.2. pET-Lpp-OmpA-IscA/BL2 and pET-Lpp-OmpA/BL21 bacterial strain is lured as described in step 3 Processing is led, adjustment cell density OD600 is about 50.It is dispensed respectively to 3 15 mL centrifuge tubes, centrifugation discards supernatant.Respectively every The above-mentioned water sample that 15 mL number is 1,2,3 is added in a pipe.After thallus is resuspended, it is mixed to be placed in 25 DEG C of 100 r/min of constant-temperature table It is centrifuged after 30 min of co oscillation, draws the processed supernatant fluid of 10 mL, directly with the various huge sum of moneys in ICP-MS measurement sample Belong to content.Fig. 4 is the concentration mensuration that IscA film expression bacterial strain removes heavy metal in trade effluent.
As a result: as shown in figure 4, the initial content (marking " a " in figure) of various heavy is higher in this 3 parts of water samples, In nickel in No. 1 sample it is exceeded, No. 2 and the copper in No. 3 samples, nickel, chromium it is exceeded, wherein copper, nickel are exceeded seriously (about surpasses respectively 3 times, 13 times of mark).Through 30 min of IscA film expression bacterial strain (marking " c " in figure) and background strain (marking " b " in figure) adsorption treatment Afterwards, various content of beary metal have reduction in sample, and after the absorption of IscA film expression bacterial strain, the range of decrease under heavy metal concentration Degree is noticeably greater than control strain.Nickel in No. 1 sample and No. 2, the copper in No. 3 samples, chromium are below maximum allowable after adsorbing Concentration of emission.But No. 2, the content of nickel is still higher than maximum allowable concentration of emission in No. 3 samples, this may be the initial nickel of sample Excessive concentration has been more than the maximum adsorption capacity of thallus.So we are not weighed again and the surplus solution after primary absorption The freshly prepared thallus hybrid reaction of metal adsorption.As shown in Fig. 4 " * " labeled data, after second adsorption, No. 2, No. 3 samples The content of middle nickel drops to maximum allowable concentration of emission or less.In addition, we also carry out other common metals of 3 parts of water samples Measurement, it is found that the content of the microelements such as its magnesium, iron, zinc is also quite high, in 5 mg/L or more.This illustrates IscA film expression Bacterial strain can be resistant to the interference of other metallic elements and complicated ingredient, can remove the various heavy in trade effluent simultaneously, It has a good application prospect.
Sequence table
<110>Wenzhou Medical University
<120>a kind of adsorbed water body heavy metal Escherichia coli transformant and its application
<130> 1
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 6019
<212> DNA
<213>Escherichia coli (Escherichia coli)
<400> 1
tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg 60
cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc 120
ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg 180
gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc 240
acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt 300
ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc 360
ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta 420
acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt 480
tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta 540
tccgctcatg aattaattct tagaaaaact catcgagcat caaatgaaac tgcaatttat 600
tcatatcagg attatcaata ccatattttt gaaaaagccg tttctgtaat gaaggagaaa 660
actcaccgag gcagttccat aggatggcaa gatcctggta tcggtctgcg attccgactc 720
gtccaacatc aatacaacct attaatttcc cctcgtcaaa aataaggtta tcaagtgaga 780
aatcaccatg agtgacgact gaatccggtg agaatggcaa aagtttatgc atttctttcc 840
agacttgttc aacaggccag ccattacgct cgtcatcaaa atcactcgca tcaaccaaac 900
cgttattcat tcgtgattgc gcctgagcga gacgaaatac gcgatcgctg ttaaaaggac 960
aattacaaac aggaatcgaa tgcaaccggc gcaggaacac tgccagcgca tcaacaatat 1020
tttcacctga atcaggatat tcttctaata cctggaatgc tgttttcccg gggatcgcag 1080
tggtgagtaa ccatgcatca tcaggagtac ggataaaatg cttgatggtc ggaagaggca 1140
taaattccgt cagccagttt agtctgacca tctcatctgt aacatcattg gcaacgctac 1200
ctttgccatg tttcagaaac aactctggcg catcgggctt cccatacaat cgatagattg 1260
tcgcacctga ttgcccgaca ttatcgcgag cccatttata cccatataaa tcagcatcca 1320
tgttggaatt taatcgcggc ctagagcaag acgtttcccg ttgaatatgg ctcataacac 1380
cccttgtatt actgtttatg taagcagaca gttttattgt tcatgaccaa aatcccttaa 1440
cgtgagtttt cgttccactg agcgtcagac cccgtagaaa agatcaaagg atcttcttga 1500
gatccttttt ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg 1560
gtggtttgtt tgccggatca agagctacca actctttttc cgaaggtaac tggcttcagc 1620
agagcgcaga taccaaatac tgtccttcta gtgtagccgt agttaggcca ccacttcaag 1680
aactctgtag caccgcctac atacctcgct ctgctaatcc tgttaccagt ggctgctgcc 1740
agtggcgata agtcgtgtct taccgggttg gactcaagac gatagttacc ggataaggcg 1800
cagcggtcgg gctgaacggg gggttcgtgc acacagccca gcttggagcg aacgacctac 1860
accgaactga gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc cgaagggaga 1920
aaggcggaca ggtatccggt aagcggcagg gtcggaacag gagagcgcac gagggagctt 1980
ccagggggaa acgcctggta tctttatagt cctgtcgggt ttcgccacct ctgacttgag 2040
cgtcgatttt tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc cagcaacgcg 2100
gcctttttac ggttcctggc cttttgctgg ccttttgctc acatgttctt tcctgcgtta 2160
tcccctgatt ctgtggataa ccgtattacc gcctttgagt gagctgatac cgctcgccgc 2220
agccgaacga ccgagcgcag cgagtcagtg agcgaggaag cggaagagcg cctgatgcgg 2280
tattttctcc ttacgcatct gtgcggtatt tcacaccgca tatatggtgc actctcagta 2340
caatctgctc tgatgccgca tagttaagcc agtatacact ccgctatcgc tacgtgactg 2400
ggtcatggct gcgccccgac acccgccaac acccgctgac gcgccctgac gggcttgtct 2460
gctcccggca tccgcttaca gacaagctgt gaccgtctcc gggagctgca tgtgtcagag 2520
gttttcaccg tcatcaccga aacgcgcgag gcagctgcgg taaagctcat cagcgtggtc 2580
gtgaagcgat tcacagatgt ctgcctgttc atccgcgtcc agctcgttga gtttctccag 2640
aagcgttaat gtctggcttc tgataaagcg ggccatgtta agggcggttt tttcctgttt 2700
ggtcactgat gcctccgtgt aagggggatt tctgttcatg ggggtaatga taccgatgaa 2760
acgagagagg atgctcacga tacgggttac tgatgatgaa catgcccggt tactggaacg 2820
ttgtgagggt aaacaactgg cggtatggat gcggcgggac cagagaaaaa tcactcaggg 2880
tcaatgccag cgcttcgtta atacagatgt aggtgttcca cagggtagcc agcagcatcc 2940
tgcgatgcag atccggaaca taatggtgca gggcgctgac ttccgcgttt ccagacttta 3000
cgaaacacgg aaaccgaaga ccattcatgt tgttgctcag gtcgcagacg ttttgcagca 3060
gcagtcgctt cacgttcgct cgcgtatcgg tgattcattc tgctaaccag taaggcaacc 3120
ccgccagcct agccgggtcc tcaacgacag gagcacgatc atgcgcaccc gtggggccgc 3180
catgccggcg ataatggcct gcttctcgcc gaaacgtttg gtggcgggac cagtgacgaa 3240
ggcttgagcg agggcgtgca agattccgaa taccgcaagc gacaggccga tcatcgtcgc 3300
gctccagcga aagcggtcct cgccgaaaat gacccagagc gctgccggca cctgtcctac 3360
gagttgcatg ataaagaaga cagtcataag tgcggcgacg atagtcatgc cccgcgccca 3420
ccggaaggag ctgactgggt tgaaggctct caagggcatc ggtcgagatc ccggtgccta 3480
atgagtgagc taacttacat taattgcgtt gcgctcactg cccgctttcc agtcgggaaa 3540
cctgtcgtgc cagctgcatt aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat 3600
tgggcgccag ggtggttttt cttttcacca gtgagacggg caacagctga ttgcccttca 3660
ccgcctggcc ctgagagagt tgcagcaagc ggtccacgct ggtttgcccc agcaggcgaa 3720
aatcctgttt gatggtggtt aacggcggga tataacatga gctgtcttcg gtatcgtcgt 3780
atcccactac cgagatatcc gcaccaacgc gcagcccgga ctcggtaatg gcgcgcattg 3840
cgcccagcgc catctgatcg ttggcaacca gcatcgcagt gggaacgatg ccctcattca 3900
gcatttgcat ggtttgttga aaaccggaca tggcactcca gtcgccttcc cgttccgcta 3960
tcggctgaat ttgattgcga gtgagatatt tatgccagcc agccagacgc agacgcgccg 4020
agacagaact taatgggccc gctaacagcg cgatttgctg gtgacccaat gcgaccagat 4080
gctccacgcc cagtcgcgta ccgtcttcat gggagaaaat aatactgttg atgggtgtct 4140
ggtcagagac atcaagaaat aacgccggaa cattagtgca ggcagcttcc acagcaatgg 4200
catcctggtc atccagcgga tagttaatga tcagcccact gacgcgttgc gcgagaagat 4260
tgtgcaccgc cgctttacag gcttcgacgc cgcttcgttc taccatcgac accaccacgc 4320
tggcacccag ttgatcggcg cgagatttaa tcgccgcgac aatttgcgac ggcgcgtgca 4380
gggccagact ggaggtggca acgccaatca gcaacgactg tttgcccgcc agttgttgtg 4440
ccacgcggtt gggaatgtaa ttcagctccg ccatcgccgc ttccactttt tcccgcgttt 4500
tcgcagaaac gtggctggcc tggttcacca cgcgggaaac ggtctgataa gagacaccgg 4560
catactctgc gacatcgtat aacgttactg gtttcacatt caccaccctg aattgactct 4620
cttccgggcg ctatcatgcc ataccgcgaa aggttttgcg ccattcgatg gtgtccggga 4680
tctcgacgct ctcccttatg cgactcctgc attaggaagc agcccagtag taggttgagg 4740
ccgttgagca ccgccgccgc aaggaatggt gcatgcaagg agatggcgcc caacagtccc 4800
ccggccacgg ggcctgccac catacccacg ccgaaacaag cgctcatgag cccgaagtgg 4860
cgagcccgat cttccccatc ggtgatgtcg gcgatatagg cgccagcaac cgcacctgtg 4920
gcgccggtga tgccggccac gatgcgtccg gcgtagagga tcgagatctc gatcccgcga 4980
aattaatacg actcactata ggggaattgt gagcggataa caattcccct ctagaaataa 5040
ttttgtttaa ctttaagaag gagatatacc atgaaggcga ccaaactggt gctgggcgcg 5100
gttatcctgg gtagcaccct gctggcgggt tgcagcagca acgcgaagat cgaccagggc 5160
attaacaaca acggtccgac ccacgaaaac caactgggtg cgggtgcgtt tggtggctac 5220
caagtgaacc cgtatgttgg ctttgaaatg ggttacgatt ggctgggtcg tatgccgtat 5280
aaaggcagcg tggagaacgg tgcgtacaag gcgcagggcg ttcaactgac cgcgaaactg 5340
ggttacccga tcaccgacga tctggacatt tatacccgtc tgggtggcat ggtgtggcgt 5400
gcggacacca aaagcaacgt ttacggcaag aaccacgata ccggtgtgag cccggttttt 5460
gcgggtggcg tggaatatgc gatcaccccg gagattgcga cccgtggtat tccgggtatg 5520
agcattaccc tgagcgatag cgcggcggcg cgtgtgaaca ccttcctggc gaaccgtggc 5580
aagggttttg gtctgcgtct gggcgttcgt accagcggtt gcagcggtat ggcgtacgtg 5640
ctggagttcg ttgacgaacc gaccccggag gacattgtgt ttgaagataa gggcgttaaa 5700
gtggttgtgg atggcaagag cctgcagttc ctggacggta cccaactgga ttttgttaaa 5760
gaaggcctga acgagggttt caaatttacc aacccgaacg tgaaggacga atgcggttgc 5820
ggcgagagct tccacgttta aaagcttgcg gccgcactcg agcaccacca ccaccaccac 5880
tgagatccgg ctgctaacaa agcccgaaag gaagctgagt tggctgctgc caccgctgag 5940
caataactag cataacccct tggggcctct aaacgggtct tgaggggttt tttgctgaaa 6000
ggaggaacta tatccggat 6019

Claims (13)

1. a kind of adsorbed water body heavy metal Escherichia coli transformant, which is characterized in that the transformant is by plasmid pET-Lpp-OmpA- IscA converts Escherichia coli and obtains, and the plasmid includes expression vector pET-28b, Escherichia coli IscA protein gene, large intestine bar Lipoprotein signal peptide Lpp gene and Escherichia coli memebrane protein OmpA gene before bacterium.
2. a kind of adsorbed water body heavy metal Escherichia coli transformant according to claim 1, which is characterized in that the matter Grain pET-Lpp-OmpA-IscA gene order is as shown in SEQ ID NO .1.
3. a kind of adsorbed water body heavy metal Escherichia coli convert preparation, which comprises the following steps:
By one section of encoding genelpp-ompAPCR amplification is carried out, while transferring Escherichia coli by template PCR of Escherichia coliiscA Gene prepares mosaic gene using technique for gene engineeringLpp-OmpA-IscA, by the mosaic gene construction recombination plasmid；
The recombinant plasmid is transferred in Escherichia coli and obtains transformant.
4. a kind of adsorbed water body heavy metal Escherichia coli according to claim 3 convert preparation, which is characterized in that The encoding genelpp-ompAFor lipoprotein signal peptide Lpp 1-9 amino acids and transmembrane protein OmpA before Escherichia coli The encoding gene of 46-159 amino acids fusion sequence.
5. a kind of adsorbed water body heavy metal Escherichia coli according to claim 3 convert preparation, which is characterized in that The encoding gene lpp-ompA PCR amplification step are as follows: using pUC50-lpp-ompA as template, utilize primer Lpp-ompA- F and Lpp-ompA-R, PCR amplificationlpp-ompAGene.
6. a kind of adsorbed water body heavy metal Escherichia coli according to claim 5 convert preparation, which is characterized in that The primer Lpp-ompA-F and Lpp-ompA-R are as follows:
Lpp-ompA-F
5'-TTTAAGAAGGAGATATACCATGAAAAAGACAGCTATCGCGATTGCAG-3'；
Lpp-ompA-R
5’-GCACTGTCGCTCAGTGTAATCGACATACGGGTAGCGATTTCAGGAGTG-3’。
7. a kind of adsorbed water body heavy metal Escherichia coli according to claim 3 convert preparation, which is characterized in that Described transfers Escherichia coli by template PCR of Escherichia coliiscAGene, specific steps are as follows: using primer I scA-F and IscA-R, PCR are transferrediscAGene, reaction condition are as follows: 95 DEG C of initial denaturation 5 min, 95 DEG C of 40 s, 50 DEG C of 40 s, 72 DEG C 2 Min, totally 35 recycle, 10 min of last 72 DEG C of extensions.
8. a kind of adsorbed water body heavy metal Escherichia coli according to claim 7 convert preparation, which is characterized in that The primer I scA-F and IscA-R are as follows:
IscA-F
5'-CACTCCTGAAATCGCTACCCGTATGTCGATTACACTGAGCGACAGTGC-3'；
IscA-R
5’-TGCTCGAGTGCGGCCGCAAGTCAAACGTGGAAGCTTTCGCCGCAACCACAC -3’。
9. a kind of adsorbed water body heavy metal Escherichia coli according to claim 3 convert preparation, which is characterized in that Described prepares mosaic gene using technique for gene engineeringLpp-OmpA-IscASpecific steps are as follows: by encoding genelpp- ompAWithiscANew PCR system is added in 1:1 to genetic fragment in molar ratio, using primer Lpp-ompA-F and IscA-R, passes through Recombinant PCR method connects two segments.
10. a kind of adsorbed water body heavy metal Escherichia coli according to claim 3 convert preparation, feature exists In the specific steps of the construction recombination plasmid are as follows: the lpp-ompA-IscA segment connected after running gel recycles, ThroughNcoI andHinPET28b linear carrier after dIII double digestion carries out seamless clone, and final building obtains Escherichia coli IscA Film surface table recombinant plasmid pET-Lpp-OmpA-IscA.
11. a kind of adsorbed water body heavy metal Escherichia coli according to claim 3 convert preparation, feature exists In the Escherichia coli that the recombinant plasmid is transferred to are BL21 (DE3).
12. a kind of Escherichia coli transformant comprising claim 1 is in the application prepared in adsorbed water body Heavy Metal Reagent.
13. a kind of transformant comprising claim 1 according to claim 12 is preparing adsorbed water body Heavy Metal Reagent In application, which is characterized in that pET-Lpp-OmpA-IscA/BL21 bacterial strain is transferred in M9 culture medium and expands culture to OD600 It is 0.8, the IPTG of final concentration of 200 μm of ol/L is added, induces 24 h under the conditions of 25 DEG C, will be abandoned after the bacterium solution centrifugation after induction Remove culture medium, be resuspended again after washing 2 times with PBS solution, by bacterium solution all centrifugation discard supernatant, be added heavy metal solution be resuspended into Row application.
CN201811558589.1A 2018-12-19 2018-12-19 Escherichia coli transformant capable of adsorbing heavy metal in water and application thereof Active CN109593698B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201811558589.1A CN109593698B (en) 2018-12-19 2018-12-19 Escherichia coli transformant capable of adsorbing heavy metal in water and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201811558589.1A CN109593698B (en) 2018-12-19 2018-12-19 Escherichia coli transformant capable of adsorbing heavy metal in water and application thereof

Publications (2)

Publication Number Publication Date
CN109593698A true CN109593698A (en) 2019-04-09
CN109593698B CN109593698B (en) 2020-08-25

Family

ID=65964053

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201811558589.1A Active CN109593698B (en) 2018-12-19 2018-12-19 Escherichia coli transformant capable of adsorbing heavy metal in water and application thereof

Country Status (1)

Country Link
CN (1) CN109593698B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111454978A (en) * 2020-03-31 2020-07-28 天津大学 Surface display engineering bacterium for specifically adsorbing heavy metal lead and construction method and application thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106279374A (en) * 2016-08-26 2017-01-04 深圳市职业病防治院 A kind of polypeptide being combined with lead ion and application thereof
CN107287225A (en) * 2017-06-27 2017-10-24 深圳劲宇生物科技有限公司 Gold ion is detected and adsorption system and its Host Strains, gold ion recovery method

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106279374A (en) * 2016-08-26 2017-01-04 深圳市职业病防治院 A kind of polypeptide being combined with lead ion and application thereof
CN107287225A (en) * 2017-06-27 2017-10-24 深圳劲宇生物科技有限公司 Gold ion is detected and adsorption system and its Host Strains, gold ion recovery method

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
GUOQIANG TAN ET AL.: "Copper Binding in IscA Inhibits Iron-Sulphur Cluster Assembly in Escherichia Coli", 《MOL MICROBIOL》 *
NCBI REFERENCE SEQUENCE: NP_415477.1: "outer membrane porin A [Escherichia coli str. K-12 substr. MG1655]", 《NCBI-GENE》 *
NCBI REFERENCE SEQUENCE: NP_416192.1: "murein lipoprotein [Escherichia coli str. K-12 substr. MG1655]", 《NCBI-GENE》 *
NCBI REFERENCE SEQUENCE: NP_417023.1: "iron-sulfur cluster insertion protein IscA [Escherichia coli str. K-12 substr. MG1655]", 《NCBI-GENE》 *
WEI WEI ET AL.: "Simple Whole-Cell Biodetection and Bioremediation of Heavy Metals Based on an Engineered Lead-Specific Operon", 《ENVIRON SCI TECHNOL》 *
百度文库: "pET-28b(+)大肠杆菌表达载体说明", 《HTTPS://WENKU.BAIDU.COM/VIEW/A1B98FE1CC1755270622082F.HTML?FROM=SEARCH》 *
路延笃 等: "细菌表面展示技术及其在环境重金属污染修复中的意义", 《生态与农村环境学报》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111454978A (en) * 2020-03-31 2020-07-28 天津大学 Surface display engineering bacterium for specifically adsorbing heavy metal lead and construction method and application thereof
CN111454978B (en) * 2020-03-31 2023-04-18 天津大学 Surface display engineering bacterium for specifically adsorbing heavy metal lead and construction method and application thereof

Also Published As

Publication number Publication date
CN109593698B (en) 2020-08-25

Similar Documents

Publication Publication Date Title
CN111454978B (en) Surface display engineering bacterium for specifically adsorbing heavy metal lead and construction method and application thereof
CN111304232B (en) Method for purifying protein based on membrane surface fusion expression strategy and application thereof
CN106676051A (en) Method for preparing genetically engineered bacteria for efficiently compounding pantothenic acid and application thereof
CN110257356B (en) Enzyme capable of being used for synthesizing carnosine and coding gene thereof
CN111850007A (en) Cellulosobody docking protein combination mutant 36864 applicable to low calcium ion concentration and application
CN111848758B (en) Cellulosome docking protein mutant suitable for low calcium ion concentration and application
CN114774452B (en) Construction method and application of engineering escherichia coli for adsorbing mercury ions in solution
CN107739404A (en) A kind of protectiveness people PrPC G127I mutant and its construction method
CN109593698B (en) Escherichia coli transformant capable of adsorbing heavy metal in water and application thereof
CN113151214B (en) Protein PnlipA with lipase activity and gene and application thereof
CN112592877B (en) Recombinant escherichia coli for over-expressing lsrC gene and construction method and application thereof
CN111848757B (en) Cellulosome docking protein combined mutant 36862 suitable for low calcium ion concentration and application
CN113383080B (en) Bacterial expression vectors for increasing protein secretion
KR20180010642A (en) Transformed E. coli producing pili(F4, F18) and heat labile toxin(LT) for postweaing diarrhea vaccine in pigs and vaccine composition comprising the pili and LT produced by the same
CN112501103A (en) Recombinant escherichia coli for over-expressing lsrB gene and construction method and application thereof
CN114150002A (en) Light-operated gene switch and application thereof
CN111850005A (en) Cellulosome docking protein combined mutant 36863 suitable for low calcium ion concentration and application
CN111848759B (en) Cellulosomal dockerin mutant 36741 with improved activity and application thereof
CN109439680B (en) Method for preparing antibacterial recombinant protein
CN111850004B (en) Cellulosomal dockerin mutant 36740 with improved activity and application thereof
CN113122558B (en) Expression vector of membrane protein AmpG and expression and purification method thereof
CN113122561B (en) Expression vector of membrane protein SohB and expression and purification method thereof
CN114591985B (en) Mutant pectin lyase and application thereof
CN111850006B (en) Cellulosome docking protein combined mutant 36865 suitable for low calcium ion concentration and application
CN113122557A (en) Expression vector of membrane protein AmtB and expression purification method thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant