CN107739404B - Protective prion protein G127I mutant and construction method thereof - Google Patents

Abstract

The invention discloses a protective human prion protein G127I mutant and a construction method thereof. The invention takes recombinant wild type human prion protein as a template, and mutates amino acid at 127 bit of the prion protein from Gly to Ile by a point mutation method. After expression and purification, the mutant has obviously weaker in-vitro fibrosis capability than wild prion protein through detection, and the fiber growth lag phase of the mutant is more than 5 times that of the wild prion protein. Therefore, the human prion protein mutant obtained by the invention has wide application prospect in treatment of diseases caused by prion protein, such as CJD and the like, and drug development.

Description

Protective prion protein G127I mutant and construction method thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a protective human prion protein mutant G127I and a construction method thereof.

Background

Prion protein (prion) is a protein pathogenic agent that has the ability to spread across species in mammals and can cause fatal neurodegenerative diseases such as Creutzfeldt-Jakob disease (CJD) in humans. It was found that prion protein consists of its normal cell type PrP^CConversion to pathologic PrP^ScAnd the accumulation of amyloid fibers in the brain leads to the occurrence of such diseases. Prion protein PrP^CTo PrP^ScThe process of transformation isThe key step in the development of CJD and other diseases is the current two models of this important process: first, the template-assisted model considers PrP^CTo PrP^ScSpontaneous conformational transition is hindered by higher kinetic energy, PrP^ScMonomers and PrP^CThe binding of monomers to form heterodimers promotes PrP^CTo PrP^ScA transition of (a); second, the polymeric nucleation model suggests PrP^CWith PrP^ScThere is a reversible dynamic equilibrium between, PrP^ScThe addition of seeds promotes PrP^CTo PrP^ScOf a simultaneous formation of PrP^ScBinding to the seed into a more stable structure further facilitates this conformational transition process. In the conformational transition of PrP, the most critical step is PrP^CWith PrP^ScA heterodimer is formed.

Many mutants of prion protein can cause CJD diseases, etc., wherein the 129 th amino acid of prion protein has polymorphism and can code Met or Val, but the CJD infected patients are Met₁₂₉Homozygotes, it was thought that the 129 MV heterozygote inhibited PrP heterodimer binding and thus inhibition of PrP^ScIs performed. Recently, researchers have found another protective mutant, after glycine Gly at position 127 is mutated into valine Val, experimental mice can resist infection of various plant-type prions, and unlike the 129 polymorphism, the prion G127V mutant not only can inhibit conformation transformation of PrP, but also can inhibit proliferation and transmission of wild-type prions. The research on the structural basis that the prion protein G127V mutant inhibits prion proliferation is helpful for revealing the mechanism of prion proliferation, has guiding significance on the development and treatment of related medicines, and has great application potential. Therefore, it is necessary to further study the mutation of the 127 th amino acid of prion protein.

Disclosure of Invention

The invention aims to provide a human prion protein G127I mutant which has long lag phase of in vitro fibrosis, is difficult to aggregate in cells and has weak proteinase K resistance, can inhibit the conformational transition of prion protein, can inhibit the misfolding and aggregation of prion protein and is expected to resist prion infection.

The invention also aims to provide a preparation method of the human prion protein G127I mutant.

The invention also aims to provide application of the human prion protein G127I mutant in drug development for treating neurodegenerative diseases such as Creutzfeldt-Jakob disease.

The invention realizes the aim through the following technical scheme:

in a first aspect, the amino acid sequence of the human prion protein G127I mutant provided by the invention is shown in SEQ ID NO: 1 is shown.

In the second aspect, the gene encoding the human prion protein G127I mutant also belongs to the protection scope of the invention.

The gene can be the DNA molecule described in any one of the following 1) or 2):

1) SEQ ID NO: 2;

2) has more than 90% homology with the DNA sequence limited by 1) and codes SEQ ID NO: 1 of said protein.

In a third aspect, the invention provides a recombinant expression vector, an expression cassette, a transgenic cell line or a recombinant bacterium containing the human prion protein G127I mutant gene.

In a fourth aspect, the invention provides a method for preparing a human prion protein G127I mutant, which comprises the following steps:

1) obtaining a plasmid containing a mutant encoding human prion protein G127I: the pET30a-hPrP recombinant plasmid is taken as a template, wherein the nucleotide sequence of the pET30a-hPrP recombinant plasmid is shown as SEQ ID NO: 3, designing a primer as follows:

a forward primer: 5 'CCTTGGCATCTACATGCTGGGAAGTGC 3' (SEQ ID NO: 4);

reverse primer: 5 'GCACTTCCCAGCATGTAGATGCCAAGG 3' (SEQ ID NO: 5);

carrying out site-directed mutagenesis on 127 th amino acid of prion protein by PCR to obtain a recombinant plasmid pET30a-hPrP-G127I containing human prion protein G127I mutant gene;

2) expression of purified human prion protein G127I mutant: transforming the recombinant plasmid pET30a-hPrPG127I into E.coli BL21 DE3 (from the type culture Collection of Wuhan university), activating BL21 strain containing pET30a-hPrP-G127I plasmid in LB culture medium, expanding culture, and IPTG inducing expression to obtain inclusion body of mutant protein; under denaturing conditions, primary purification was performed with a Ni-Sepharose column, after renaturation, the correctly folded mutant protein was further obtained by HPLC with a C4 reverse phase column.

In a fifth aspect, the human prion protein G127I mutant can be applied to research and development of drugs for treating neurodegenerative diseases such as Creutzfeldt-Jakob disease.

In a sixth aspect, the present invention provides a prion inhibitor, the active ingredient of which comprises the human prion protein G127I mutant of the present invention.

In one embodiment of the invention, the results of the in vitro fibrosis lag phase of the prion protein and mutants thereof calculated from the fluorescence intensity after thioflavin t (tht) staining indicate that the lag phase of the human prion protein G127I and G127V mutants is 5.3 times and 3.2 times that of the wild type, respectively, and the fibrosis of the other mutants is not greatly influenced by the 127 th amino acid size (tryptophan G127W and alanine G127A) or different acid bases (lysine G127K and glutamic acid G127E). Depending on the time taken for the prion monomer band dissolved in the detergent Sarkosyl to disappear, G127I was even more difficult to aggregate than G127V.

In another embodiment of the invention, prion mutants are overexpressed in RK13 cells, and the content of Sarkosyl-insoluble prion mutant fibers in the pellet after ultracentrifugation of the cell lysate is examined, which shows that, given a consistent total amount of prion expressed in the cells, G127V and G127I form less Sarkosyl-insoluble aggregates than the wild type, and G127I forms less fibers than G127V.

The cellular lysates were tested for protease K resistance of the prion mutants, and the results indicated that G127V and G127I were more easily degraded by PK enzyme than the wild-type prion.

The human prion protein G127I mutant obtained by the invention is not reported before, and a plurality of recombinant human prion protein 127-position amino acid mutants such as G127A, G127E, G127K, G127W and G127I are constructed, wherein only G127I and G127V have similar properties, and the in-vitro fibrosis delay periods are respectively 5.3 times and 3.2 times of that of a wild type; similarly, G127I and G127V that were overexpressed in cells were more difficult to aggregate and less PK resistant than the wild type. Our results show that G127I inhibits prion aggregation even better than G127V, and the study of this mutant is helpful for drug development and gene therapy of CJD disease.

Drawings

FIG. 1 shows the sequencing results of recombinant wild-type prion protein and G127I mutant.

FIG. 2 shows elution peaks of recombinant wild-type prion protein and G127I mutant on a C4 reversed phase chromatographic column with acetonitrile/water gradient.

FIG. 3 is SDS-PAGE expression analysis of recombinant wild type prion protein and G127I mutant,

the molecular weight of the target band is 23 kDa.

FIG. 4 shows the in vitro fiber growth kinetics of wild-type prion protein and 127 th mutant,

a is the fluorescence intensity of the dyed thioflavin T (ThT) and is fitted by an S-shaped curve equation, b-h is the condition that the Sarkosyl experiment verifies that wild type prion protein and 127 th mutant are aggregated in vitro, and i is the result of the in vitro fibrosis lag phase of the prion protein and the mutant thereof calculated by the fluorescence intensity of the dyed thioflavin T (ThT).

FIG. 5 shows the aggregation of intracellular prion protein and mutants thereof,

a is the prion protein precipitate band (top) and the total prion protein band (bottom) on SDS-PAGE, insoluble in the detergent Sarkosyl, and b is the relative prion protein fiber content (top/bottom) obtained by grey scale analysis of the results in a.

FIG. 6 shows PK resistance of cellular expressed prions and mutants.

Detailed Description

The features and advantages of the present invention will be further understood from the following detailed description taken in conjunction with the accompanying drawings. The examples provided are merely illustrative of the method of the present invention and do not limit the remainder of the disclosure in any way. Example 1 construction of recombinant human prion mutant G127I

The wild recombinant human prion protein plasmid pET30a-hPrP is used as a template, the plasmid is constructed in the early stage of the laboratory, the genbank number corresponding to the hPrP is AB300823.1, and the DNA sequence of the pET30a-hPrP vector is shown as SEQ ID NO: 3, design Ile₁₂₇The primer and the primer sequence are as follows:

a forward primer: 5 'CCTTGGCATCTACATGCTGGGAAGTGC 3' (SEQ ID NO: 4)

Reverse primer: 5 'GCACTTCCCAGCATGTAGATGCCAAGG 3' (SEQ ID NO: 5)

Site-directed mutagenesis was performed by PCR, the PCR amplification system was:

3. mu.l of DNA template;

5 μ l Buffer 10 × PCR Buffer for KOD-Plus-;

5μl 2mM dNTPs；

2μl 25mM MgSO₄；

1 μ l forward primer;

1 μ l reverse primer;

1 μ l enzyme KOD-Plus-;

ddH₂the amount of O was adjusted to 50. mu.l.

The PCR reaction program is:

S1:94℃,5min；

S2:98℃,10s；

S3:59℃,30s；

S4:68℃,1min/kb；

repeat S2 to S428 times.

The PCR product was digested with DpnI enzyme in the following reaction system: mu.l of 10 XTango buffer, 1.5. mu.l of DpnI enzyme, and 20. mu.l of PCR product were made up, mixed well, and incubated at 37 ℃ for 1 hour. Mu.l of the digest was added to 50. mu.l of DH 5. alpha. competence, mixed well and ice-cooled for 30 min. The mixture was heated in a 42 ℃ water bath for 90s, immediately ice-cooled for 3min, then added to LB medium to 1ml and incubated in a shaker at 37 ℃ and 220rpm for 1 h. The transformation products were plated on LB medium plates containing 100mg/L kanamycin and incubated overnight at 37 ℃. The monoclonal colonies were picked from the plate and cultured in LB medium at 37 ℃ for 8h on a shaker at 220rpm, each colony was divided into two portions, one portion was used for sequencing, the other portion was added to 20% final concentration glycerol and stored at-80 ℃. As a result of sequencing by alignment, the correctly mutated strain was plasmid extracted and transformed into e.coli BL21 DE3 (from the university of wuhan type culture collection).

[ example 2 ] expression purification of prion mutant G127I

a. BL21 strain containing pET30a-hPrP-G127I plasmid was inoculated into 10ml LB medium tube containing kanamycin to activate, and cultured at 37 ℃ and 220rpm for 8-10 h.

b. 1ml of the activated bacterial suspension is transferred to 250ml of LB medium containing kanamycin, for example, and is subjected to amplification culture at 37 ℃ and 220rpm for 3-4h (OD. apprxeq.0.5), expression is induced by adding 1mM IPTG to the final concentration, and the induction is carried out overnight at 37 ℃ and 220rpm in a shaker.

c. The cells were centrifuged at 17000g for 2min at 4 ℃ to collect the cells and the supernatant was discarded. After freezing and thawing the pellet once at-80 ℃, it was resuspended in lysis buffer (20mM Tris,150mM NaCl,2mM EDTA, 0.1% Triton X-100,2mM PMSF, pH 7.4). The ultrasonic bacteria splitting at 200W is carried out for 30min, and the ultrasonic time interval is 3 s. Centrifuge at 17000g for 30min at 4 ℃ and discard the supernatant.

d. Inclusion bodies were washed with the following buffers respectively: 20mM Tris,20mM NaCl, 0.5% (v/v) Triton X-100, pH 7.4; 20mM Tris,2M NaCl, pH 7.4; 20mM Tris,150mM NaCl,2M Urea, pH7.4, 17000g centrifugation at 4 ℃ for 15min, supernatant discarded, inclusion body pellet resuspended in phosphate buffer (8M Urea,100mM Na)₂HPO₄10mM Tris,1mM β -mercaptoethanol, pH 8.0), at 4 ℃ overnight.

e. Centrifuging at 17000g at 4 ℃ for 1h, collecting the supernatant, and filtering with a 0.45 mu m filter membrane. The recombinant human prion protein mutant G127I which is primarily purified can be obtained by using a Ni-Sepharose column for purification, and carrying out the steps of balancing, loading, eluting and the like. The eluent is the phosphate buffer solution and the pH value is adjusted to be below 4.5.

f. The protein concentration purified on Ni-Sepharose column was calculated from molar extinction coefficient of prion mutant G127I and diluted to 0.1-0.3mg/ml with renaturation buffer (0.1M Tris,6M Urea, pH7.5), filled into clean dialysis bags and dialysed for renaturation at room temperature for at least 12 h.

g. The mutant protein with good renaturation is further purified and separated into correctly folded recombinant prion protein by HPLC through a C4 reverse chromatographic column. As shown in fig. 2 and 3. Dialyzing the purified protein into deionized water, concentrating the protein to about 2mg/ml, subpackaging and storing at-80 ℃.

Example 3 detection of aggregation Capacity of prion protein and mutants thereof

a. Similar to G127I, other prion protein mutants to be detected, such as G127W, G127A, G127K and G127E, are constructed on pET30a-hPrP plasmid by means of point mutation, and are expressed and purified according to the same method as the purified G127I. The purified mutants were dialyzed into 2M guanidine hydrochloride-containing phosphate buffer (2M GdnHCl,0.1M PBS, pH 7.0) to a final concentration of 10. mu.M, and placed in a shaker at 37 ℃ with continuous shaking at 220 rpm. According to the time sampling, 20 μ l of the sample is diluted ten-fold to phosphate buffer (pH 7.0), thioflavin T (ThT) is added to the sample to a final concentration of 125 μ M, and 200 μ l of the final volume is added to a 96-well microplate to measure the fluorescence emitted at 480nm upon 450nm excitation. The resulting ThT fluorescence values were fitted with a sigmoidal equation (Cohlberg JA, et al, Heparin and other glyco-polysaccharides simulation the formation of amyloid from-synthesis in vitro biochemistry 41: 1502. 1511.) where F ═ F-₀+(A+ct)/{1+exp[k(t_m-t)]Where F is the fluorescence value at time t, F₀Is the baseline fluorescence value during the lag phase, A + ct is the fluorescence value during the final fiber plateau phase, k represents the fiber growth rate, t_mIs the time at which the fluorescence value reaches half of the maximum value. The calculation method of the in vitro fibrosis lag phase of prion protein and mutant thereof is t_mAnother 10 μ l sample was incubated with sarcosyl (Sarkosyl) at a final concentration of 2% for at least 30min at room temperature and the mixture was directly loaded on 12.5% SDS-PAGE with coomassie blue staining using loading buffer without β -mercaptoethanol.

The results of the in vitro fibrosis lag phase of the prion protein and the mutant thereof calculated by the fluorescence intensity after thioflavin T (ThT) staining indicate that the lag phase of the human prion protein G127I and the G127V mutant is 5.3 times and 3.2 times of that of the wild type, respectively, and the fibrosis of other mutants is not greatly influenced by the size of the 127 th amino acid (tryptophan G127W and alanine G127A) or different acid bases (lysine G127K and glutamic acid G127E), as shown in FIGS. 4a and 4 i. Depending on the time taken for the prion monomer band to disappear when dissolved in the detergent Sarkosyl, as shown in FIGS. 4b-h, G127I was even more difficult to aggregate than G127V.

b. Intracellular detection of the aggregation capacity of prion protein and mutants thereof: because the pET30a vector is a prokaryotic expression vector, the prion gene is required to be cloned to a cell expression vector pcDNA3.1, and pcDNA3.1-hPrP plasmid is constructed in the early stage of the laboratory. The G127I mutant is constructed by the point mutation method according to the molecular biology method and using pcDNA3.1-hPrP plasmid as a template, and the construction method is as follows:

a forward primer: 5 'CCTTGGCATCTACATGCTGGGAAGTGC 3'

Reverse primer: 5 'GCACTTCCCAGCATGTAGATGCCAAGG 3'

Site-directed mutagenesis was performed by PCR, the PCR amplification system was:

3. mu.l of DNA template;

5 μ l Buffer 10 × PCR Buffer for KOD-Plus-;

5μl 2mM dNTPs；

2μl 25mM MgSO₄；

1 μ l forward primer;

1 μ l reverse primer;

1 μ l enzyme KOD-Plus-;

ddH₂the amount of O was adjusted to 50. mu.l.

The PCR reaction program is:

S1:94℃,5min；

S2:98℃,10s；

S3:59℃,30s；

S4:68℃,1min/kb；

repeat S2 to S428 times.

The PCR product was digested with DpnI enzyme in the following reaction system: mu.l of 10 XTango buffer, 1.5. mu.l of DpnI enzyme, and 20. mu.l of PCR product were made up, mixed well, and incubated at 37 ℃ for 1 hour. Mu.l of the digest was added to 50. mu.l of DH 5. alpha. competence, mixed well and ice-cooled for 30 min. The mixture was heated in a 42 ℃ water bath for 90s, immediately ice-cooled for 3min, then added to LB medium to 1ml and incubated in a shaker at 37 ℃ and 220rpm for 1 h. The transformant was plated on LB medium plate of 100mg/L ampicillin and cultured overnight at 37 ℃. The monoclonal colonies were picked from the plate and cultured in LB medium at 37 ℃ for 8h on a shaker at 220rpm, each colony was divided into two portions, one portion was used for sequencing, the other portion was added to 20% final concentration glycerol and stored at-80 ℃. Comparing the sequencing result, and extracting the plasmid from the correctly mutated strain.

To be provided with

2000(Invitrogen, Carlsbad, Calif.) pcDNA3.1-hPrP and mutant plasmids were transiently transferred into rabbit renal epithelial cells (RK 13). 48h after transfection, collecting and cracking cells, centrifuging at 4 ℃ and 10000g for 10min to remove cell fragments, dividing the cell lysate into two parts, adding Sarkosyl with the final concentration of 1% into one part, incubating at room temperature for 30min, ultracentrifuging the mixture at 4 ℃ and 150000g for 30min, washing the precipitate with PBS for one time to obtain precipitate insoluble in detergent Sarkosyl, adding SDS-PAGE sample buffer, boiling, and preparing for sample loading; another portion of the cell lysate is added to a loading buffer to detect total protein in the cell lysate. After the sample is prepared, 12.5% SDS-PAGE is loaded, and the prion protein content in total protein and sediment is detected by a Western blot method, wherein an antibody is a murine prion protein monoclonal antibody 3F 4. As shown in fig. 5, in the case of the total amount of prion protein expressed in cells being consistent, G127V and G127I formed less Sarkosyl-insoluble aggregation than the wild type, and G127I formed less fiber than G127V.

And detecting PK resistance of the prion protein expressed by the cells and the mutant thereof. The cell lysate was incubated with various concentrations of Proteinase K (PK) at 37 ℃ for 1h, the concentration of PK enzyme was 0,0.1,0.2, 0.5. mu.g/ml, and 1mM PMSF was added to terminate the reaction. Adding the enzymolysis product into a loading buffer solution, boiling for 10min, loading on 12.5% SDS-PAGE, and detecting the content of the PK resistant prion protein by a Western blot method, wherein the antibody is murine monoclonal antibody 3F 4. As shown in fig. 6, G127V and G127I were more easily degraded by PK enzymes than the wild-type prion.

Sequence listing

<110> Wuhan university

<120> protective human prion protein G127I mutant and construction method thereof

<160>5

<170>SIPOSequenceListing 1.0

<210>1

<211>209

<212>PRT

<213> prion protein (prion)

<400>1

Lys Lys Arg Pro Lys Pro Gly Gly Trp Asn Thr Gly Gly Ser Arg Tyr

1 5 10 15

Pro Gly Gln Gly Ser Pro Gly Gly Asn Arg Tyr Pro Pro Gln Gly Gly

20 25 30

Gly Gly Trp Gly Gln Pro His Gly Gly Gly Trp Gly Gln Pro His Gly

35 40 45

Gly Gly Trp Gly Gln Pro His Gly Gly Gly Trp Gly Gln Pro His Gly

50 55 60

Gly Gly Trp Gly Gln Gly Gly Gly Thr His Ser Gln Trp Asn Lys Pro

65 70 75 80

Ser Lys Pro Lys Thr Asn Met Lys His Met Ala Gly Ala Ala Ala Ala

85 90 95

Gly Ala Val Val Gly Gly Leu Gly Ile Tyr Met Leu Gly Ser Ala Met

100 105 110

Ser Arg Pro Ile Ile His Phe Gly Ser Asp Tyr Glu Asp Arg Tyr Tyr

115 120 125

Arg Glu Asn Met His Arg Tyr Pro Asn Gln Val Tyr Tyr Arg Pro Met

130 135 140

Asp Glu Tyr Ser Asn Gln Asn Asn Phe Val His Asp Cys Val Asn Ile

145 150 155 160

Thr Ile Lys Gln His Thr Val Thr Thr Thr Thr Lys Gly Glu Asn Phe

165 170 175

Thr Glu Thr Asp Val Lys Met Met Glu Arg Val Val Glu Gln Met Cys

180 185 190

Ile Thr Gln Tyr Glu Arg Glu Ser Gln Ala Tyr Tyr Gln Arg Gly Ser

195 200 205

Ser

<210>2

<211>633

<212>DNA

<213> prion protein (prion)

<400>2

atgaagaagc gcccgaagcc tggaggatgg aacactgggg gcagccgata cccggggcag 60

ggcagccctg gaggcaaccg ctacccacct cagggcggtg gtggctgggg gcagcctcat 120

ggtggtggct gggggcagcc tcatggtggt ggctgggggc agccccatgg tggtggctgg 180

ggacagcctc atggtggtgg ctggggtcaa ggaggtggca cccacagtca gtggaacaag 240

ccgagtaagc caaaaaccaa catgaagcac atggctggtg ctgcagcagc tggggcagtg 300

gtggggggcc ttggcatcta catgctggga agtgccatga gcaggcccat catacatttc 360

ggcagtgact atgaggaccg ttactatcgt gaaaacatgc accgttaccc caaccaagtg 420

tactacaggc ccatggatga gtacagcaac cagaacaact ttgtgcacga ctgcgtcaat 480

atcacaatca agcagcacac ggtcaccaca accaccaagg gggagaactt caccgagacc 540

gacgttaaga tgatggagcg cgtggttgag cagatgtgta tcacccagta cgagagggaa 600

tctcaggcct attaccagag aggatcgagc tga 633

<210>3

<211>5905

<212>DNA

<213> Artificial sequence ()

<400>3

tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg 60

cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc 120

ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg 180

gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc 240

acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt 300

ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc 360

ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta 420

acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt 480

tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta 540

tccgctcatg aattaattct tagaaaaact catcgagcat caaatgaaac tgcaatttat 600

tcatatcagg attatcaata ccatattttt gaaaaagccg tttctgtaat gaaggagaaa 660

actcaccgag gcagttccat aggatggcaa gatcctggta tcggtctgcg attccgactc 720

gtccaacatc aatacaacct attaatttcc cctcgtcaaa aataaggtta tcaagtgaga 780

aatcaccatg agtgacgact gaatccggtg agaatggcaa aagtttatgc atttctttcc 840

agacttgttc aacaggccag ccattacgct cgtcatcaaa atcactcgca tcaaccaaac 900

cgttattcat tcgtgattgc gcctgagcga gacgaaatac gcgatcgctg ttaaaaggac 960

aattacaaac aggaatcgaa tgcaaccggc gcaggaacac tgccagcgca tcaacaatat 1020

tttcacctga atcaggatat tcttctaata cctggaatgc tgttttcccg gggatcgcag 1080

tggtgagtaa ccatgcatca tcaggagtac ggataaaatg cttgatggtc ggaagaggca 1140

taaattccgt cagccagttt agtctgacca tctcatctgt aacatcattg gcaacgctac 1200

ctttgccatg tttcagaaac aactctggcg catcgggctt cccatacaat cgatagattg 1260

tcgcacctga ttgcccgaca ttatcgcgag cccatttata cccatataaa tcagcatcca 1320

tgttggaatt taatcgcggc ctagagcaag acgtttcccg ttgaatatgg ctcataacac 1380

cccttgtatt actgtttatg taagcagaca gttttattgt tcatgaccaa aatcccttaa 1440

cgtgagtttt cgttccactg agcgtcagac cccgtagaaa agatcaaagg atcttcttga 1500

gatccttttt ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg 1560

gtggtttgtt tgccggatca agagctacca actctttttc cgaaggtaac tggcttcagc 1620

agagcgcaga taccaaatac tgtccttcta gtgtagccgt agttaggcca ccacttcaag 1680

aactctgtag caccgcctac atacctcgct ctgctaatcc tgttaccagt ggctgctgcc 1740

agtggcgata agtcgtgtct taccgggttg gactcaagac gatagttacc ggataaggcg 1800

cagcggtcgg gctgaacggg gggttcgtgc acacagccca gcttggagcg aacgacctac 1860

accgaactga gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc cgaagggaga 1920

aaggcggaca ggtatccggt aagcggcagg gtcggaacag gagagcgcac gagggagctt 1980

ccagggggaa acgcctggta tctttatagt cctgtcgggt ttcgccacct ctgacttgag 2040

cgtcgatttt tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc cagcaacgcg 2100

gcctttttac ggttcctggc cttttgctgg ccttttgctc acatgttctt tcctgcgtta 2160

tcccctgatt ctgtggataa ccgtattacc gcctttgagt gagctgatac cgctcgccgc 2220

agccgaacga ccgagcgcag cgagtcagtg agcgaggaag cggaagagcg cctgatgcgg 2280

tattttctcc ttacgcatct gtgcggtatt tcacaccgca tatatggtgc actctcagta 2340

caatctgctc tgatgccgca tagttaagcc agtatacact ccgctatcgc tacgtgactg 2400

ggtcatggct gcgccccgac acccgccaac acccgctgac gcgccctgac gggcttgtct 2460

gctcccggca tccgcttaca gacaagctgt gaccgtctcc gggagctgca tgtgtcagag 2520

gttttcaccg tcatcaccga aacgcgcgag gcagctgcgg taaagctcat cagcgtggtc 2580

gtgaagcgat tcacagatgt ctgcctgttc atccgcgtcc agctcgttga gtttctccag 2640

aagcgttaat gtctggcttc tgataaagcg ggccatgtta agggcggttt tttcctgttt 2700

ggtcactgat gcctccgtgt aagggggatt tctgttcatg ggggtaatga taccgatgaa 2760

acgagagagg atgctcacga tacgggttac tgatgatgaa catgcccggt tactggaacg 2820

ttgtgagggt aaacaactgg cggtatggat gcggcgggac cagagaaaaa tcactcaggg 2880

tcaatgccag cgcttcgtta atacagatgt aggtgttcca cagggtagcc agcagcatcc 2940

tgcgatgcag atccggaaca taatggtgca gggcgctgac ttccgcgttt ccagacttta 3000

cgaaacacgg aaaccgaaga ccattcatgt tgttgctcag gtcgcagacg ttttgcagca 3060

gcagtcgctt cacgttcgct cgcgtatcgg tgattcattc tgctaaccag taaggcaacc 3120

ccgccagcct agccgggtcc tcaacgacag gagcacgatc atgcgcaccc gtggggccgc 3180

catgccggcg ataatggcct gcttctcgcc gaaacgtttg gtggcgggac cagtgacgaa 3240

ggcttgagcg agggcgtgca agattccgaa taccgcaagc gacaggccga tcatcgtcgc 3300

gctccagcga aagcggtcct cgccgaaaat gacccagagc gctgccggca cctgtcctac 3360

gagttgcatg ataaagaaga cagtcataag tgcggcgacg atagtcatgc cccgcgccca 3420

ccggaaggag ctgactgggt tgaaggctct caagggcatc ggtcgagatc ccggtgccta 3480

atgagtgagc taacttacat taattgcgtt gcgctcactg cccgctttcc agtcgggaaa 3540

cctgtcgtgc cagctgcatt aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat 3600

tgggcgccag ggtggttttt cttttcacca gtgagacggg caacagctga ttgcccttca 3660

ccgcctggcc ctgagagagt tgcagcaagc ggtccacgct ggtttgcccc agcaggcgaa 3720

aatcctgttt gatggtggtt aacggcggga tataacatga gctgtcttcg gtatcgtcgt 3780

atcccactac cgagatgtcc gcaccaacgc gcagcccgga ctcggtaatg gcgcgcattg 3840

cgcccagcgc catctgatcg ttggcaacca gcatcgcagt gggaacgatg ccctcattca 3900

gcatttgcat ggtttgttga aaaccggaca tggcactcca gtcgccttcc cgttccgcta 3960

tcggctgaat ttgattgcga gtgagatatt tatgccagcc agccagacgc agacgcgccg 4020

agacagaact taatgggccc gctaacagcg cgatttgctg gtgacccaat gcgaccagat 4080

gctccacgcc cagtcgcgta ccgtcttcat gggagaaaat aatactgttg atgggtgtct 4140

ggtcagagac atcaagaaat aacgccggaa cattagtgca ggcagcttcc acagcaatgg 4200

catcctggtc atccagcgga tagttaatga tcagcccact gacgcgttgc gcgagaagat 4260

tgtgcaccgc cgctttacag gcttcgacgc cgcttcgttc taccatcgac accaccacgc 4320

tggcacccag ttgatcggcg cgagatttaa tcgccgcgac aatttgcgac ggcgcgtgca 4380

gggccagact ggaggtggca acgccaatca gcaacgactg tttgcccgcc agttgttgtg 4440

ccacgcggtt gggaatgtaa ttcagctccg ccatcgccgc ttccactttt tcccgcgttt 4500

tcgcagaaac gtggctggcc tggttcacca cgcgggaaac ggtctgataa gagacaccgg 4560

catactctgc gacatcgtat aacgttactg gtttcacatt caccaccctg aattgactct 4620

cttccgggcg ctatcatgcc ataccgcgaa aggttttgcg ccattcgatg gtgtccggga 4680

tctcgacgct ctcccttatg cgactcctgc attaggaagc agcccagtag taggttgagg 4740

ccgttgagca ccgccgccgc aaggaatggt gcatgcaagg agatggcgcc caacagtccc 4800

ccggccacgg ggcctgccac catacccacg ccgaaacaag cgctcatgag cccgaagtgg 4860

cgagcccgat cttccccatc ggtgatgtcg gcgatatagg cgccagcaac cgcacctgtg 4920

gcgccggtga tgccggccac gatgcgtccg gcgtagagga tcgagatcga tctcgatccc 4980

gcgaaattaa tacgactcac tataggggaa ttgtgagcgg ataacaattc ccctctagaa5040

ataattttgt ttaactttaa gaaggagata tacatatgaa gaagcgcccg aagcctggag 5100

gatggaacac tgggggcagc cgatacccgg ggcagggcag ccctggaggc aaccgctacc 5160

cacctcaggg cggtggtggc tgggggcagc ctcatggtgg tggctggggg cagcctcatg 5220

gtggtggctg ggggcagccc catggtggtg gctggggaca gcctcatggt ggtggctggg 5280

gtcaaggagg tggcacccac agtcagtgga acaagccgag taagccaaaa accaacatga 5340

agcacatggc tggtgctgca gcagctgggg cagtggtggg gggccttggc ggctacatgc 5400

tgggaagtgc catgagcagg cccatcatac atttcggcag tgactatgag gaccgttact 5460

atcgtgaaaa catgcaccgt taccccaacc aagtgtacta caggcccatg gatgagtaca 5520

gcaaccagaa caactttgtg cacgactgcg tcaatatcac aatcaagcag cacacggtca 5580

ccacaaccac caagggggag aacttcaccg agaccgacgt taagatgatg gagcgcgtgg 5640

ttgagcagat gtgtatcacc cagtacgaga gggaatctca ggcctattac cagagaggat 5700

cgagctgaga attcgagctc cgtcgacaag cttgcggccg cactcgagca ccaccaccac 5760

caccactgag atccggctgc taacaaagcc cgaaaggaag ctgagttggc tgctgccacc 5820

gctgagcaat aactagcata accccttggg gcctctaaac gggtcttgag gggttttttg 5880

ctgaaaggag gaactatatc cggat 5905

<210>4

<211>27

<212>DNA

<213> Artificial sequence ()

<400>4

ccttggcatc tacatgctgg gaagtgc 27

<210>5

<211>27

<212>DNA

<213> Artificial sequence ()

<400>5

gcacttccca gcatgtagat gccaagg 27

Claims (1)

1. The preparation method of the human prion protein G127I mutant is characterized in that the amino acid sequence of the human prion protein G127I mutant is shown as SEQ ID NO: 1, comprising the following steps:

1) obtaining a plasmid containing a mutant encoding human prion protein G127I: the pET30a-hPrP recombinant plasmid is taken as a template, wherein the nucleotide sequence of the pET30a-hPrP recombinant plasmid is shown as SEQ ID NO: 3, designing a primer as follows:

a forward primer: 5 'CCTTGGCATCTACATGCTGGGAAGTGC 3' (SEQ ID NO: 4);

reverse primer: 5 'GCACTTCCCAGCATGTAGATGCCAAGG 3' (SEQ ID NO: 5);

site-directed mutagenesis was performed by PCR, the PCR amplification system was:

3. mu.l of DNA template;

5 μ l Buffer 10 × PCR Buffer for KOD-Plus-;

5μl 2mM dNTPs；

2μl 25mM MgSO₄；

1 μ l forward primer;

1 μ l reverse primer;

1 μ l enzyme KOD-Plus-;

ddH₂supplementing O to 50 μ l;

the PCR reaction program is:

S1:94℃,5min；

S2:98℃,10s；

S3:59℃,30s；

S4:68℃,1min/kb；

repeating S2 to S428 times;

the PCR product was digested with DpnI enzyme in the following reaction system: mu.l of 10 XTango buffer, 1.5. mu.l of DpnI enzyme, and the PCR product is supplemented to 20. mu.l, mixed evenly and incubated for 1h at 37 ℃; adding 5 μ l of the digested product into 50 μ l of DH5 α competence, mixing, and ice-cooling for 30 min; heating in 42 deg.C water bath for 90s, immediately ice-cooling for 3min, adding LB culture medium to 1ml, and culturing in 37 deg.C shaking table at 220rpm for 1 h; the transformation products were spread on LB medium plates with 100mg/L kanamycin and incubated overnight at 37 ℃; selecting monoclonal colonies from the plate, culturing in LB medium at 37 deg.C in a shaking table at 220rpm for 8h, dividing each colony into two parts, one part for sequencing, and the other part added with 20% final concentration glycerol and stored at-80 deg.C; comparing the sequencing result, extracting plasmid from the correctly mutated strain and transforming into E.coli BL21 DE 3;

the 127 th amino acid of the prion protein is subjected to site-directed mutagenesis by PCR, and the nucleotide sequence of the human prion protein G127I mutant is coded as shown in SEQ ID NO: 2, obtaining a recombinant plasmid pET30a-hPrP-G127I containing human prion protein G127I mutant gene;

2) expression of purified human prion protein G127I mutant:

a. BL21 strain containing pET30a-hPrP-G127I plasmid is inoculated into 10ml LB culture medium test tube containing kanamycin for activation, and cultured for 8-10h at 37 ℃ and 220 rpm;

b. transferring 1ml of activated bacterial liquid into 250ml of LB culture medium containing kanamycin, carrying out amplification culture at 37 ℃ and 220rpm for 3-4h, wherein OD of the bacterial liquid is approximately equal to 0.5, adding 1mM IPTG (isopropyl thiogalactoside G) with final concentration for induction expression, and inducing overnight at 37 ℃ and 220rpm in a shaking table;

c. centrifuging at 17000g at 4 ℃ for 2min to collect thalli, removing supernatant, freezing and thawing the precipitate at-80 ℃ once, and then suspending in a bacteria cracking buffer solution, wherein the bacteria cracking buffer solution comprises: 20mM Tris,150mM NaCl,2mM EDTA, 0.1% Triton X-100,2mM PMSF, pH 7.4; performing ultrasonic bacteria splitting at 200W for 30min, and performing ultrasonic treatment at intervals of 3 s; centrifuging at 17000g at 4 ℃ for 30min, and removing the supernatant;

d. the inclusion bodies were washed with ① 20mM Tris,20mM NaCl, 0.5% Triton X-100, pH7.4, ② 20mM Tris,2M NaCl, pH7.4, ③ 20mM Tris,150mM NaCl,2M Urea, pH7.4, and 17000g centrifugation at 4 ℃ for 15min to discard the supernatant, and the inclusion body pellet was resuspended in phosphate buffer containing 8M Urea,100mM Na, respectively₂HPO₄10mM Tris,1mM β -mercaptoethanol, pH 8.0, 4 ℃ overnight;

e. centrifuging at 17000g at 4 ℃ for 1h, collecting supernatant, and filtering with a 0.45-micron filter membrane; purifying by using a Ni-Sepharose column, and carrying out the steps of balancing, loading, eluting and the like to obtain a primarily purified recombinant human prion mutant G127I, wherein the pH of an eluent is adjusted to be below 4.5 by using a phosphate buffer solution in the step d);

f. calculating the protein concentration purified by a Ni-Sepharose column according to the molar extinction coefficient of the prion protein mutant G127I, diluting the protein concentration to 0.1-0.3mg/ml by using a renaturation buffer solution which is 0.1M Tris,6M Urea and has the pH value of 7.5, filling the protein concentration into a clean dialysis bag, and dialyzing the protein concentration for renaturation for at least 12 hours at room temperature;

g. the mutant protein with good renaturation is further purified and separated into correctly folded recombinant prion protein by HPLC through a C4 reverse chromatographic column.

Images