CN105925701A - Sheep UCP1 (uncoupling protein 1) allelotype detection method and detection kit - Google Patents
Sheep UCP1 (uncoupling protein 1) allelotype detection method and detection kit Download PDFInfo
- Publication number
- CN105925701A CN105925701A CN201610397209.5A CN201610397209A CN105925701A CN 105925701 A CN105925701 A CN 105925701A CN 201610397209 A CN201610397209 A CN 201610397209A CN 105925701 A CN105925701 A CN 105925701A
- Authority
- CN
- China
- Prior art keywords
- ucp1
- sheep
- allelotype
- sample
- pcr amplification
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a sheep UCP1 (uncoupling protein 1) allelotype detection kit which comprises a specific primer pair and sheep UCP1 allelotype standard DNAs, wherein the specific primer pair comprises a sense primer 5'-AGATACAAGCGGAAGAGACAC-3' and an antisense primer 5'-TGAAGGGTTGGGTCTGTCA-3'; the sheep UCP1 allelotype standard DNAs are SEQ ID No. 1-3 in a sequence table. The invention further provides a sheep UCP1 allelotype detection method. By the detection method, different sheep UCP1 allelotypes and sheep carcass fat content characters are associatively analyzed, and researches show that a sheep UCP1 allelotype has remarkable influence (P<0.05) on a carcass fat content character of a sheep population. Therefore, a sheep UCP1 gene can be determined to improve the sheep carcass fat content character as a molecular marker.
Description
Technical field
The present invention relates to detection and the qualification of alleles, be specifically related to the inspection of a kind of sheep UCP1 allelotype
Survey method and detection kit thereof.
Background technology
China is sheep raising big country, occupies first place in the world in sheep number of animals raised position, along with the change of world sheep raising general layout in recent years, mutton sheep
Production is increasingly becoming main flow, but domestic mutton sheep colony product meat is inefficient, and it produces far from meeting domestic consumption to high-quality
The demand of amount mutton product.Accelerate improvement sheep Meat Traits, improve mutton product quality, it has also become in sheep seed selection work urgently
Problem to be solved.Fat content is one of key factor affecting meat tenderness.The fatty character of meat include content of fat in body,
Back-fat thickness, leaf fat rate, caul-fat rate, IMF and intramuscular fat.Content of fat in body be research fat on meat tenderness impact main
Phenotype index.
Meat quality is associated with a lot of economic characters or the production traits, and the tenderness such as increasing meat needs to select trunk
The individuality that the fatty amount of body is high, but the fat mass increase of trunk means that the decline of lean meat percentage and feed conversion rate reduce, because
Comparing with body deposition albumen, the fat of deposition identical weight needs more energy, and is converted into the mistake of fat at energy
In journey, capacity usage ratio is less than the utilization rate being converted into protein.With traditional Phenotypic Selection improve meat will be one very long multiple
Miscellaneous process.On the other hand, comparing with American-European countries, the cultivation starting of China's high-quality Mutton Sheep is late, the most backward, how to have
Effect utilizes the existing excellent sheep germ plasm resource of China, and the Meat Quality improving sheep is a urgent problem.Solve these
Problem it is crucial that preserving while existing excellent sheep genetic resources, seek a kind of relatively rapid effective breeding technique and carry
High sheep Meat Quality.Utilizing and carrying out molecular mark is the actual and feasible technical method of comparison.
Mutton content of fat in body proterties is as complicated quantitative character (quantitative trait, QT), and it makes a variation
By controlled by multiple genes, by the joint effect of h and E.Additionally, major part quantitative trait phenotypes variation, except many by minor effect
Outside gene controls, also its major gene resistance (major gene) producing bigger effect can be affected by one or more.Pass through
Traditional Phenotypic Selection improves Meat Quality and is probably the very long and seed selection and breeding process of poor efficiency, along with sending out of modern biotechnology
Exhibition and theoretical the enriching constantly of molecular breeding make us directly utilize molecular marking supplementary breeding to be possibly realized.Therefore, find
With these major gene resistances of research, it it is one of effective way improving sheep Meat Performance.
Uncoupling proteins 1 (uncoupling protein 1, UCP1) is brown adipose tissue (brown adipose
Tissue, BAT) marker gene that exists.Containing substantial amounts of mitochondria in brown fat cell, UCP1 albumen is present in line in a large number
On mitochondrial membrane.By the effect of proton leak, UCP1 albumen consumes the proton concentration produced in a part of oxidative phosphorylation process
Gradient, makes the synthetic quantity of atriphos reduce, and energy transfers to be released in the form of heat.Accordingly, as a kind of natural power consumption
Type fat, brown fat plays an important role for maintaining body temperature and energy balance.
UCP1 gene has close contacting with fat metabolism, energy balance.UCP1 gene in new-bom lamb adipose tissue
Expression survival rate postnatal to lamb play an important role.Relevant UCP1 gene mononucleotide polymorphism (single
Nucleotide polymorphism, SNP) research show, promoter region-3826A ＞ G and-1766A ＞ G, exon 2
The sudden change of the 208T ＞ G of Ala64Thr and the Met229Leu of extron 5 and introne 4 and the body weight of people, body-mass index
(body mass index, BMI) and waist-to-hip ratio, waistline and height ratio, body fat weight, fat percentage, abdominal subcutaneous fat and abdomen
Portion's interior fat weight, and there is notable association in the ill probability of type II diabetes etc..
Forefathers study sheep UCP1 gene and are concentrated mainly on tissue expression properties study, but sink carcass lipid about UCP1
Long-pending research is also few, and the correlative study being simultaneous for UCP1 gene pairs Sheep fat content is less.
Summary of the invention
Present invention solves the technical problem that and be to provide a kind of detection allelic method of sheep UCP1, find with economical
The allelotype of trait associations is as molecular labeling, to accelerate to have building of high-quality content of fat in body proterties sheep population
Vertical.
The present invention is achieved through the following technical solutions:
The present invention provides the detection kit of a kind of sheep UCP1 allelotype, described kit include specific primer to
Sheep UCP1 allele standard DNA；
Described specific primer to for:
Upstream primer: 5 '-AGATACAAGCGGAAGAGACAC-3 '；
Downstream primer: 5 '-TGAAGGGTTGGGTCTGTCA-3 '；
Described sheep UCP1 allele standard DNA is SEQ ID No.1-3 in sequence table.
The present invention also provides for the detection method of a kind of sheep UCP1 allelotype, and step is as follows:
(1) design specific primer pair:
Upstream primer: 5 '-AGATACAAGCGGAAGAGACAC-3 '；
Downstream primer: 5 '-TGAAGGGTTGGGTCTGTCA-3 '；
(2) sample to be tested is carried out PCR amplification；
(3) after processing pcr amplification product with denaturant, to the amplified fragments after sex change and sheep UCP1 allele standard DNA
Sample synchronization carries out SSCP electrophoresis, judges the UCP1 allelotype of sample to be tested according to standard DNA sample electrophoresis result；Described
Sheep UCP1 allele standard DNA is SEQ ID No.1-3 in sequence table.
As preferably, described in step (2), pcr amplification reaction program is: 94 DEG C of denaturations 5min, 94 DEG C of sex change 30s, moves back
Fire temperature 60 C 30s, 72 DEG C of extension 1min, circulate 35 times, and 72 DEG C extend 5min, 4 DEG C of preservations.
The present invention also provides for a kind of molecular labeling assisting sifting method of Sheep fat content proterties, first identifies and treats
Test sample UCP1 allelotype originally, then judges to result: when allelotype is as UCP1*B, Sheep fat contains
Amount proterties is high-quality；When allelotype is UCP1*A, Sheep fat content proterties is qualified；Allelotype is
During UCP1*C, Sheep fat content proterties is inferior.
As preferably, the method for the described UCP1 allelotype identifying sample to be tested is:
(1) design specific primer pair:
Upstream primer: 5 '-AGATACAAGCGGAAGAGACAC-3 '；
Downstream primer: 5 '-TGAAGGGTTGGGTCTGTCA-3 '；
(2) sample to be tested is carried out PCR amplification；
(3), after processing pcr amplification product with denaturant, the amplified fragments after sex change and standard DNA sample synchronization are carried out SSCP
Electrophoresis, judges the UCP1 allelotype of sample to be tested according to standard DNA sample electrophoresis result.
As preferably, described in step (2), pcr amplification reaction program is: 94 DEG C of denaturations 5min, 94 DEG C of sex change 30s, moves back
Fire temperature 60 C 30s, 72 DEG C of extension 1min, circulate 35 times, and 72 DEG C extend 5min, 4 DEG C of preservations.
The present invention also provides for the method for building up of high-quality content of fat in body proterties sheep population, first identifies sample to be tested
UCP1 allelotype, then screens result: eliminated by the sheep individuality that content of fat in body proterties is UCP1*C；Will
The individuality that content of fat in body character gene type is UCP1*B and genotype is UCP1*BC reserve seed for planting carry out expanding numerous.
As preferably, the method for the described UCP1 allelotype identifying sample to be tested is:
(1) design specific primer pair:
Upstream primer: 5 '-AGATACAAGCGGAAGAGACAC-3 '；
Downstream primer: 5 '-TGAAGGGTTGGGTCTGTCA-3 '；
(2) sample to be tested is carried out PCR amplification；
(3), after processing pcr amplification product with denaturant, the amplified fragments after sex change and standard DNA sample synchronization are carried out SSCP
Electrophoresis, judges the UCP1 allelotype of sample to be tested according to standard DNA sample electrophoresis result.
As preferably, described in step (2), pcr amplification reaction program is: 94 DEG C of denaturations 5min, 94 DEG C of sex change 30s, moves back
Fire temperature 60 C 30s, 72 DEG C of extension 1min, circulate 35 times, and 72 DEG C extend 5min, 4 DEG C of preservations.
Compared with prior art, the present invention has following technical effect that
The present invention is according to the sequences Design announcing sheep UCP1 gene (GenBank Accession No. JN604985.1)
Primer, with the genomic DNA of sheep as template, carries out PCR amplification, by the SSCP polyacrylamide gel electricity to amplified production
Swimming and sequencing analysis find to there is polymorphism and different allelotypes in sheep UCP1 gene promoter area.
For above-mentioned sheep UCP1 gene polynorphisms and allelotype, the invention also discloses equipotential based on SSCP
Gene distinguishes type and detection method, after carrying out PCR amplification, processes sample to be tested and standard DNA sample with denaturant, carries out SSCP and gathers
Acrylamide gel electrophoresis, by obtaining the allelotype of sample to be tested with standard DNA banding pattern comparison, it is possible to simple, quick,
Low cost, accurately detect the allelotype of sheep UCP1 gene.
The detection method of the present invention is that sheep UCP1 difference allelotype is closed with Sheep fat content proterties
Connection is analyzed, research show sheep UCP1 allelotype the content of fat in body proterties of Sheep Populations had significantly affect (P <
0.05).More than research show, sheep UCP1 gene can as improve Sheep fat content proterties molecular labeling, with
Just for the molecular marker assisted selection of Sheep fat content proterties, the heredity money with high-quality Meat Traits is quickly set up
Source Sheep Populations.
Accompanying drawing explanation
Accompanying drawing is for providing a further understanding of the present invention, and constitutes a part for specification, with the reality of the present invention
Execute example together for explaining the present invention, be not intended that limitation of the present invention.In the accompanying drawings:
Fig. 1 is Sheep fat content proterties special major gene resistance allele SSCP banding pattern figure.
Detailed description of the invention
Below example facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiment
Method, if no special instructions, is conventional method.Test material used in following embodiment, if no special instructions, is city
Sell.
Embodiment 1 one kinds is for the PCR-SSCP kit of Sheep fat content proterties detection
The kit of the present invention includes:
1, special primer pair:
Upstream primer: 5 '-AGATACAAGCGGAAGAGACAC-3 '；
Downstream primer: 5 '-TGAAGGGTTGGGTCTGTCA-3 '；
2, biochemical reagents:
Taq DNA polymerase；Sterilizing ultra-pure water；
Include MgCl2, the 5 × Buffer of dNTPs or be
10 × PCR buffer solution, MgCl2And dNTP.
Points for attention:
(1) extraction of DNA can be extracted kit according to the whole blood DNA of different manufacturers and be required extraction, but need to ensure the purity of DNA,
If extraction effect is the best, need to carry out follow-up test the most again；
(2) reaction system and response procedures can operate according to different producer's product requirements, but to ensure the special of amplification
Property and the concentration of amplified production, one side affect follow-up result of the test.
Embodiment 2 screening and the method for local Sheep Populations intramuscular fat proterties significant correlation DNA molecular marker
The sheep sequence (GenBank Accession No. JN604985.1) that first present invention announces according to NCBI sets
Meter primer, with ovine genome DNA as template, carries out PCR amplification, by the SSCP polyacrylamide gel electricity to amplified production
Swimming and sequencing analysis find to there is polymorphism and different allelotypes in sheep UCP1 gene promoter area；Secondly, right
Colony to be measured carries out the PCR-SSCP detection of allelotype；Finally, according to the allelotype detected in colony, carry out
Population genetic statistical analysis and the association analysis of content of fat in body proterties, filter out closely related with sheep intramuscular fat proterties
Molecular labeling.
For the molecule labelling method of seed selection place Sheep Populations intramuscular fat proterties, utilize PCR-SSCP technology screening with
The method of local Sheep Populations intramuscular fat proterties significant correlation DNA molecular marker, particular content is as follows:
One, extracting genome DNA
Gather sheep jugular vein blood 5ml to be measured, sodium citrate anti-freezing ,-20 DEG C of preservations；
With reference to " Molecular Cloning: A Laboratory guide ", extract genomic DNA ,-20 DEG C of preservations with phenol chloroform extraction method.
Preparing 1% Ago-Gel: agarose 1g, be dissolved in the 0.5 × TBE of 100ml, microwave-oven-heating, to fully dissolving, is treated
Pour in the glue groove being inserted with comb after being down to room temperature, stand-by after cooled and solidified.
1% Ago-Gel utilizing preparation carries out electrophoresis detection, voltage 100V, electric current 50mA, electrophoresis 30 minutes.Through bromine
After changing ingot dyeing 15 minutes, irradiate under gel imaging instrument uviol lamp, observe size and the brightness of band, it is judged that DNA carries
Take quality.
Two, PCR amplification
(1) PCR amplification primers
Specific amplification UCP1 gene, the sequence of P is respectively as follows: by the primer
Upstream primer the sequence 5 '-AGATACAAGCGGAAGAGACAC-3 ' of primer P；
Downstream primer the sequence 5 '-TGAAGGGTTGGGTCTGTCA-3 ' of primer P；
Amplified fragments size is 352bp.
(2) pcr amplification reaction system sees table 1.
Table 1 pcr amplification reaction system
The PCR reaction condition of above-mentioned unique allele amplimer is: 94 DEG C of denaturations 5min, 94 DEG C of sex change 30s, annealing temperature
Spending 60 DEG C of 30s, 72 DEG C of extension 1min, circulate 35 times, 72 DEG C extend 5min, 4 DEG C of preservations.
Two groups of PCR primer of specific amplification are detected by 1% agarose gel electrophoresis, voltage 100V, electrophoresis 30min, warp
After bromination ingot EB dyeing 15min, irradiate under Bio-RAD gel imaging instrument uviol lamp, observe the size of amplified band and bright
Degree, it is judged that PCR primer amplification quality.
Three, SSCP detection with sample to be tested distinguish type
The preparation of (1) 14% non-denaturing polyacrylamide gel
The compound method of 25ml 14% non-denaturing polyacrylamide gel: 40% acrylamide solution 8.75ml, 10 × TBE solution
1.25ml, 10%APS solution 150 μ l, TEMED solution 13.64 μ l, distilled water 14.84ml.Glue is at the uniform velocity poured into after stirring
Device, and insert comb, after gelling is solid, slowly extract comb.
(2) pcr amplification product and standard DNA denaturing samples
Take the PCR primer of 3 μ l, add 7 μ l denaturation buffer, 95% formamide, 10mmol/L EDTA, 0.05% bromjophenol blue,
0.05% dimethylbenzene is blue or green, after brief centrifugation, and 98 DEG C of sex change 10min in PCR instrument, it is immediately placed on after taking-up on ice, complete after 10min
Portion's loading.
(3) SSCP polyacrylamide gel electrophoresis
Appropriate 0.5 × tbe buffer liquid is added upper and lower groove, with syringe, the bubble of generation is driven out of, and rinse loading wells；By just
Negative pole closes electrophoresis tank lid, after prerunning 30min, draws the PCR primer after sex change with microsyringe and adds loading wells；Point sample
After completing, electrophoresis 18h at voltage 250V, temperature 15 DEG C.
(4) dye, develop the color:
From electrophoresis tank, take out gel, after rinsing 2 times with distilled water, add dyeing liquor (0.1% silver nitrate) 250ml, be put in shaking table
Lucifuge shakes 15min gently, pours out dyeing liquor；
Add nitrite ion (2% NaOH+0.1% formaldehyde) 250ml, submergence gel, shake while observe, until manifesting electricity on gel
Swimming band；Pour out nitrite ion, use deionized water rinsing 2-3 time rapidly, take pictures.
Sheep UCP1 allele standard DNA and DNA double chain sample synchronization to be detected are carried out SSCP electrophoresis, standard specimen DNA
Having three allele, its nucleotide sequence is respectively as follows:
UCP1*A standard DNA:
agatacaagcggaagagacacacacctttgtcttttgatgagaggaatctgcgaatatgctttaaaaccacat
cagatggaaccactgagaaagacaatgcacagggttggtgagttgggttgtgggttggggattatccagttgatagc
gattcaccttttatgcattataacgaacattcccaatctgcttagccatcatcctcacaacctaataacttcaccac
agctgcactctctaaggtgaccaattatgttagagccaaatccaatagttttctttgtttttattctcttttgacat
tttttctaaacattacagtatgactacttgacagacccaacccttcaa
UCP1*B standard DNA:
agatacaagcggaagagacacacacctttgtcttttgatgagaggaatctgcgaatatgctttaaaaccacat
cagatggaaccactgagaaagacaatgcacagggttggtgagttgggttgtgggttggggattatccagttgatagc
gattcaccttttatgcattataacgaacattcccaatctgcttagccatcatcctcataacctaataacttcaccac
agctgcactctctaaggtgaccaattatgttagagccaaatccaatagttttctttgtttttattctcttttgacat
tttttctaaacattacagtatgactacttgacagacccaacccttcaa
UCP1*C standard DNA:
agatacaagcggaagagacacacacctttgtcttttgatgagaggaatctgcgaatatgctttaaaaccacat
cagatggaaccactgagaaagacaatgcacagggttggtgagttgggttgtgggttggggattatccagttgatagc
gattcaccttttatgcattataacgaacattcccaatctgcttagccatcatcctcataacctaataacttcaccac
agctgcactctctaaagtgaccaattatgttagagccaaatccaatagttttctttgtttttattctcttttgacat
tttttctaaacattacagtatgactacttgacagacccaacccttcaa
The nucleotide sequence of sheep UCP1 allele standard DNA sample and the allele of sample to be checked complete phase in sequence
With, allele standard DNA sample is the single stranded DNA prepared, and its unique characteristic is the single stranded DNA of standard specimen bar when SSCP electrophoresis
Band the most clearly becomes clear, and when standard specimen DNA and DNA double chain sample synchronization to be detected carry out SSCP electrophoresis, can the most directly lead to
Cross and compare standard specimen DNA banding pattern and DNA sample banding pattern difference to be measured, identify the UCP1 allelotype of sample to be tested with this, knot
Fruit sees accompanying drawing 1.
Four, DNA sequencing
Choose the PCR primer that in primer P amplification gene fragment, different genotype is individual, be sent to the limited duty of Shanghai biotechnology
Ren company checks order, and utilizes DNAman software analysis comparing dna sequence, determines allelic sequences.
Five, association analysis
Utilize software SPSS19.0, the content of fat in body proterties between different genotype is carried out statistical analysis, analyze method such as
Under:
Application General linear mixed model (General Linear Mixed Model, GLMM) assessment UCP1 allele is deposited
In/the disappearance impact on intramuscular fat proterties.Existence being defined as " 1 " respectively, disappearance is defined as " 0 ", it is considered to allele is imitated
Should, sex-effects and birth grade (single lamb, twin lamb(s) etc.) they are fixed factor (Fixed Factors), and family effect is random
Factor, coordinates following model to carry out least square variance analysis,
Yijkng=μ+Mi+Gj+Wg+Ck+Xn+eijkng
Wherein: YijkngFor content of fat in body proterties；μ is trait population mean value；MiFor UCP1 genotype, allele is imitated
Should；GjFor birth grade effect；WgFor sex-effects；CkFor family effect；XnFor reciprocal effects；eijkngFor random error effect.
P < 0.05 is for having active effects.
According to the above-mentioned result that analyzes and identifies, sample to be tested banding pattern is consistent with UCP1*B banding pattern and sample to be tested with
Its Sheep fat content proterties that UCP1*BC genotype is consistent is high-quality；Sample to be tested and UCP1*A standard DNA sample strip
The Sheep fat content proterties that type is consistent is qualified；Sample to be tested banding pattern is consistent with UCP1*C standard DNA sample banding pattern
Sheep fat content proterties is inferior.
According to above-mentioned analysis, content of fat in body proterties UCP1*C individuality is eliminated；High-quality content of fat in body proterties base
Carry out expanding numerous because the individuality of type UCP1*B and genotype UCP1*BC is reserved seed for planting, an excellent Meat Quality colony will be formed.
Result such as table 2 below and table 3.
Content of fat in body proterties between table 2 not iso-allele carries out significance test of difference table
* significance is 0.05, and more significant level is between 0.05-0.10.
Content of fat in body proterties between table 3 different genotype carries out significance test of difference table
* significance is 0.05, and more significant level is between 0.05-0.10.
The foundation of embodiment 3 high-quality content of fat in body proterties sheep population
Method in Application Example 2 identifies the UCP1 allelotype of sample to be tested, then screens result: by trunk
Fat content proterties is that the sheep individuality of UCP1*C is eliminated；It is UCP1*B and genotype by content of fat in body character gene type
Reserving seed for planting for the individuality of UCP1*BC, it is numerous to carry out expanding, and sets up high-quality content of fat in body proterties sheep population.
Finally it is noted that the foregoing is only the preferred embodiments of the present invention, it is not limited to the present invention,
Although being described in detail the present invention with reference to previous embodiment, for a person skilled in the art, it still may be used
So that the technical scheme described in foregoing embodiments to be modified, or wherein portion of techniques feature is carried out equivalent.
All within the spirit and principles in the present invention, any modification, equivalent substitution and improvement etc. made, should be included in the present invention's
Within protection domain.
Sequence table
<110>Chinese Academy of Sciences cold area arid region environment and Engineering research institute
<120>detection method of a kind of sheep UCP1 allelotype and detection kit thereof
<170> PatentIn version 3.5
<210> 1
<211> 352
<212> DNA
<213>UCP1*A standard DNA
<400> 1
agatacaagc ggaagagaca cacacctttg tcttttgatg agaggaatct gcgaatatgc 60
tttaaaacca catcagatgg aaccactgag aaagacaatg cacagggttg gtgagttggg 120
ttgtgggttg gggattatcc agttgatagc gattcacctt ttatgcatta taacgaacat 180
tcccaatctg cttagccatc atcctcacaa cctaataact tcaccacagc tgcactctct 240
aaggtgacca attatgttag agccaaatcc aatagttttc tttgttttta ttctcttttg 300
acattttttc taaacattac agtatgacta cttgacagac ccaacccttc aa 352
<210> 2
<211> 352
<212> DNA
<213>UCP1*B standard DNA
<400> 2
agatacaagc ggaagagaca cacacctttg tcttttgatg agaggaatct gcgaatatgc 60
tttaaaacca catcagatgg aaccactgag aaagacaatg cacagggttg gtgagttggg 120
ttgtgggttg gggattatcc agttgatagc gattcacctt ttatgcatta taacgaacat 180
tcccaatctg cttagccatc atcctcataa cctaataact tcaccacagc tgcactctct 240
aaggtgacca attatgttag agccaaatcc aatagttttc tttgttttta ttctcttttg 300
acattttttc taaacattac agtatgacta cttgacagac ccaacccttc aa 352
<210> 3
<211> 352
<212> DNA
<213>UCP1*C standard DNA
<400> 3
agatacaagc ggaagagaca cacacctttg tcttttgatg agaggaatct gcgaatatgc 60
tttaaaacca catcagatgg aaccactgag aaagacaatg cacagggttg gtgagttggg 120
ttgtgggttg gggattatcc agttgatagc gattcacctt ttatgcatta taacgaacat 180
tcccaatctg cttagccatc atcctcataa cctaataact tcaccacagc tgcactctct 240
aaagtgacca attatgttag agccaaatcc aatagttttc tttgttttta ttctcttttg 300
acattttttc taaacattac agtatgacta cttgacagac ccaacccttc aa 352
Claims (9)
1. the detection kit of a sheep UCP1 allelotype, it is characterised in that: described kit includes specific primer
To and sheep UCP1 allele standard DNA；
Described specific primer to for:
Upstream primer: 5 '-AGATACAAGCGGAAGAGACAC-3 '；
Downstream primer: 5 '-TGAAGGGTTGGGTCTGTCA-3 '；
Described sheep UCP1 allele standard DNA is SEQ ID No.1-3 in sequence table.
2. the detection method of a sheep UCP1 allelotype, it is characterised in that: step is as follows: (1) design specific primer
Right:
Upstream primer: 5 '-AGATACAAGCGGAAGAGACAC-3 '；
Downstream primer: 5 '-TGAAGGGTTGGGTCTGTCA-3 '；
(2) sample to be tested is carried out PCR amplification；
(3) after processing pcr amplification product with denaturant, to the amplified fragments after sex change and sheep UCP1 allele standard DNA
Sample synchronization carries out SSCP electrophoresis, judges the UCP1 allelotype of sample to be tested according to standard DNA sample electrophoresis result；Described
Sheep UCP1 allele standard DNA is SEQ ID No.1-3 in sequence table.
Method the most according to claim 1, it is characterised in that: described in step (2), pcr amplification reaction program is: 94 DEG C
Denaturation 5min, 94 DEG C of sex change 30s, 60 DEG C of 30s of annealing temperature, 72 DEG C of extension 1min, circulate 35 times, 72 DEG C of extension 5min, 4
DEG C preserve.
4. the molecular labeling assisting sifting method of a Sheep fat content proterties, it is characterised in that: first identify to be measured
The UCP1 allelotype of sample, then judges result: when allelotype is as UCP1*B, Sheep fat content
Proterties is high-quality；When allelotype is UCP1*A, Sheep fat content proterties is qualified；Allelotype is UCP1*C
Time, Sheep fat content proterties is inferior.
Method the most according to claim 4, it is characterised in that: the side of the UCP1 allelotype of described qualification sample to be tested
Method is:
(1) design specific primer pair:
Upstream primer: 5 '-AGATACAAGCGGAAGAGACAC-3 '；
Downstream primer: 5 '-TGAAGGGTTGGGTCTGTCA-3 '；
(2) sample to be tested is carried out PCR amplification；
(3), after processing pcr amplification product with denaturant, the amplified fragments after sex change and standard DNA sample synchronization are carried out SSCP
Electrophoresis, judges the UCP1 allelotype of sample to be tested according to standard DNA sample electrophoresis result.
Method the most according to claim 5, it is characterised in that: described in step (2), pcr amplification reaction program is: 94 DEG C
Denaturation 5min, 94 DEG C of sex change 30s, 60 DEG C of 30s of annealing temperature, 72 DEG C of extension 1min, circulate 35 times, 72 DEG C of extension 5min, 4
DEG C preserve.
7. the method for building up of high-quality content of fat in body proterties sheep population, it is characterised in that: first identify sample to be tested
UCP1 allelotype, then screens result: eliminated by the sheep individuality that content of fat in body proterties is UCP1*C；Will
The individuality that content of fat in body character gene type is UCP1*B and genotype is UCP1*BC reserve seed for planting carry out expanding numerous.
Method the most according to claim 7, it is characterised in that: the side of the UCP1 allelotype of described qualification sample to be tested
Method is:
(1) design specific primer pair:
Upstream primer: 5 '-AGATACAAGCGGAAGAGACAC-3 '；
Downstream primer: 5 '-TGAAGGGTTGGGTCTGTCA-3 '；
(2) sample to be tested is carried out PCR amplification；
(3), after processing pcr amplification product with denaturant, the amplified fragments after sex change and standard DNA sample synchronization are carried out SSCP
Electrophoresis, judges the UCP1 allelotype of sample to be tested according to standard DNA sample electrophoresis result.
Method the most according to claim 8, it is characterised in that: described in step (2), pcr amplification reaction program is: 94 DEG C
Denaturation 5min, 94 DEG C of sex change 30s, 60 DEG C of 30s of annealing temperature, 72 DEG C of extension 1min, circulate 35 times, 72 DEG C of extension 5min, 4
DEG C preserve.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610397209.5A CN105925701A (en) | 2016-06-07 | 2016-06-07 | Sheep UCP1 (uncoupling protein 1) allelotype detection method and detection kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610397209.5A CN105925701A (en) | 2016-06-07 | 2016-06-07 | Sheep UCP1 (uncoupling protein 1) allelotype detection method and detection kit |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105925701A true CN105925701A (en) | 2016-09-07 |
Family
ID=56832560
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610397209.5A Pending CN105925701A (en) | 2016-06-07 | 2016-06-07 | Sheep UCP1 (uncoupling protein 1) allelotype detection method and detection kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105925701A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109554489A (en) * | 2019-01-25 | 2019-04-02 | 甘肃农业大学 | Molecular marker related to sheep feed conversion rate and application thereof |
| CN109694916A (en) * | 2019-01-08 | 2019-04-30 | 甘肃农业大学 | One kind molecular labeling relevant to sheep forage conversion ratio and its application |
| CN110079611A (en) * | 2019-05-08 | 2019-08-02 | 刘学峰 | It sheep intramuscular fat and inosine acid content molecular labeling and its is applied in breed of variety |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104726579A (en) * | 2015-03-17 | 2015-06-24 | 甘肃农业大学 | PCR-SSCP kit used for molecular selection of sheep meat performance |
-
2016
- 2016-06-07 CN CN201610397209.5A patent/CN105925701A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104726579A (en) * | 2015-03-17 | 2015-06-24 | 甘肃农业大学 | PCR-SSCP kit used for molecular selection of sheep meat performance |
Non-Patent Citations (3)
| Title |
|---|
| G. YANG等: "Genetic variation in the ovine uncoupling protein 1 gene:association with carcass traits in New Zealand (NZ) Romney sheep, but no association with growth traits in either NZ Romney or NZ Suffolk sheep", 《JOURNAL OF ANIMAL BREEDING AND GENETICS》 * |
| YA-NAN YUAN等: "Cloning and ontogenetic expression of the uncoupling protein 1 gene UCP1 in sheep", 《JOURNAL OF APPLIED GENETICS》 * |
| 袁亚男等: "绵羊UCP1 基因碱基突变与其蛋白结构和功能", 《中国农业科学》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109694916A (en) * | 2019-01-08 | 2019-04-30 | 甘肃农业大学 | One kind molecular labeling relevant to sheep forage conversion ratio and its application |
| CN109554489A (en) * | 2019-01-25 | 2019-04-02 | 甘肃农业大学 | Molecular marker related to sheep feed conversion rate and application thereof |
| CN110079611A (en) * | 2019-05-08 | 2019-08-02 | 刘学峰 | It sheep intramuscular fat and inosine acid content molecular labeling and its is applied in breed of variety |
| CN110079611B (en) * | 2019-05-08 | 2020-01-07 | 黑龙江省农业科学院畜牧兽医分院 | Molecular marker for contents of intramuscular fat and inosinic acid of sheep and application of molecular marker in variety cultivation |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103525920B (en) | A kind of molecule marking method for seed selection Altai Sheep meat production and application thereof | |
| CN105296648B (en) | Fox derived component identify and animal product in fox, rabbit, dog ingredient multiple PCR detection kit | |
| CN110373474A (en) | The relevant genetic marker of Gansu Province east Cashmere Goat diameter and its application | |
| CN108949907A (en) | One kind SNP marker primer pair relevant to Suhuai pig intramuscular fat content and its application | |
| CN114703298B (en) | Molecular marker for identifying duck feed utilization rate character based on neuropeptide gene NPY and method and application thereof | |
| CN104673902B (en) | SNP molecular marker related to breast muscle weight and breast muscle percentage of chicken and application of SNP molecular marker | |
| CN104726554B (en) | Preparation method for procambarus clarkia simple sequence repeats (SSR) primer | |
| CN105925701A (en) | Sheep UCP1 (uncoupling protein 1) allelotype detection method and detection kit | |
| CN106498078B (en) | A kind of method and its application for the single nucleotide polymorphism detecting sheep KITLG gene | |
| CN108893544A (en) | To pig through producing the relevant SNP marker of litter size, identification and its application | |
| CN102146460A (en) | Detecting method for Litopenaeus vannamei Boone LvE165 microsatellite DNA marker | |
| CN107130023A (en) | The genetic marker related to laying hen egg quality characteristics and its application | |
| CN108588235B (en) | Genetic marker related to velvet production and velvet layer height of meridian-ridge black goats and application of genetic marker | |
| CN114703299A (en) | Molecular marker for identifying duck feed utilization rate character based on neuropeptide Y5 receptor NPY5R gene, and method and application thereof | |
| CN109576376A (en) | Genetic marker relevant to tibetan sheep high altitude hypoxia adaptation and its application | |
| CN109825600A (en) | One kind SNP marker relevant to Suhuai pig muscle drip loss and detection method | |
| CN103898216B (en) | A kind of mulberry tree breed affiliation DNA molecular criticism method | |
| CN107699623A (en) | Detect the PCR SSCP primers of UCP1 gene mutations and its application in yak Meat Quality discrimination method | |
| CN103911375B (en) | The molecular marker relevant to beef cattle Meat Quality and application thereof | |
| CN104673916A (en) | Method for identifying imprinted gene Rasgrf1 of domestic pig | |
| CN104561279B (en) | Method of improving quality of chicken semen, primer used for method, kit and using method of kit | |
| CN103276090B (en) | Jinghai yellow chicken 16-week weight molecular genetic marker and application thereof | |
| CN105177142A (en) | Hippocampus erectus microsatellite markers and screening method thereof | |
| CN101985656B (en) | Method for detecting single nucleotide polymorphisms of AQP9 genes in native Chinese cattle | |
| CN108998543A (en) | A kind of SNP marker relevant to swine erythrocyte number character |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160907 |
|
| RJ01 | Rejection of invention patent application after publication |