CN107739404A - A kind of protectiveness people PrPC G127I mutant and its construction method - Google Patents

Abstract

The invention discloses a kind of protectiveness people PrPC G127I mutant and its construction method.The amino acids of PrPC 127 are sported Ile by the present invention by the method for point mutation to recombinate wild type human PrPC as template by Gly.After expression and purification, after testing, the ability of mutant fibrosis in vitro is markedly less than wild type PrPC, and its fiber growth lag phase is more than 5 times of wild type.Therefore people's PrPC mutant of present invention gained has very wide application prospect in such as CJD of the disease caused by prion protein etc. treatment and drug development.

Description

A kind of protectiveness people PrPC G127I mutant and its construction method

Technical field

The invention belongs to gene engineering technology field, and in particular to a kind of protectiveness people PrPC mutant G127I and its Construction method.

Background technology

Prion protein (prion) is a kind of protein virulence factor, and it has what is propagated in mammal span species Ability, the lethal nerve degenerative diseases such as people's creutzfeldt-Jacob disease (CJD) can be caused.Research finds that PrPC is normal by its Cellular type PrP^CIt is converted into pathotype PrP^Sc, and gather the generation to form amyloid fiber and result in such disease in big intracerebral. PrPC PrP^CTo PrP^ScThe process of conversion is the pathogenetic committed step of the diseases such as CJD, for this important process, is had at present Two kinds of models：First, template submodel thinks PrP^CTo PrP^ScSpontaneously conformation transition can be hindered by higher dynamics, PrP^ScMonomer and PrP^CMonomer combines to form heterodimer and promotes PrP^CTo PrP^ScTransformation；Second, poly Hopkinson effect Think PrP^CWith PrP^ScBetween reversible dynamic equilibrium, PrP be present^ScThe addition of seed promotes PrP^CTo PrP^ScTransformation, together When the PrP that is formed^ScMore stable structure, which is combined into, with seed further promotes this conformation transition process.In PrP conformation In transformation, the most key step is exactly PrP^CWith PrP^ScForm heterodimer.

PrPC has many mutant to cause the diseases such as CJD, and the wherein amino acids of PrPC the 129th have polymorphic Property, Met either Val can be encoded, and find that the patient of CJD infection is Met at present₁₂₉Homozygote, research think 129 Position MV heterozygotes can suppress the combination of PrP heterodimers, so as to suppress PrP^ScFormation.Recently, researcher has found again Another mutant with protectiveness, after the glycine Gly of 127 sport valine Val, experiment mice can The infection of a variety of plant type prions is resisted, with 129 polymorphism differences, PrPC G127V mutant itself can not only suppress PrP conformation transition, while propagation and the propagation of wild-type prion can also be suppressed.PrPC G127V mutant is suppressed The research of the architecture basics of prion propagation, helps to disclose the mechanism of prion propagation, exploitation to related drugs and controls Treatment has directive significance, has very big application potential.Therefore, it is necessary to the mutation to the amino acids of PrPC the 127th is carried out Further research.

The content of the invention

It is an object of the invention to provide a kind of lag phase of fibrosis in vitro it is long, it is intracellular be difficult to assemble, Proteinase K resists The weak people's PrPC G127I mutant of property, the mutant can suppress the conformation transition of PrPC, can suppress the mistake of PrPC Fold and assemble by mistake, be expected to resist the infection of prion.

It is a further object of the invention to provide the preparation method of people's PrPC G127I mutant.

Moved back it is still another object of the present invention to provide people's PrPC G127I mutant in nerves such as treatment creutzfeldt-Jacob diseases Application in the drug development of row disease.

The present invention is achieved through the following technical solutions above-mentioned purpose：

In a first aspect, people's PrPC G127I mutant provided by the invention, its amino acid sequence such as SEQ ID NO：1 institute Show.

Second aspect, the gene for encoding described people's PrPC G127I mutant fall within protection scope of the present invention.

The gene can be it is following 1) or 2) in any described DNA molecular：

1) the SEQ ID NO of sequence table：DNA molecular shown in 2；

2) DNA sequence dna with 1) limiting has more than 90% homology and coding SEQ ID NO：1 protein DNA Molecule.

The third aspect, the present invention provide the recombinant expression carriers of the G127I mutant genes of PrPC containing someone, expression cassette, Transgenic cell line or recombinant bacterium.

Fourth aspect, the preparation method of people's PrPC G127I mutant of the present invention, comprises the following steps：

1) plasmid containing encoding human PrPC G127I mutant is obtained：Using pET30a-hPrP recombinant plasmids as template, The wherein nucleotide sequence of pET30a-hPrP recombinant plasmids such as SEQ ID NO：Shown in 3, design primer is：

Forward primer：5’CCTTGGCATCTACATGCTGGGAAGTGC3’(SEQ ID NO：4)；

Reverse primer：5’GCACTTCCCAGCATGTAGATGCCAAGG3’(SEQ ID NO：5)；

Rite-directed mutagenesis is carried out to the amino acids of PrPC the 127th by PCR, obtains the G127I mutant of PrPC containing someone The recombinant plasmid pET30a-hPrP (G127I) of gene；

2) expression and purification people PrPC G127I mutant：Recombinant plasmid pET30a-hPrP (G127I) is transformed into E.coli BL21 (DE3) (comes from Wuhan University's Type Tissue Collection), will contain the BL21 of pET30a-hPrP (G127I) plasmid Bacterial strain activates in LB culture mediums, is cultivated by expanding, and IPTG induced expressions obtain the inclusion body of mutant protein；In denaturation bar Under part, with Ni-Sepharose post preliminary purifications, after renaturation, further correctly folded with C4 reverse chromatograms post by HPLC Mutant protein.

5th aspect, people's PrPC G127I mutant of the present invention, it can be applied to the nerves such as treatment creutzfeldt-Jacob disease and move back The medicament research and development of row disease.

6th aspect, the present invention provide a kind of prion inhibitor, and its active component contains people's protein egg of the present invention White G127I mutant.

In one embodiment of the invention, the PrPC that the fluorescence intensity after being dyed by thioflavine T (ThT) is calculated And its result of the external fibrosis lag phase of mutant shows, the lag phase of people's PrPC G127I and G127V mutant is respectively 5.3 times of wild type and 3.2 times, no matter the amino acids size of other mutant 127 (tryptophan G127W, alanine G127A) Either different acid-base property (lysine G127K, glutamic acid G127E) influence little on its fibrosis.According to being dissolved in detergent The time that Sarkosyl PrPC monomer band disappears is different, and G127I even is more difficult to assemble than G127V.

In another embodiment of the invention, PrPC mutant is overexpressed in RK13 cells, detection cell cracking The content of PrPC mutant fiber in being precipitated after thing ultracentrifugation insoluble in Sarkosyl, experiment show to express in the cell PrPC total amount it is consistent in the case of, the aggregation insoluble in Sarkosyl that G127V and G127I are formed is fewer than wild type, And the fiber that G127I is formed is less than G127V.

Resistance of the PrPC mutant to Proteinase K in detection cell lysate, the results showed that G127V and G127I ratios are wild Raw type PrPC is easier to be degraded by PK enzymes.

People's PrPC G127I mutant of gained of the invention does not report that we construct a variety of recombined human protein eggs before this White 127 amino acids mutant such as G127A, G127E, G127K, G127W, G127I, wherein only G127I and G127V has phase As property, the lag phase for being mainly manifested in external fibrosis is 5.3 times and 3.2 times of wild type respectively；Equally, intracellular mistake The G127I and G127V of expression are more difficult to assemble than wild type, and PK resistances are weaker.Our result indicate that G127I is to PrPC The inhibitory action of aggregation is even more preferable than G127V, and the research to this mutant contributes to the exploitation of medicine and the base of CJD diseases Because for the treatment of.

Brief description of the drawings

Fig. 1 is the sequencing result of restructuring wild type PrPC and G127I mutant.

Fig. 2 is for restructuring wild type PrPC with G127I mutant through C4 reverse-phase chromatographic column acetonitrile/water gradient elution peaks.

Fig. 3 is to recombinate wild type PrPC and G127I mutant SDS-PAGE expression analysis figures,

Purpose band molecular size range is 23kDa.

Fig. 4 is wild type PrPC and the external fiber growth dynamics of 127 mutant,

A is that the fluorescence intensity after thioflavine T (ThT) dyeing is fitted with S types curvilinear equation, and b-h is that Sarkosyl is tested The situation of wild type PrPC and 127 mutant aggregation in vitro is demonstrate,proved, i is the fluorescence intensity after being dyed by thioflavine T (ThT) The result of the external fibrosis lag phase of PrPC and its mutant calculated.

Fig. 5 is the aggregation situation of intracellular PrPC and its mutant,

A be on SDS-PAGE insoluble in detergent Sarkosyl PrPC precipitation band (on) and total PrPC band (under), b is the relative amount (up/down) of the PrPC fiber obtained to the result in a by gray analysis.

Fig. 6 is the PrPC of cell expression and its PK resistances of mutant.

Embodiment

By combination accompanying drawing described further below it will be further appreciated that the features and advantages of the invention.The implementation provided Example is only explanation to the inventive method, remaining content without limiting the invention in any way announcement.

【Embodiment 1】Build recombined human PrPC mutant G127I

Using wild type recombined human PrPC plasmid pET30a-hPrP as template, the plasmid is this laboratory structure early stage, No. genbank is AB300823.1, DNA sequence dna such as SEQ ID NO corresponding to hPrP：Shown in 1, amino acid sequence such as SEQ ID NO：Shown in 2, pET30a-hPrP vector DNA sequences such as SEQ ID NO：Shown in 3, Ile is designed₁₂₇Primer, primer sequence are as follows：

Forward primer：5’CCTTGGCATCTACATGCTGGGAAGTGC3’(SEQ ID NO：4)

Reverse primer：5’GCACTTCCCAGCATGTAGATGCCAAGG3’(SEQ ID NO：5)

Rite-directed mutagenesis is carried out by PCR, PCR amplification system is：

3 μ l DNA profilings；

5 μ l buffer solution 10 × PCR Buffer for KOD-Plus-；

5μl 2mM dNTPs；

2μl 25mM MgSO₄；

1 μ l forward primers；

1 μ l reverse primers；

1 μ l enzymes KOD-Plus-；

ddH₂O polishings are to 50 μ l.

PCR response procedures are：

S1:94℃,5min；

S2:98℃,10s；

S3:59℃,30s；

S4:68℃,1min/kb；

Repeat S2 to S4 28 times.

PCR primer is as follows with DpnI enzymic digestion templates, reaction system：2 μ 10 × Tango of l buffer, 1.5 μ l DpnI Enzyme, PCR primer polishing to 20 μ l, mix, 37 DEG C of incubation 1h.Take 5 μ l digestion products to add in 50 μ l DH5 α competence, mix, Ice bath 30min.42 DEG C of water-bath thermal shock 90s, at once ice bath 3min, LB culture mediums are then added to 1ml and are placed in 37 DEG C of 220rpm 1h is cultivated in shaking table.Converted product is coated on the LB culture medium flat plates of 100mg/L kanamycins, is placed in 37 DEG C and is incubated overnight.From Monoclonal bacterium colony is selected on flat board in LB culture mediums, 8h is cultivated in 37 DEG C of 220rpm shaking tables, each monoclonal bacterium colony is divided into Two parts, portion is used to be sequenced, and another adds the glycerine of final concentration 20% and is stored in -80 DEG C.Sequencing result is compared, will be correctly mutated Bacterial strain extraction plasmid and be transformed into E.coli BL21 (DE3) (coming from Wuhan University's Type Tissue Collection).

【Embodiment 2】PrPC mutant G127I expression and purification

A, the BL21 inoculations of pET30a-hPrP (G127I) plasmid will be contained in the 10ml LB cultures containing kanamycins Activated in base test tube, 37 DEG C of 220rpm cultivate 8-10h.

B, by the bacterium solution switching of 1ml activation as in LB culture mediums of the 250ml containing kanamycins, 37 DEG C of 220rpm expand culture 3-4h (OD ≈ 0.5), add final concentration 1mM IPTG induced expressions, 37 DEG C of 220rpm overnight inductions in shaking table.

C, 4 DEG C of 17000g centrifugations 2min collect thalline, abandon supernatant.It is deposited in -80 DEG C after freeze thawing once, is resuspended in and splits bacterium Buffer solution (20mM Tris, 150mM NaCl, 2mM EDTA, 0.1%Triton X-100,2mM PMSF, pH 7.4).200W Ultrasound splits bacterium 30min, ultrasonic 3s intervals 3s.4 DEG C of 17000g centrifuge 30min, abandon supernatant.

D, inclusion body is washed with following buffer solution respectively：20mM Tris, 20mM NaCl, 0.5% (v/v) Triton X- 100,pH 7.4；20mM Tris,2M NaCl,pH7.4；7.4,4 DEG C of 20mM Tris, 150mM NaCl, 2M Urea, pH 17000g centrifugations 15min abandons supernatant, and inclusion body precipitation is resuspended in phosphate buffer (8M Urea, 100mM Na₂HPO₄,10mM Tris, 1mM beta -mercaptoethanol, pH 8.0), 4 DEG C of dissolvings are overnight.

E, 4 DEG C of 17000g centrifugations 1h collect supernatant, and 0.45 μm of filter membrane filters.Purified, passed through using Ni-Sepharose posts The steps such as balance, loading, elution, the recombined human PrPC mutant G127I of preliminary purification can be obtained.Eluent is above-mentioned phosphorus Acid buffer adjusts pH to less than 4.5.

F, the protein compression of Ni-Sepharose posts purifying is calculated according to PrPC mutant G127I molar extinction coefficient Degree, and 0.1-0.3mg/ml is diluted to renaturation buffer (0.1M Tris, 6M Urea, pH7.5), load clean bag filter And dialysis renaturation at least 12h at room temperature.

G, the good mutant protein of renaturation, which through HPLC is crossed C4 reverse chromatograms posts and is further purified, isolates the weight correctly folded Histone albumen.As shown in Figure 2,3.Purified protein is dialysed to deionized water, protein concentrate to 2mg/ml or so, packing It is stored in -80 DEG C.

【Embodiment 3】The detection of PrPC and its mutant aggregates ability

A, it is similar with G127I, other proteins for needing to detect are built by the method for point mutation on pET30a-hPrP plasmids Protein mutant, expression and purification is carried out such as G127W, G127A, G127K, G127E, and according to purifying G127I identicals method. Above-mentioned mutant after purification is dialysed to the phosphate buffer (2M GdnHCl, 0.1M PBS, pH 7.0) of the guanidine hydrochloride containing 2M, Final concentration of 10 μM, it is placed in 37 DEG C of 220rpm of shaking table and persistently shakes.According to time sampling, 20 μ l samples dilute ten times and delayed to phosphoric acid Fliud flushing (pH 7.0), adds final concentration of 125 μM of thioflavine T (ThT), and the μ l of final volume 200 add the measurement of 96 hole elisa Plates 450nm is excited, the fluorescent value of 480nm transmittings.The ThT fluorescent values of gained are fitted (Cohlberg JA, et with S types curvilinear equation al.,Heparin and other glycosamlnoglycans stimulate the formation of amyloid fibrils from-synuclein in vitro.Biochemistry 41:1502-1511.), equation F=F₀+(A+ ct)/{1+exp[k(t_m- t)] }, wherein F is fluorescent value in time t, F₀For lag phase when Baseline fluorescence values, A+ct is The fluorescent value of fiber plateau is ultimately formed, k represents fiber growth speed, t_mIt is the time that fluorescent value reaches maximum half. The computational methods of PrPC and its external fibrosis lag phase of mutant are t_m-2/k.It is another to take 10 μ l samples and final concentration 2% Sarcosyl (Sarkosyl) is incubated at room temperature at least 30min, and mixture adds the loading without beta -mercaptoethanol and delayed The direct loading 12.5%SDS-PAGE of fliud flushing, is detected with coomassie brilliant blue staining.

The PrPC and its external fibrosis of mutant that fluorescence intensity after being dyed by thioflavine T (ThT) is calculated prolong The result of demurrage shows that the lag phase of people's PrPC G127I and G127V mutant is 5.3 times and 3.2 times of wild type respectively, No matter other amino acids sizes of mutant 127 (tryptophan G127W, alanine G127A) or different acid-base property (rely ammonia Sour G127K, glutamic acid G127E) its fibrosis is influenceed less, as shown in Fig. 4 a and 4i.According to being dissolved in detergent The time that Sarkosyl PrPC monomer band disappears is different, and as shown in Fig. 4 b-h, G127I even is more difficult to gather than G127V Collection.

B, the ability of aggregation of PrPC and its mutant is detected into the cell：Because pET30a carriers are prokaryotic expression carrier, Prion protein gene need to be cloned on fibrocyte expression vector pcDNA3.1, vector DNA sequence such as SEQ ID NO：Shown in 6, PcDNA3.1-hPrP plasmids are this laboratory structure early stage.By above-mentioned molecular biology method using pcDNA3.1-hPrP plasmids as Template, G127I mutant is built by the method for point mutation, its construction method is as follows：

Forward primer：5’CCTTGGCATCTACATGCTGGGAAGTGC3’

Reverse primer：5’GCACTTCCCAGCATGTAGATGCCAAGG3’

Rite-directed mutagenesis is carried out by PCR, PCR amplification system is：

3 μ l DNA profilings；

5 μ l buffer solution 10 × PCR Buffer for KOD-Plus-；

5μl 2mM dNTPs；

2μl 25mM MgSO₄；

1 μ l forward primers；

1 μ l reverse primers；

1 μ l enzymes KOD-Plus-；

ddH₂O polishings are to 50 μ l.

PCR response procedures are：

S1:94℃,5min；

S2:98℃,10s；

S3:59℃,30s；

S4:68℃,1min/kb；

Repeat S2 to S4 28 times.

PCR primer is as follows with DpnI enzymic digestion templates, reaction system：2 μ 10 × Tango of l buffer, 1.5 μ l DpnI Enzyme, PCR primer polishing to 20 μ l, mix, 37 DEG C of incubation 1h.Take 5 μ l digestion products to add in 50 μ l DH5 α competence, mix, Ice bath 30min.42 DEG C of water-bath thermal shock 90s, at once ice bath 3min, LB culture mediums are then added to 1ml and are placed in 37 DEG C of 220rpm 1h is cultivated in shaking table.Converted product is coated on the LB culture medium flat plates of 100mg/L ammonia benzyl mycins, is placed in 37 DEG C and is incubated overnight.From Monoclonal bacterium colony is selected on flat board in LB culture mediums, 8h is cultivated in 37 DEG C of 220rpm shaking tables, each monoclonal bacterium colony is divided into Two parts, portion is used to be sequenced, and another adds the glycerine of final concentration 20% and is stored in -80 DEG C.Sequencing result is compared, will be correctly mutated Bacterial strain extraction plasmid.

With2000 (Invitrogen, Carlsbad, CA) are by pcDNA3.1-hPrP and are mutated constitution Grain is transferred to rabbit renal epithelial cell (RK13) wink.48h after transfection, is collected and cell lysis, 4 DEG C of 10000g centrifugations 10min remove thin After born of the same parents' fragment, cell lysate is divided into two parts, a portion adds the Sarkosyl incubations at room temperature of final concentration 1% 30min, then by mixture under the conditions of 4 DEG C of 150000g ultracentrifugation 30min, then wash primary sedimentation with PBS, obtain insoluble In detergent Sarkosyl precipitation, add SDS-PAGE sample-loading buffers and boil, prepare loading；Another part cell cracks Thing adds sample-loading buffer and detects the total protein in cell lysate with this.After sample makes, loading 12.5%SDS-PAGE And the PrPC content in total protein and precipitation is detected by Western blot method, antibody is the PrPC list in mouse source Clonal antibody 3F4.As shown in figure 5, in the case that the PrPC total amount of cell inner expression is consistent, what G127V and G127I were formed Aggregation insoluble in Sarkosyl is fewer than wild type, and the fiber that G127I is formed is less than G127V.

Detect the PrPC of cell expression and its PK resistances of mutant.The albumen of above-mentioned cell lysate and various concentrations Enzyme K (PK) is incubated 1h under the conditions of 37 DEG C jointly, and PK enzyme concentrations are 0,0.1,0.2,0.5 μ g/ml, adds 1mM PMSF and terminates instead Should.Enzymolysis product adds sample-loading buffer, boils 10min, is splined on 12.5%SDS-PAGE and by Western blot's Method detects the PrPC content with PK resistances, and antibody is mouse source monoclonal antibody 3F4.As shown in fig. 6, G127V and G127I ratios are wild Raw type PrPC is easier to be degraded by PK enzymes.

Sequence table

<110>Wuhan University

<120>A kind of protectiveness people PrPC G127I mutant and its construction method

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 209

<212> PRT

<213>PrPC (prion)

<400> 1

Lys Lys Arg Pro Lys Pro Gly Gly Trp Asn Thr Gly Gly Ser Arg Tyr

1 5 10 15

Pro Gly Gln Gly Ser Pro Gly Gly Asn Arg Tyr Pro Pro Gln Gly Gly

20 25 30

Gly Gly Trp Gly Gln Pro His Gly Gly Gly Trp Gly Gln Pro His Gly

35 40 45

Gly Gly Trp Gly Gln Pro His Gly Gly Gly Trp Gly Gln Pro His Gly

50 55 60

Gly Gly Trp Gly Gln Gly Gly Gly Thr His Ser Gln Trp Asn Lys Pro

65 70 75 80

Ser Lys Pro Lys Thr Asn Met Lys His Met Ala Gly Ala Ala Ala Ala

85 90 95

Gly Ala Val Val Gly Gly Leu Gly Ile Tyr Met Leu Gly Ser Ala Met

100 105 110

Ser Arg Pro Ile Ile His Phe Gly Ser Asp Tyr Glu Asp Arg Tyr Tyr

115 120 125

Arg Glu Asn Met His Arg Tyr Pro Asn Gln Val Tyr Tyr Arg Pro Met

130 135 140

Asp Glu Tyr Ser Asn Gln Asn Asn Phe Val His Asp Cys Val Asn Ile

145 150 155 160

Thr Ile Lys Gln His Thr Val Thr Thr Thr Thr Lys Gly Glu Asn Phe

165 170 175

Thr Glu Thr Asp Val Lys Met Met Glu Arg Val Val Glu Gln Met Cys

180 185 190

Ile Thr Gln Tyr Glu Arg Glu Ser Gln Ala Tyr Tyr Gln Arg Gly Ser

195 200 205

Ser

<210> 2

<211> 633

<212> DNA

<213>PrPC (prion)

<400> 2

atgaagaagc gcccgaagcc tggaggatgg aacactgggg gcagccgata cccggggcag 60

ggcagccctg gaggcaaccg ctacccacct cagggcggtg gtggctgggg gcagcctcat 120

ggtggtggct gggggcagcc tcatggtggt ggctgggggc agccccatgg tggtggctgg 180

ggacagcctc atggtggtgg ctggggtcaa ggaggtggca cccacagtca gtggaacaag 240

ccgagtaagc caaaaaccaa catgaagcac atggctggtg ctgcagcagc tggggcagtg 300

gtggggggcc ttggcatcta catgctggga agtgccatga gcaggcccat catacatttc 360

ggcagtgact atgaggaccg ttactatcgt gaaaacatgc accgttaccc caaccaagtg 420

tactacaggc ccatggatga gtacagcaac cagaacaact ttgtgcacga ctgcgtcaat 480

atcacaatca agcagcacac ggtcaccaca accaccaagg gggagaactt caccgagacc 540

gacgttaaga tgatggagcg cgtggttgag cagatgtgta tcacccagta cgagagggaa 600

tctcaggcct attaccagag aggatcgagc tga 633

<210> 3

<211> 5905

<212> DNA

<213>Artificial sequence ()

<400> 3

tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg 60

cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc 120

ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg 180

gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc 240

acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt 300

ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc 360

ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta 420

acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt 480

tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta 540

tccgctcatg aattaattct tagaaaaact catcgagcat caaatgaaac tgcaatttat 600

tcatatcagg attatcaata ccatattttt gaaaaagccg tttctgtaat gaaggagaaa 660

actcaccgag gcagttccat aggatggcaa gatcctggta tcggtctgcg attccgactc 720

gtccaacatc aatacaacct attaatttcc cctcgtcaaa aataaggtta tcaagtgaga 780

aatcaccatg agtgacgact gaatccggtg agaatggcaa aagtttatgc atttctttcc 840

agacttgttc aacaggccag ccattacgct cgtcatcaaa atcactcgca tcaaccaaac 900

cgttattcat tcgtgattgc gcctgagcga gacgaaatac gcgatcgctg ttaaaaggac 960

aattacaaac aggaatcgaa tgcaaccggc gcaggaacac tgccagcgca tcaacaatat 1020

tttcacctga atcaggatat tcttctaata cctggaatgc tgttttcccg gggatcgcag 1080

tggtgagtaa ccatgcatca tcaggagtac ggataaaatg cttgatggtc ggaagaggca 1140

taaattccgt cagccagttt agtctgacca tctcatctgt aacatcattg gcaacgctac 1200

ctttgccatg tttcagaaac aactctggcg catcgggctt cccatacaat cgatagattg 1260

tcgcacctga ttgcccgaca ttatcgcgag cccatttata cccatataaa tcagcatcca 1320

tgttggaatt taatcgcggc ctagagcaag acgtttcccg ttgaatatgg ctcataacac 1380

cccttgtatt actgtttatg taagcagaca gttttattgt tcatgaccaa aatcccttaa 1440

cgtgagtttt cgttccactg agcgtcagac cccgtagaaa agatcaaagg atcttcttga 1500

gatccttttt ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg 1560

gtggtttgtt tgccggatca agagctacca actctttttc cgaaggtaac tggcttcagc 1620

agagcgcaga taccaaatac tgtccttcta gtgtagccgt agttaggcca ccacttcaag 1680

aactctgtag caccgcctac atacctcgct ctgctaatcc tgttaccagt ggctgctgcc 1740

agtggcgata agtcgtgtct taccgggttg gactcaagac gatagttacc ggataaggcg 1800

cagcggtcgg gctgaacggg gggttcgtgc acacagccca gcttggagcg aacgacctac 1860

accgaactga gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc cgaagggaga 1920

aaggcggaca ggtatccggt aagcggcagg gtcggaacag gagagcgcac gagggagctt 1980

ccagggggaa acgcctggta tctttatagt cctgtcgggt ttcgccacct ctgacttgag 2040

cgtcgatttt tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc cagcaacgcg 2100

gcctttttac ggttcctggc cttttgctgg ccttttgctc acatgttctt tcctgcgtta 2160

tcccctgatt ctgtggataa ccgtattacc gcctttgagt gagctgatac cgctcgccgc 2220

agccgaacga ccgagcgcag cgagtcagtg agcgaggaag cggaagagcg cctgatgcgg 2280

tattttctcc ttacgcatct gtgcggtatt tcacaccgca tatatggtgc actctcagta 2340

caatctgctc tgatgccgca tagttaagcc agtatacact ccgctatcgc tacgtgactg 2400

ggtcatggct gcgccccgac acccgccaac acccgctgac gcgccctgac gggcttgtct 2460

gctcccggca tccgcttaca gacaagctgt gaccgtctcc gggagctgca tgtgtcagag 2520

gttttcaccg tcatcaccga aacgcgcgag gcagctgcgg taaagctcat cagcgtggtc 2580

gtgaagcgat tcacagatgt ctgcctgttc atccgcgtcc agctcgttga gtttctccag 2640

aagcgttaat gtctggcttc tgataaagcg ggccatgtta agggcggttt tttcctgttt 2700

ggtcactgat gcctccgtgt aagggggatt tctgttcatg ggggtaatga taccgatgaa 2760

acgagagagg atgctcacga tacgggttac tgatgatgaa catgcccggt tactggaacg 2820

ttgtgagggt aaacaactgg cggtatggat gcggcgggac cagagaaaaa tcactcaggg 2880

tcaatgccag cgcttcgtta atacagatgt aggtgttcca cagggtagcc agcagcatcc 2940

tgcgatgcag atccggaaca taatggtgca gggcgctgac ttccgcgttt ccagacttta 3000

cgaaacacgg aaaccgaaga ccattcatgt tgttgctcag gtcgcagacg ttttgcagca 3060

gcagtcgctt cacgttcgct cgcgtatcgg tgattcattc tgctaaccag taaggcaacc 3120

ccgccagcct agccgggtcc tcaacgacag gagcacgatc atgcgcaccc gtggggccgc 3180

catgccggcg ataatggcct gcttctcgcc gaaacgtttg gtggcgggac cagtgacgaa 3240

ggcttgagcg agggcgtgca agattccgaa taccgcaagc gacaggccga tcatcgtcgc 3300

gctccagcga aagcggtcct cgccgaaaat gacccagagc gctgccggca cctgtcctac 3360

gagttgcatg ataaagaaga cagtcataag tgcggcgacg atagtcatgc cccgcgccca 3420

ccggaaggag ctgactgggt tgaaggctct caagggcatc ggtcgagatc ccggtgccta 3480

atgagtgagc taacttacat taattgcgtt gcgctcactg cccgctttcc agtcgggaaa 3540

cctgtcgtgc cagctgcatt aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat 3600

tgggcgccag ggtggttttt cttttcacca gtgagacggg caacagctga ttgcccttca 3660

ccgcctggcc ctgagagagt tgcagcaagc ggtccacgct ggtttgcccc agcaggcgaa 3720

aatcctgttt gatggtggtt aacggcggga tataacatga gctgtcttcg gtatcgtcgt 3780

atcccactac cgagatgtcc gcaccaacgc gcagcccgga ctcggtaatg gcgcgcattg 3840

cgcccagcgc catctgatcg ttggcaacca gcatcgcagt gggaacgatg ccctcattca 3900

gcatttgcat ggtttgttga aaaccggaca tggcactcca gtcgccttcc cgttccgcta 3960

tcggctgaat ttgattgcga gtgagatatt tatgccagcc agccagacgc agacgcgccg 4020

agacagaact taatgggccc gctaacagcg cgatttgctg gtgacccaat gcgaccagat 4080

gctccacgcc cagtcgcgta ccgtcttcat gggagaaaat aatactgttg atgggtgtct 4140

ggtcagagac atcaagaaat aacgccggaa cattagtgca ggcagcttcc acagcaatgg 4200

catcctggtc atccagcgga tagttaatga tcagcccact gacgcgttgc gcgagaagat 4260

tgtgcaccgc cgctttacag gcttcgacgc cgcttcgttc taccatcgac accaccacgc 4320

tggcacccag ttgatcggcg cgagatttaa tcgccgcgac aatttgcgac ggcgcgtgca 4380

gggccagact ggaggtggca acgccaatca gcaacgactg tttgcccgcc agttgttgtg 4440

ccacgcggtt gggaatgtaa ttcagctccg ccatcgccgc ttccactttt tcccgcgttt 4500

tcgcagaaac gtggctggcc tggttcacca cgcgggaaac ggtctgataa gagacaccgg 4560

catactctgc gacatcgtat aacgttactg gtttcacatt caccaccctg aattgactct 4620

cttccgggcg ctatcatgcc ataccgcgaa aggttttgcg ccattcgatg gtgtccggga 4680

tctcgacgct ctcccttatg cgactcctgc attaggaagc agcccagtag taggttgagg 4740

ccgttgagca ccgccgccgc aaggaatggt gcatgcaagg agatggcgcc caacagtccc 4800

ccggccacgg ggcctgccac catacccacg ccgaaacaag cgctcatgag cccgaagtgg 4860

cgagcccgat cttccccatc ggtgatgtcg gcgatatagg cgccagcaac cgcacctgtg 4920

gcgccggtga tgccggccac gatgcgtccg gcgtagagga tcgagatcga tctcgatccc 4980

gcgaaattaa tacgactcac tataggggaa ttgtgagcgg ataacaattc ccctctagaa 5040

ataattttgt ttaactttaa gaaggagata tacatatgaa gaagcgcccg aagcctggag 5100

gatggaacac tgggggcagc cgatacccgg ggcagggcag ccctggaggc aaccgctacc 5160

cacctcaggg cggtggtggc tgggggcagc ctcatggtgg tggctggggg cagcctcatg 5220

gtggtggctg ggggcagccc catggtggtg gctggggaca gcctcatggt ggtggctggg 5280

gtcaaggagg tggcacccac agtcagtgga acaagccgag taagccaaaa accaacatga 5340

agcacatggc tggtgctgca gcagctgggg cagtggtggg gggccttggc ggctacatgc 5400

tgggaagtgc catgagcagg cccatcatac atttcggcag tgactatgag gaccgttact 5460

atcgtgaaaa catgcaccgt taccccaacc aagtgtacta caggcccatg gatgagtaca 5520

gcaaccagaa caactttgtg cacgactgcg tcaatatcac aatcaagcag cacacggtca 5580

ccacaaccac caagggggag aacttcaccg agaccgacgt taagatgatg gagcgcgtgg 5640

ttgagcagat gtgtatcacc cagtacgaga gggaatctca ggcctattac cagagaggat 5700

cgagctgaga attcgagctc cgtcgacaag cttgcggccg cactcgagca ccaccaccac 5760

caccactgag atccggctgc taacaaagcc cgaaaggaag ctgagttggc tgctgccacc 5820

gctgagcaat aactagcata accccttggg gcctctaaac gggtcttgag gggttttttg 5880

ctgaaaggag gaactatatc cggat 5905

<210> 4

<211> 27

<212> DNA

<213>Artificial sequence ()

<400> 4

ccttggcatc tacatgctgg gaagtgc 27

<210> 5

<211> 27

<212> DNA

<213>Artificial sequence ()

<400> 5

gcacttccca gcatgtagat gccaagg 27

Claims (6)

1. A kind of 1. people's PrPC G127I mutant, it is characterised in that its amino acid sequence such as SEQ ID NO：Shown in 1.
2. 2. people's PrPC G127I mutant according to claim 1, it is characterised in that encode described people's PrPC The gene of G127I mutant is following 1）Or 2）In any described DNA molecular：

   1）The SEQ ID NO of sequence table：DNA molecular shown in 2；

   2）With 1）The DNA sequence dna of restriction has more than 90% homology and coding SEQ ID NO：1 protein DNA point Son.
3. 3. a kind of recombinant expression carrier of people's PrPC G127I mutant genes containing described in claim 2, expression cassette, turn Gene cell system or recombinant bacterium.
4. 4. the preparation method of people's PrPC G127I mutant described in a kind of claim 1, it is characterised in that including following step Suddenly：

   1）Obtain the plasmid containing encoding human PrPC G127I mutant：Using pET30a-hPrP recombinant plasmids as template, wherein The nucleotide sequence of pET30a-hPrP recombinant plasmids such as SEQ ID NO：Shown in 3, design primer is：

   Forward primer：5’CCTTGGCATCTACATGCTGGGAAGTGC3’ (SEQ ID NO：4)；

   Reverse primer：5’GCACTTCCCAGCATGTAGATGCCAAGG3’ (SEQ ID NO：5)；

   Rite-directed mutagenesis is carried out to the amino acids of PrPC the 127th by PCR, obtains the G127I mutant genes of PrPC containing someone Recombinant plasmid pET30a-hPrP（G127I）；

   2）Expression and purification people's PrPC G127I mutant：Recombinant plasmid pET30a-hPrP（G127I）It is transformed into E.coli BL21 （DE3）, pET30a-hPrP will be contained（G127I）The BL21 bacterial strains of plasmid activate in LB culture mediums, are cultivated by expanding, IPTG induced expressions obtain the inclusion body of mutant protein；Under Denaturing, with Ni-Sepharose post preliminary purifications, renaturation Afterwards, the mutant protein further correctly folded with C4 reverse chromatograms posts by HPLC.
5. 5. a kind of prion inhibitor, it is characterised in that its active component contains people's PrPC G127I described in claim 1 Mutant.
6. 6. people's PrPC G127I mutant described in claim 1 is treating the medicine of the nerve degenerative diseases such as creutzfeldt-Jacob disease Application in exploitation.