CN109576376A - Genetic marker relevant to tibetan sheep high altitude hypoxia adaptation and its application - Google Patents
Genetic marker relevant to tibetan sheep high altitude hypoxia adaptation and its application Download PDFInfo
- Publication number
- CN109576376A CN109576376A CN201811382697.8A CN201811382697A CN109576376A CN 109576376 A CN109576376 A CN 109576376A CN 201811382697 A CN201811382697 A CN 201811382697A CN 109576376 A CN109576376 A CN 109576376A
- Authority
- CN
- China
- Prior art keywords
- place
- tibetan sheep
- high altitude
- genotype
- sheep
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P60/00—Technologies relating to agriculture, livestock or agroalimentary industries
- Y02P60/80—Food processing, e.g. use of renewable energies or variable speed drives in handling, conveying or stacking
- Y02P60/87—Re-use of by-products of food processing for fodder production
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides genetic marker relevant to tibetan sheep high altitude hypoxia adaptation, it is characterised in that: it is located on HMOX1 gene, and there are four preponderant genotypes AA, BB, AB and AC；When the genotype of tibetan sheep is AA, BB and AC, tibetan sheep high altitude hypoxia adaptation is good；When the genotype of tibetan sheep is AB, tibetan sheep high altitude hypoxia adaptation is poor.The present invention also provides its applications in the good tibetan sheep of breeding high altitude hypoxia adaptation.Genetic marker disclosed by the invention can be used in identifying the height of tibetan sheep high altitude hypoxia adaptation, additionally it is possible to be used for the good tibetan sheep of breeding high altitude hypoxia adaptation.
Description
Technical field
The invention belongs to technical field of molecular biology, and in particular to heredity relevant to tibetan sheep high altitude hypoxia adaptation
Label and its application.
Background technique
Heme oxygenase (Hem oxygenase, HMOX) is the key that rate-limiting enzyme in heme catabolism, by by blood
Red pigment oxidation generates biliverdin, and the metabolic pathway of bilirubin is then translated by biliverdin reductase by blood extra in vivo
Red pigment metabolism is fallen.The metabolite generated by catalysis hemachrome degradation is in anti-oxidant, anti-inflammatory, defense cell apoptosis, transmitting
Neuronal messages and adjust vascular tone etc. play a significant role (Shibahara et al., 1999；McCoubrey
et al.,1997；Sun et al.,2003；Li Yanli etc., 2017).There are 3 kinds of isomerase forms for Heme oxygenase: stress
HMOX3 that the HMOX1 of induction type, the HMOX2 of composing type and function are still not clear (Sun et al., 2003).When cell and group
When knitting in stress situation, HMOX1 can be used as protective protein and be induced, to defend to be damaged by cytokine mediated cell in vivo
Wound (Ryter et al., 2006；Lin et al.,2007；Hachfi et al.,2012).Research is found in anoxia condition
Under, the expression of HMOX1 changes different (Li Yao etc., 2005) in different genera, different types of cell, and in crowd,
HMOX1 promotor polymorphism may be decreased the expression (Ma Zhiming etc., 2005) of HMOX1 gene, and HMOX1-413A/T
The polymorphism in site may make the expression of HMOX1 enhance (Buis et al .2008) with HMOX1 gene promoter region mutation.
Tibetan sheep (Ovis aries) is one of big original sheep variety in China three, is mainly distributed on the Qinghai-Tibet Platean in China
The Alpine-arctic Pastorals such as area and river, the sweet, Yunnan adjoined therewith, breeding stock more than 2,500 ten thousand, be Qinghai-Tibet Platean and China sheep industry
Main body makes tibetan sheep generate a kind of non-reversible, heritable form knot during long-term evolution due to complicated territorial environment
Change process in terms of structure and Physiology and biochemistry maintains itself oxygen balance so as to form unique Hypoxia adaptation strategy
(Storz et al.,2010；Ding et al.,2014).Hypoxia adaptation research both at home and abroad is concentrated mainly on the hypoxemia of people at present
Physiology and biochemistry, molecular regulation mechanism and the epigenetic mechanism field of adaptation, to the Physiology and biochemistry of plateau animal Hypoxia adaptation
System research is also lacked with molecular genetic mechanism.
Summary of the invention
In order to solve the problems in the existing technology, the present invention select tibetan sheep (High aititude) and sheep (low altitude area) for
Research object by measuring its physiochemical indice and HMOX1 gene genetic diversity, and analyzes relevance between the two, screening
The molecular labeling that tibetan sheep adapts to Altitude genetic correlation is obtained, for further research tibetan sheep high altitude hypoxia adaptation physiology machine
System and molecular genetic mechanism provide basic data.
The present invention provides genetic marker relevant to tibetan sheep high altitude hypoxia adaptation, is located on HMOX1 gene, exists
Four preponderant genotypes AA, BB, AB and AC；When the genotype of tibetan sheep is AA, BB and AC, tibetan sheep high altitude hypoxia adaptation
Well；When the genotype of tibetan sheep is AB, tibetan sheep high altitude hypoxia adaptation is poor；
C.3691, the frequency of genotypes AA is located to be C/C in HMOX1 gene, is G/G at c.3736 place, is G/ at c.3775 place
G；
C.3691, the genotype BB locates to be T/T in HMOX1 gene, is A/A at c.3736 place, is G/ at c.3775 place
G；
C.3691, the genotype AC locates to be C/T in HMOX1 gene, is A/G at c.3736 place, is G/ at c.3775 place
A；
C.3691, the genotype AB locates to be C/T in HMOX1 gene, is G/A at c.3736 place, is G/ at c.3775 place
G。
The present invention is provided to detect the primer pair of genetic marker described in claim 1, the primer pair are as follows:
Upstream primer: GATAGAACGCAACAAGGAGAA
Downstream primer: CCTGGAGTCGCTGAACATAG.
The present invention is provided to detect the kit of tibetan sheep high altitude hypoxia adaptation, the kit is constructed to be permeable to:
1), by sample of nucleic acid determine position in HMOX1 gene c.3691, c.3736 place and the c.3775 polymorphic position located
Point；
2), the tibetan sheep high altitude hypoxia adaptation as described in the prediction of result of step 1) is high and low.
4, kit according to claim 3, it is characterised in that: the kit is constructed to be permeable to:
1), determine that the polymorphic site of position in HMOX1 gene is any in following a-c by sample of nucleic acid:
A, it is C/C at c.3691 place, is G/G at c.3736 place, is G/G at c.3775 place；
B, it is T/T at c.3691 place, is A/A at c.3736 place, is G/G at c.3775 place；
C, it is C/T at c.3691 place, is A/G at c.3736 place, is G/A at c.3775 place；
2) tibetan sheep as described in the prediction of result of step 1) has high high altitude hypoxia adaptation.
Preferably, the kit is constructed to be permeable to:
1) it determines that c.3691 position is being C/T in HMOX1 gene by sample of nucleic acid, is G/A at c.3736 place,
C.3775 place is the polymorphic site of G/G；
2) tibetan sheep as described in the prediction of result of step 1) has low high altitude hypoxia adaptation.
Preferably, the kit further includes the primer pair for expanding HMOX1 gene, the primer pair are as follows:
Upstream primer: GATAGAACGCAACAAGGAGAA
Downstream primer: CCTGGAGTCGCTGAACATAG.
The present invention provides application of the above-mentioned genetic marker in identification tibetan sheep high altitude hypoxia adaptation, and the application includes
Following steps:
1) total serum IgE of tibetan sheep to be measured is extracted, reverse transcription is at cDNA；
2) using the cDNA of tibetan sheep to be measured as template, PCR amplification is carried out using primer pair as stated in claim 2；
3) pcr amplification product is identified, when genotype is AA, BB and AC, tibetan sheep high altitude hypoxia adaptation is good
It is good；When genotype is AB, tibetan sheep high altitude hypoxia adaptation is poor；
C.3691, the frequency of genotypes AA is located to be C/C in HMOX1 gene, is G/G at c.3736 place, is G/ at c.3775 place
G；
C.3691, the genotype BB locates to be T/T in HMOX1 gene, is A/A at c.3736 place, is G/ at c.3775 place
G；
C.3691, the genotype AC locates to be C/T in HMOX1 gene, is A/G at c.3736 place, is G/ at c.3775 place
A；
C.3691, the genotype AB locates to be C/T in HMOX1 gene, is G/A at c.3736 place, is G/ at c.3775 place
G。
Preferably, the pcr amplification product is detected using SSCP, while positive control is arranged in step 3), gel electricity
It swims poststaining, SSCP electrophoresis banding pattern figure is obtained, according to the type of band in map and positive control result to the hiding of sample to be tested
Sheep high altitude hypoxia adaptation is judged.
The present invention provides above-mentioned genetic marker and is selecting and remain the application in the good tibetan sheep of high altitude hypoxia adaptation.
Genetic marker disclosed by the invention can be used in identifying the height of tibetan sheep high altitude hypoxia adaptation, additionally it is possible to be used for
The good tibetan sheep of breeding high altitude hypoxia adaptation.
Detailed description of the invention
Attached drawing is used to provide further understanding of the present invention, and constitutes part of specification, with reality of the invention
It applies example to be used to explain the present invention together, not be construed as limiting the invention.In the accompanying drawings:
Fig. 1 is that tibetan sheep and sheep respectively organize HMOX1 mrna expression.
Fig. 2 is tibetan sheep HMOX1 gene third exon PCR-SSCP testing result.
Fig. 3 is tibetan sheep HMOX1 gene SNP sequencing result.
Specific embodiment
Embodiment below facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments
Method is unless otherwise specified conventional method.Test material as used in the following examples is unless otherwise specified certainly
What routine biochemistry reagent shop was commercially available.
Embodiment 1
1 materials and methods
1.1 experimental animals and sample acquire
Selection health, body condition is good, the age 1.5~3 years old adult tibetan sheep 280 (be collected in Gansu Province Maqu County,
Height above sea level about 4000m) and sheep 204 (being collected in Linan area, Zhejiang Province, height above sea level about 100m), jugular vein acquires blood sample 5ml in containing
Have in the vacuum blood collection tube of anti-coagulants, for extracting genomic DNA and measurement physiochemical indice.Slaughter Age 3 years old tibetan sheep and
Sheep ewe each 3, heart, liver, spleen, lungs, kidney, longissimus dorsi muscle and adipose tissue are acquired immediately, and be transferred to rapidly
Liquid nitrogen storage, takes back laboratory and is placed in -80 DEG C of refrigerators and save backup.
The measurement of 1.2 physiochemical indices
(PCO is divided using carbon dioxide in U.S. DL-1600 type blood gas analyzer measurement blood2), partial pressure of oxygen (PO2), blood
Oxygen saturation (SO2), content of hemoglobin (HGB), hematocrit (HCT), etc. indexs.
The extraction of 1.3 genomic DNAs and total serum IgE
Poba gene group DNA is extracted using the two-step method of the descriptions such as conventional phenol-chloroform extraction method and Zhou.According to day
Root biochemical technology Co., Ltd (Beijing) RNA simple Total RNAKit total RNA extraction reagent box specification extracts each group
Knit total serum IgE.According to Fast King RT Kit (With gDNase) kit specification by total serum IgE reverse transcription at cDNA, -20
It DEG C saves backup.
1 sheep HMOX1 gene cDNA clone of table and RT-PCR primer
1.4 qRT-PCR
According to sheep mRNA sequence (GenBank No.XM_015094843.1), β-actin is selected
(GenBankNo.DQ838049.1) it is used as reference gene, using DNAman software design P1 and P2 primer, primer information is shown in Table
1.20 μ LqRT-PCR reaction systems are respectively adopted:Green MasterMix10.0 μ L, upstream and downstream primer
(10 μm of ol/L) each 0.4 μ L, ROX Reference Dye 2 is 0.4 μ L, cDNA template (50ng/ μ L) 2.0 μ L, ddH2O is added to
20μL.Reaction condition: 95 DEG C, 5min；95 DEG C, 10s；60 DEG C (P1 and P2 primer), 30s；Enter after 72 DEG C, 30s, 40 circulations
Solubility curve program；95 DEG C, 15s；60 DEG C, 60s；95 DEG C, 15s.Reaction is in Applied Biosystems
It is carried out on 6Flex.
1.5 standard PCR amplification
Referring to the sequence (GenBank No.NC_019460.2) of sheep HMOX1 gene, draw using the design of Primer 5.0
Object P3 (table 1) expands the area tibetan sheep HMOX1 gene exon3.PCR reaction system is 20.0 μ L, Mix reagent (Tiangeng biochemistry sections
Skill, Beijing) 10 μ L, dd H2O8.4 μ L, upstream and downstream primer (5 μm of ol/L) each 0.4 μ L, genomic DNA (100ng/ μ L) 0.8 μ L.
PCR reaction condition are as follows: 95 DEG C of initial denaturation 5min；94 DEG C of denaturation 30s, 62 DEG C of annealing 30s, 72 DEG C of extension 30s, 35 recycle；72
DEG C extend 10min, 4 DEG C preservation.Then, it is detected using 1.0% agarose gel electrophoresis.
1.6 SSCP detection
It takes 2 μ L of pcr amplification product in sterile centrifugation tube, 8 μ L is added and are denaturalized sample-loading buffer (98% deionization formyl
Amine, 0.025% dimethylbenzene cyanogen, 0.025% bromophenol blue, 10mmol/L EDTA), 98 DEG C of denaturation 10min are fast in mixture of ice and water
Quickly cooling but 5min, is splined on non-denaturing polyacrylamide gel (Acr: Bis=37.5: 1), 0.5 × Tris- boric acid
(trisborate, TBE) buffer electrophoresis.
Pcr amplification product SSCP deposition condition: gel strength 14%, 23 DEG C of electrophoresis tank water loop temperature, voltage 200V, electricity
Silver staining develops the color and determines SSCP banding pattern after swimming 16h.
The sequencing of 1.7 allele
Allelic sequences measuring method is different because of heterozygote and homozygote.If SSCP band is homozygote, expanded with PCR
Increase production object direct Sequencing；If SSCP band is heterozygote, carried out cutting glue sequencing according to the method that Gong etc. (2011) describe.Sequence
Column measurement is completed by the raw work biology Co., Ltd in Shanghai.For the accuracy for guaranteeing sequencing, every kind of allele selects 2 differences
Individual be sequenced.
1.8 statistics and analysis
Nucleotide sequence is compared using MEGA5.0 software, Popgen32.0 software calculates gene frequency, homozygosity
(Ho), heterozygosity (He), effective number of allele (Ne) and χ is carried out2It examines, PIC software calculates polymorphism information content (PIC).
QRT-PCR result is with 2-ΔΔCtMethod calculates gene relative expression quantity (Zhang et al., 2014).Using 20.0 software of SPSS
Genotype, allele are analyzed to the correlation of physiochemical indice, is as a result indicated with X ± SE.
2. result and analysis
2.1 tibetan sheep HMOX1 gene organization expression analysis
Using qRT-PCR to the HMOX1 gene of tibetan sheep and sheep in heart, liver, spleen, lungs, kidney, back longest
Expression in the tissue such as flesh and fat carries out qualitative analysis.The result shows that HMOX1 gene has in above-mentioned 7 tissues
It expresses (Fig. 1).Wherein, in tibetan sheep, expression quantity of the gene in spleen is above its hetero-organization (P < 0.01), secondly exists
Expression quantity is also higher (P < 0.05) in liver, kidney and longissimus dorsi muscle；In sheep, expression water of the gene in fat and lungs
It is flat to be higher than its hetero-organization (P < 0.01)；HMOX1 gene tibetan sheep and sheep lung, adipose tissue expression difference it is extremely significant (P <
0.01)；It is significant (P < 0.05) in tibetan sheep and sheep liver, spleen and back longest machine tissue expression difference.
Fig. 1 is that tibetan sheep and sheep respectively organize HMOX1 mrna expression；Wherein, 1: heart；2: liver；3: spleen
It is dirty；4: lungs；5: kidney；6: longissimus dorsi muscle；7: fat.Sheep heart tissue is control group；Error bar is standard error；Tibetan sheep
And sheep respectively organize between the otherness of gene expression amount show that wherein shoulder marking-up is female different indicates with upper case and lower case alphabet respectively
Significant difference (P < 0.05)；Identical expression difference is not significant (P > 0.05)；* indicates that interspecies differences are extremely significant (P < 0.01)；*
Indicate that interspecies differences are significant (P < 0.05).
2.2 tibetan sheep HMOX1 gene third exon analysis of genetic polymorphisms
The PCR product of sheep HMOX1 gene third exon through sscp analysis, tibetan sheep detected in P3 3 (A, B,
C) allele and 6 kinds of (AA, BB, CC, AB, AC and BC) genotype, and sheep only detect two allele of A, B and
A kind of genotype of AB, does not detect other genotype.As a result as shown in Figure 2.
Fig. 2 is tibetan sheep P3 primer PCR-SSCP testing result.
Sequencing result shows to detect c.3691T > C, c.3736G > A and c.3775G > SNPs of A tri- in the area Exon3.
Allele is the nucleotide sequence of A are as follows:
Allele is the nucleotide sequence of B are as follows:
Allele is the nucleotide sequence of C are as follows:
In above-mentioned nucleotide sequence, overstriking and be SNPs with the base that underscore indicates.
Tibetan sheep HMOX1 gene third exon Population genetic polymorphism is shown in Table 3.Tibetan sheep frequency of genotypes AA and allele
A frequency is up to preponderant genotype and allele, and 0.25 < PIC < 0.5 belongs to moderate polymorphic；And sheep third exon only has base
Because type AB, 0.25 < PIC < 0.5 belong to moderate polymorphic.The chi-square value of tibetan sheep group is not up to the level of signifiance (P > 0.05), is in
Hardy-Weinberg equilibrium state.
3 area sheep HMOX1 gene exon3 analysis of genetic polymorphisms of table
The correlation analysis of 2.3 tibetan sheep HMOX1 gene third exon polymorphisms and physiochemical indice
HMOX1 gene third exon genes type and allele and physiochemical indice correlation analysis are shown in Table 4 and table 5.Variance
Analysis shows the region polymorphism influences tibetan sheep HGB, HCT, PO2、SO2And PCO2The variation of equal physiochemical indices.
By between two kinds it was found that, the AB type individual PO of sheep2、PCO2And SO2Be apparently higher than tibetan sheep AA, AB,
AC and BB type is individual (P < 0.01), except the PCO of BB type individual2Except (P > 0.05)；The AB type individual HGB of sheep is significantly lower than hiding
AA, AC and BB type of sheep are individual (P<0.01), and not significant (P>0.05) with tibetan sheep AB type individual difference；The AB type of sheep
Individual HCT is individual (P < 0.01) significantly lower than AA, AB, AC and BB type of tibetan sheep.
Different genotype in tibetan sheep it was found that, the PCO of BB type individual2Be significantly higher than AA, AB and AC type individual (P <
0.05), the HGB and HCG of AA and BB type individual are significantly higher than AB type (P < 0.01), and AB type individual HGB and HCG value are minimum；AC
Type SO2Value is significantly higher than AA and BB type individual, and AC type individual values highest.The HCT for carrying allele C individual is lower than equipotential base
Because A and B is individual (P < 0.05)；The HGB for carrying allele A individual is lower than non-carrier (P < 0.05), carries allele A
The SO of body2Higher than non-carrier (P < 0.05).
The association analysis of table 4 sheep HMOX1 gene Exon3 genotype and physiochemical indice
Note: numerically marking same letter indicates no significant difference, and different capitalizations indicate that Differences are significant, i.e.,
P < 0.05, different lowercase letter indication differences are significant, i.e. P < 0.05.Because the ratio of BC and CC type individual is too small (n < 5%), not
Do association analysis.
5 tibetan sheep HMOX1 gene exon3 allele of table and physiochemical indice association analysis
3. discussing
Heme oxygenases-1 (HMOX1) is an inducible genes, in hypoxemia, oxidative stress, oxidized low-density rouge
Inducing expression under the stressed conditions such as albumen, heavy metal ion, cell factor (Li Yanli etc., 2017；Wang,et al.2010；
Bing,et al.1995；Maines,et al.1986).Studies have shown that any stress factor can induce the table of HMOX1 gene
It reaches.HMOX1 gene has expression in the multiple tissues of zebra fish, and the expression quantity in liver, spleen, the gill, kidney is higher, only in skin
It is smaller (inscription on pottery front yard etc., 2014) with expression quantity in muscle.Also studies have found that in the multiple of rat (Rattus norvegicus)
There is expression in tissue, the expression highest of HMOX1 gene in spleen, secondary is liver (Cruse et al .1988；Zhanget
al,.2008).And Zhang etc. (2017) is the study found that the HMOX1 gene expression in yak (Bos grunniens) lung tissue
Secondly highest is spleen, kidney, ovary, muscle, liver, heart and testis.Also studies have shown that the uterine part group of different cultivars duck
The expression difference for knitting middle HMOX1 gene is extremely significant (Yue Huijie etc., 2012).Under the conditions of hypoxia stress, anoxic can be lured generally
The expression of mammal HMOX1 gene is led, but most results of study show that HMOX1 is only increased in acute anoxia, with anoxic
The extension of time and gradually decrease so that restore (Li Yao etc., 2005).Li Yanli etc. (2017) is to zebra fish (Danio
Rerio) after hypoxemia processing for 24 hours, HMOX1 expression quantity obviously rises in brain, the gill and liver, and the HMOX1 in heart and kidney
Expression quantity significantly reduces.
Result of study of the present invention shows that HMOX1 gene has table in 7 tissues in two kinds of tibetan sheep and sheep
It reaches, in tibetan sheep, expression quantity highest of the gene in spleen, secondly in liver, kidney and longissimus dorsi muscle；It, should in sheep
Expression highest of the gene in fat and lungs；HMOX1 gene is in tibetan sheep and sheep lung, adipose tissue expression difference
Extremely significant (P < 0.01), it is almost the same with the results of study such as above-mentioned Zhang (2008), and with Zhang etc. (2017) on yak
Result of study is different.These results indicate that HMOX1 gene may be influenced not under hypoxemia stimulation by different modes
The histoorgan of same type, has specificity in kind and histoorgan, and tibetan sheep is chronically at stable Altitude shape
Under state, realize to environment of low oxygen plateau genetic adaptation.
Ma Zhiming etc. (2005) on people (Homo sapiens) studies have shown that HMOX1 promoter polymorphism shadow
Ring its expression, a small amount of repetitive sequences of (GT) n may be decreased the expression of HMOX1 gene, also with the occurrence and development of coronary heart disease
And degree of stenosis is related (Wang Yinghong etc., 2008).Buis CI etc. (2008) research has shown that the HMOX1- in people
The polymorphism in the site 413A/T may make HMOX1 expression enhancing with HMOX1 gene promoter region mutation, more preferably play anti-oxidant energy
Power is related.And packet roc first-class (2014) has increase red in the advantage haplotype Hap_4 of hiding sheep EPO gene studies discovery wild argali
Cell number and content of hemoglobin, and reduce the trend of erythrocyte volume.
The present invention passes through to the area gene Exon3 HMOX1 detection discovery c.3650+41T > C, c.3750-14G > A and c.3650
Tri- SNPs of+30G > A, wherein c.3650+41T > mutation of C two is only present in AB genotype, and only detects in sheep
Other genotype are not detected in AB genotype, it is presumed that during high altitude hypoxia adaptation, the heredity of tibetan sheep and sheep away from
From larger, farther out, and the genetic diversity of tibetan sheep is richer (Cheng Shuru etc., 2009) for affiliation, with long-term plateau
The selection of low-oxygen environment is further selected in tibetan sheep group conducive to the genotype of Hypoxia adaptation, is unfavorable for Hypoxia adaptation
Genotype in tibetan sheep group frequency decline.
Outstanding feature of the Hypoxia adaptation ability of plateau original inhabitants animal in hematology is that HGB, HCT are significantly higher than accordingly
Plain species animal (Zhao Xue etc., 2014；Ye Runrong etc., 1992；Jiang Jiachun etc., 1991；Kong little Yan etc., 2014；Qiang Bayang
Deng 2011).The raising of HGB and HCT is to adapt to improve oxygen carrying capacity in environment of low oxygen plateau.By between two kinds not
Homogenic type it was found that, AB type individual PO2, PCO of sheep2And SO2It is apparently higher than AA, AB, AC and BB type individual of tibetan sheep
(P < 0.01), except the PCO of BB type individual2Except (P > 0.05)；AB type the individual HGB and HCG of sheep are significantly lower than tibetan sheep
AA, AB, AC and BB type are individual (P<0.01), and in addition to the HGB of AB type individual (P>0.05), this may be by plateau atmosphere buckling
Change and the influence of height above sea level height, make PO in tibetan sheep blood2、PCO2And SO2Measure lower, HGB and HCG amount is higher, shows to adapt to
Low-oxygen environment feature.For Altitude animal, the HGB and HCG in blood are higher, and the ability for carrying conveying oxygen is got over
By force, be more conducive to adapt to low-oxygen environment.The HGB and HCG of AA and BB type individual are significantly higher than AB type (P < 0.01) in tibetan sheep, and
AB type individual HGB and HCG are minimum, are unfavorable for the adaptation of low-oxygen environment；AC type SO2Value is significantly higher than AA and BB type individual, and AC
Type individual values highest.For tibetan sheep, SO2, HGB and HCG it is higher, blood carry conveying oxygen ability it is stronger, more have
Conducive to adaptation low-oxygen environment.By statistic analysis result, it is presumed that AB genotype is unfavorable for the adaptation of low-oxygen environment, and AA, BB
It is more advantageous to adaptation environment of low oxygen plateau with AC genotype, and the mutation in AC genotype can make SO2Value is significantly raised, Ke Yigeng
Good adaptation low-oxygen environment.
4 conclusions
HMOX1 gene has expression in 7 tissues of sheep, in tibetan sheep, expression quantity of the gene in spleen
Highest, secondly in liver, kidney and longissimus dorsi muscle；In sheep, secondly expression highest of the gene in fat is lung
Dirty, spleen and kidney；Between two kinds, tibetan sheep lung, adipose tissue expression quantity are extremely significant to be lower than sheep (P < 0.01), shows as
The specificity of kind and histoorgan.C.3650+41T > C, c.3750-14G > A and c.3650+30G > A are detected in the area Exon3
Three SNPs, the region polymorphism will affect tibetan sheep HGB, HCT, SO2And PCO2The variation of equal physiochemical indices, AB genotype can
It can be unfavorable for the adaptation of low-oxygen environment, and AA, BB and AC genotype are more advantageous to the adaptation of low-oxygen environment, and position in AC genotype
Point mutation point, which has, increases HGB, HCT and SO2The trend of value can make tibetan sheep preferably adapt to low-oxygen environment.Therefore, of the invention
As a result basic data is provided for further research tibetan sheep high altitude hypoxia adaptation physiological mechanism and molecular genetic mechanism.
Embodiment 2
Detect the kit of tibetan sheep high altitude hypoxia adaptation, comprising:
1, primer pair
Upstream primer: GATAGAACGCAACAAGGAGAA
Downstream primer: CCTGGAGTCGCTGAACATAG.
2, PCR detection reagent
PCR reaction system is 20.0 μ L, Mix reagent (Tiangeng biochemical technology, Beijing), 10 μ L, dd H2O8.4 μ L, upstream and downstream
Primer (5 μm of ol/L) each 0.4 μ L, genomic DNA (100ng/ μ L) 0.8 μ L.
PCR reaction condition are as follows: 95 DEG C of initial denaturation 5min；94 DEG C of denaturation 30s, 62 DEG C of annealing 30s, 72 DEG C of extension 30s, 35
Circulation；72 DEG C of extension 10min, 4 DEG C of preservations.
3, SSCP loading denaturation buffer
98% deionized formamide, 0.025% dimethylbenzene cyanogen, 0.025% bromophenol blue, 10mmol/L EDTA.
4, standard sample
Standard sample A: its nucleotides sequence is classified as sequence table SEQ ID No.1；
Standard sample B: its nucleotides sequence is classified as sequence table SEQ ID No.2；
Standard sample C: its nucleotides sequence is classified as sequence table SEQ ID No.3.
The application method of the kit and to the analysis method of result referring to embodiment 1.
The SSCP electrophoresis banding pattern figure of the SSCP electrophoresis banding pattern figure of sample to be tested and standard sample is compared, to sample to be tested
High altitude hypoxia adaptation judged.
Finally, it should be noted that the foregoing is only a preferred embodiment of the present invention, it is not intended to restrict the invention,
Although the present invention is described in detail referring to the foregoing embodiments, for those skilled in the art, still may be used
To modify the technical solutions described in the foregoing embodiments or equivalent replacement of some of the technical features.
All within the spirits and principles of the present invention, any modification, equivalent replacement, improvement and so on should be included in of the invention
Within protection scope.
Sequence table
<110>Gansu Agriculture University
<120>genetic marker relevant to tibetan sheep high altitude hypoxia adaptation and its application
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 167
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
gatagaacgc aacaaggaga accccgtcta cactcccctc tacttcccag aggagctgca 60
ccgccgggcc gccctggagc aggacatggc cttctggtac gggccccgct ggcaggaggc 120
catcccctac acacaggcca ccaagcgcta tgttcagcga ctccagg 167
<210> 2
<211> 167
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
gatagaacgc aacaaggaga accccgtcta tactcccctc tacttcccag aggagctgca 60
ccgccgggcc gccctagagc aggacatggc cttctggtac gggccccgct ggcaggaggc 120
catcccctac acacaggcca ccaagcgcta tgttcagcga ctccagg 167
<210> 3
<211> 167
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
gatagaacgc aacaaggaga accccgtcta tactcccctc tacttcccag aggagctgca 60
ccgccgggcc gccctggagc aggacatggc cttctggtac gggccccgct ggcaagaggc 120
catcccctac acacaggcca ccaagcgcta tgttcagcga ctccagg 167
Claims (9)
1. genetic marker relevant to tibetan sheep high altitude hypoxia adaptation, it is characterised in that: it is located on HMOX1 gene, exists
Four preponderant genotypes AA, BB, AB and AC；When the genotype of tibetan sheep is AA, BB and AC, tibetan sheep high altitude hypoxia adaptation
Well；When the genotype of tibetan sheep is AB, tibetan sheep high altitude hypoxia adaptation is poor；
C.3691, the frequency of genotypes AA is located to be C/C in HMOX1 gene, is G/G at c.3736 place, is G/G at c.3775 place；
C.3691, the genotype BB locates to be T/T in HMOX1 gene, is A/A at c.3736 place, is G/G at c.3775 place；
C.3691, the genotype AC locates to be C/T in HMOX1 gene, is A/G at c.3736 place, is G/A at c.3775 place；
C.3691, the genotype AB locates to be C/T in HMOX1 gene, is G/A at c.3736 place, is G/G at c.3775 place.
2. the primer pair for detecting genetic marker described in claim 1, it is characterised in that: the primer pair are as follows:
Upstream primer: GATAGAACGCAACAAGGAGAA
Downstream primer: CCTGGAGTCGCTGAACATAG.
3. the kit for detecting tibetan sheep high altitude hypoxia adaptation, it is characterised in that: the kit is constructed to be permeable to:
1), by sample of nucleic acid determine position in HMOX1 gene c.3691, c.3736 place and the c.3775 polymorphic site located；
2), the tibetan sheep high altitude hypoxia adaptation as described in the prediction of result of step 1) is high and low.
4. kit according to claim 3, it is characterised in that: the kit is constructed to be permeable to:
1), determine that the polymorphic site of position in HMOX1 gene is any in following a-c by sample of nucleic acid:
A, it is C/C at c.3691 place, is G/G at c.3736 place, is G/G at c.3775 place；
B, it is T/T at c.3691 place, is A/A at c.3736 place, is G/G at c.3775 place；
C, it is C/T at c.3691 place, is A/G at c.3736 place, is G/A at c.3775 place；
2) tibetan sheep as described in the prediction of result of step 1) has high high altitude hypoxia adaptation.
5. kit according to claim 3, it is characterised in that: the kit is constructed to be permeable to:
1) determine that c.3691 position is being C/T in HMOX1 gene, is G/A at c.3736 place, is c.3775 locating by sample of nucleic acid
For the polymorphic site of G/G；
2) tibetan sheep as described in the prediction of result of step 1) has low high altitude hypoxia adaptation.
6. according to the described in any item kits of claim 3-5, it is characterised in that: the kit further includes for expanding
The primer pair of HMOX1 gene, the primer pair are as follows:
Upstream primer: GATAGAACGCAACAAGGAGAA
Downstream primer: CCTGGAGTCGCTGAACATAG.
7. application of the genetic marker described in claim 1 in identification tibetan sheep high altitude hypoxia adaptation, it is characterised in that: institute
State application the following steps are included:
1) total serum IgE of tibetan sheep to be measured is extracted, reverse transcription is at cDNA；
2) using the cDNA of tibetan sheep to be measured as template, PCR amplification is carried out using primer pair as stated in claim 2；
3) pcr amplification product is identified, when genotype is AA, BB and AC, tibetan sheep high altitude hypoxia adaptation is good；When
When genotype is AB, tibetan sheep high altitude hypoxia adaptation is poor；
C.3691, the frequency of genotypes AA is located to be C/C in HMOX1 gene, is G/G at c.3736 place, is G/G at c.3775 place；
C.3691, the genotype BB locates to be T/T in HMOX1 gene, is A/A at c.3736 place, is G/G at c.3775 place；
C.3691, the genotype AC locates to be C/T in HMOX1 gene, is A/G at c.3736 place, is G/A at c.3775 place；
C.3691, the genotype AB locates to be C/T in HMOX1 gene, is G/A at c.3736 place, is G/G at c.3775 place.
8. application according to claim 7, it is characterised in that: in step 3), the pcr amplification product is examined using SSCP
Survey, while positive control be set, gel electrophoresis poststaining obtains SSCP electrophoresis banding pattern figure, according to the type of band in map and
Positive control result judges the tibetan sheep high altitude hypoxia adaptation of sample to be tested.
9. genetic marker described in claim 1 is selecting and remain the application in the good tibetan sheep of high altitude hypoxia adaptation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811382697.8A CN109576376B (en) | 2018-11-20 | 2018-11-20 | Genetic marker related to Tibetan sheep plateau hypoxia adaptability and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811382697.8A CN109576376B (en) | 2018-11-20 | 2018-11-20 | Genetic marker related to Tibetan sheep plateau hypoxia adaptability and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109576376A true CN109576376A (en) | 2019-04-05 |
| CN109576376B CN109576376B (en) | 2022-06-07 |
Family
ID=65922984
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811382697.8A Active CN109576376B (en) | 2018-11-20 | 2018-11-20 | Genetic marker related to Tibetan sheep plateau hypoxia adaptability and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109576376B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109994153A (en) * | 2019-04-09 | 2019-07-09 | 山东省农业科学院奶牛研究中心 | A kind of method and its application for screening ox high altitude hypoxia adaptation molecular labeling |
| CN110241232A (en) * | 2019-07-03 | 2019-09-17 | 甘肃农业大学 | With the performance-relevant genetic marker of tibetan sheep lower oxygen concentration resistance and its application |
| CN114438225A (en) * | 2022-02-16 | 2022-05-06 | 西北农林科技大学 | Structural variation molecular marker related to goat hypoxia adaptation and application |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013075065A1 (en) * | 2011-11-18 | 2013-05-23 | Memorial Sloan-Kettering Cancer Center | 2-hydroxyglutarate as a biomarker for chronic hypoxia |
| CN106498080A (en) * | 2016-12-14 | 2017-03-15 | 兰州大学 | Method and its application using PCR SSCP quick detection sheep NELF gene mononucleotide polymorphisms |
| US20170226583A1 (en) * | 2014-02-24 | 2017-08-10 | Vanderbilt University | Identification of cattle at risk of high altitude pulmonary hypertension |
| CN107988379A (en) * | 2017-11-08 | 2018-05-04 | 甘肃农业大学 | Genetic marker relevant with tibetan sheep high altitude hypoxia adaptation and its application |
-
2018
- 2018-11-20 CN CN201811382697.8A patent/CN109576376B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013075065A1 (en) * | 2011-11-18 | 2013-05-23 | Memorial Sloan-Kettering Cancer Center | 2-hydroxyglutarate as a biomarker for chronic hypoxia |
| US20170226583A1 (en) * | 2014-02-24 | 2017-08-10 | Vanderbilt University | Identification of cattle at risk of high altitude pulmonary hypertension |
| CN106498080A (en) * | 2016-12-14 | 2017-03-15 | 兰州大学 | Method and its application using PCR SSCP quick detection sheep NELF gene mononucleotide polymorphisms |
| CN107988379A (en) * | 2017-11-08 | 2018-05-04 | 甘肃农业大学 | Genetic marker relevant with tibetan sheep high altitude hypoxia adaptation and its application |
Non-Patent Citations (2)
| Title |
|---|
| ZIHONG HE等: "Association between HMOX-1 genotype and cardiac function during exercise", 《APPL PHYSIOL NUTR METAB》 * |
| 唐晓惠等: "藏绵羊对高原低氧环境的适应性及抗病性相关基因研究进展", 《畜牧与兽医》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109994153A (en) * | 2019-04-09 | 2019-07-09 | 山东省农业科学院奶牛研究中心 | A kind of method and its application for screening ox high altitude hypoxia adaptation molecular labeling |
| CN109994153B (en) * | 2019-04-09 | 2020-11-13 | 山东省农业科学院奶牛研究中心 | Method for screening bovine plateau hypoxia adaptive molecular marker and application thereof |
| CN110241232A (en) * | 2019-07-03 | 2019-09-17 | 甘肃农业大学 | With the performance-relevant genetic marker of tibetan sheep lower oxygen concentration resistance and its application |
| CN114438225A (en) * | 2022-02-16 | 2022-05-06 | 西北农林科技大学 | Structural variation molecular marker related to goat hypoxia adaptation and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109576376B (en) | 2022-06-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Shojaei et al. | Association of growth trait and Leptin gene polymorphism in Kermani sheep | |
| CN102250889B (en) | SNP (Single Nucleotide Polymorphism) related to chick carcass trait and application thereof | |
| CN107988379B (en) | Genetic marker related to Tibetan sheep plateau hypoxia adaptability and application thereof | |
| CN109576376A (en) | Genetic marker relevant to tibetan sheep high altitude hypoxia adaptation and its application | |
| CN114457170B (en) | DNAJC30 gene molecular marker related to chicken carcass traits and application thereof | |
| CN106906303B (en) | SNP marker influencing pork quality traits and application thereof | |
| CN116083597B (en) | SNP genetic marker affecting later egg yield of chickens and application thereof | |
| CN112652362B (en) | Method for screening bovine plateau hypoxia adaptive gene ALDOC and functional molecular marker and application thereof | |
| CN114686597A (en) | SNP molecular marker for sex identification of salangid and application thereof | |
| CN114150070A (en) | SNP molecular marker related to chicken growth and slaughter traits, detection primer, kit and breeding method | |
| CN108588235B (en) | Genetic marker related to velvet production and velvet layer height of meridian-ridge black goats and application of genetic marker | |
| CN113249492B (en) | SNP marker for evaluating pig eye muscle area and application method thereof | |
| CN114921568B (en) | SNP molecular marker related to Qinchuan cattle body ruler and meat quality traits and application thereof | |
| CN103937791A (en) | Molecular marker related to rabbit important economic characters, and detection method and application thereof | |
| CN111549143A (en) | Genetic marker related to diameter of cashmere fiber of goat and application thereof | |
| CN115181805B (en) | Molecular marker related to yellow-feather broiler leg skin yellowness and application thereof | |
| CN110241232A (en) | With the performance-relevant genetic marker of tibetan sheep lower oxygen concentration resistance and its application | |
| CN105925701A (en) | Sheep UCP1 (uncoupling protein 1) allelotype detection method and detection kit | |
| US20210010023A1 (en) | Use of haplotype of snp site associated with hypoxia tolerance in breeding of megalobrama amblycephala | |
| CN112176073B (en) | PROS1 gene molecular marker related to chicken carcass traits and application | |
| CN113322333A (en) | CNV molecular marker combination related to Guangxi hemp chicken body size and slaughter traits based on whole genome sequencing screening and application | |
| CN103740830A (en) | Molecular marking method for indicating Qinchuan cattle meat tenderness and water-holding capacity by utilizing THRSP (thyroid hormone responsive spot) genes | |
| CN116334235B (en) | SERCA2 gene molecular marker related to chicken carcass traits and application thereof | |
| CN106319063A (en) | Method for detecting beef carcass and meat quality characters by aid of PRSS2 (protease, serine, 2) gene markers | |
| CN117025792A (en) | InDel molecular marker related to goats primary heavy reproduction traits and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Liu Xiu Inventor after: He Yanyu Inventor after: He Jianwen Inventor after: Zhang Wei Inventor after: Li Shaobin Inventor after: Hu Jiang Inventor after: Wang Jiqing Inventor after: Luo Yuzhu Inventor before: He Yanyu Inventor before: Liu Xiu Inventor before: He Jianwen Inventor before: Zhang Wei Inventor before: Li Shaobin Inventor before: Hu Jiang Inventor before: Wang Jiqing Inventor before: Luo Yuzhu |
|
| CB03 | Change of inventor or designer information | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |