CN109554320A

CN109554320A - Application of the PA4608 albumen as target spot in preparation antibacterials

Info

Publication number: CN109554320A
Application number: CN201811363656.4A
Authority: CN
Inventors: 徐领会; 盛硕; 辛凌翼; 刘琼; 黎钊廷; 王俊霞; 周佳暖; 梁照珣
Original assignee: South China Agricultural University
Current assignee: South China Agricultural University
Priority date: 2018-11-16
Filing date: 2018-11-16
Publication date: 2019-04-02

Abstract

Application the invention discloses PA4608 albumen as target spot in preparation antibacterials.By point mutation bacterial strain mapz_R13A and mapZ the full genome knockout mutations body for constructing PA4608 (mapZ), infection model, scuffing cell model and Murine Model of Intraperitoneal Infection model is killed fastly using nematode to be studied, the c-di-GMP binding site for being put forward for the first time PA4608 albumen plays important adjusting function in charrin disease process, it proposes that the site is the critical sites of P. aeruginosa bacteria pathogenic, then propose prevention and/or treats novel targets --- the c-di-GMP receptor PA4608 of pseudomonas aeruginosa；For Development of Novel antibacterials, it is based especially on c-di-GMP receptor induction mechanism and designs novel antibacterials and provide important theoretical basis, important theoretical reference is provided for prevention and clinical treatment charrin disease, there is important practical significance.

Description

Application of the PA4608 albumen as target spot in preparation antibacterials

Technical field

The invention belongs to field of microbial biotechnology, in particular to PA4608 albumen is as target spot in preparation antibacterials In application.

Background technique

Pseudomonas aeruginosa (Pseudomonas aeruginosa, PA) is also known as Pseudomonas aeruginosa, is wide in a kind of nature General existing Gram-negative bacteria is distributed in soil, ocean, in animal and plant body etc. in a variety of ecological environments.It is also one simultaneously The most commonly seen opportunistic human bacterial pathogen of kind can cause the acute infections such as pneumonia, urinary tract infections and septicemia, especially to immune The low patient of power includes metabolic disease patient, AIDS patient, organ transplant person, large-area burns person etc., therefore it is One of main pathogen bacterium of global hospital acquired infections.The nosocomial infection in the whole world 10%~20% is drawn by Pseudomonas aeruginosa It rises.In recent years, the recall rate of the trauma patient open wound pseudomonas aeruginosa of hospital and infection rate rise year by year, this and copper The generation of green pseudomonad antibody-resistant bacterium and popular and bacterial strain colonize increase it is closely related, and at present for the bacterium treatment of infection Strategy be still antibacterials use so that the drug resistance of Pseudomonas aeruginosa is increasingly severe.Charrin's disease threatens generation Public health security within the scope of boundary is one of the drug-fast bacteria for needing most research and development novel drugs to control.

C-di-GMP (c-di-GMP) be it is a kind of be prevalent in bacterium second messenger's small molecule intracellular, mediate and adjust Different physiological roles include motility, cell differentiation, virulence factor generates and biofilm is formed.Bacterium experiences outer signals C-di-GMP concentration intracellular is adjusted by activating or inhibiting c-di-GMP metabolic enzyme activity, and the c-di-GMP concentration intracellular changes Signal is by specific receptors or effector perception activation downstream targets and transmits signal, thus the water after transcription, translation and translation Flat number of mechanisms causes a series of physiological acoustic signals of cell, and final special change organisms or group behavior are outer to adapt to Boundary's changes in environmental conditions.The c-di-GMP signal transduction path plays crucial regulation in the pathogenic course of pseudomonas aeruginosa Effect.Existing research evidence shows that c-di-GMP promotes Pseudomonas aeruginosa life style to turn from travelling individual to biofilm state It changes, while being also the key regulator that acute infection is converted to chronic infection.Bacterium low concentration c-di-GMP intracellular promotes anxious The generation of the property a variety of virulence factors of course of infection；Bacterium high concentration c-di-GMP intracellular promotes chronic infection process biofilm It is formed.Pseudomonas aeruginosa is the mode bacterium for studying c-di-GMP signal path and pathogenic mechanism.It illustrates in c-di-GMP signal path The Regulation Mechanism of key metabolic enzymes and acceptor molecule will provide ideal molecular target to design new antibacterials.

Pseudomonas aeruginosa gene group coding is found to have 8 c-di-GMP receptors containing PilZ structural domain, including Alg44, PilZ, PA2799, PA4608, PA4324, PA3353, PA2989 and PA0012.Wherein, Alg44 regulates and controls alginates and closes At；The springing up property of PA3353 adjusting bacterium；PilZ does not have c-di-GMP and combines activity, participates in the assembling of four type pili of regulation； PA2799 participates in adjusting the adherency of bacterium surface and the formation of biofilm；PA4608 (MapZ) participates in adjusting the chemotactic of bacterium Property, and its excess-three PA4324, PA2989 and PA0012 Unknown Function.Up to the present document report this 8 is not had also to contain The c-di-GMP receptor of PilZ structural domain participates in the pathogenic infection process of bacterium.

Therefore, further further investigation c-di-GMP receptor induction mechanism, innovative design novel antibacterial drug are resistance to preventing and treating The infection of medicine bacterium has important theoretical and practical significance.

Summary of the invention

The primary purpose of the present invention is that the shortcomings that overcoming the prior art and deficiency, provide c-di-GMP receptor PA4608 (mapZ) application as target spot in preparation antibacterials.

Another object of the present invention is to provide a kind of prevention and/or the drugs for the treatment of charrin disease.

The purpose of the invention is achieved by the following technical solution:

Application of the c-di-GMP receptor PA4608 (mapZ) as target spot in preparation antibacterials.The drug can The pathogenic of the mushroom is influenced by c-di-GMP receptor induction mechanism.

The drug can carry out gene mutation or gene silencing for PA4608 gene as target spot.

The drug preferably makes the 13rd arginine (R) of PA4608 albumen that amino acid mutation occur；Further preferably For the 13rd arginine (R) of PA4608 albumen is sported alanine (A).

Amino acid sequence after described the 13rd arginine (R) the generation amino acid mutation of PA4608 albumen is preferably such as Shown in SEQ ID NO.4.

The 37th of the nucleotide sequence of the PA4608 albumen of amino acid mutation occurs for coding the 13rd arginine (R) At least one site of~39 nucleotide mutates (such as point mutation) and makes the amino acid of the 37th~39 nucleotide coding Nonsynonymous mutation occurs；Preferably its 37th and/or the 38th nucleotide mutation, further preferably the 37th nucleosides Acid sports G and/or the 38th nucleotide by C and sports C by G.

The nonsynonymous mutation is preferably missense mutation.

The nucleotide sequence that PA4608 albumen after amino acid mutation occurs for coding the 13rd arginine (R) is preferred As shown in SEQ ID NO.5.

The antibacterials include the drug infected caused by prevention or treatment mushroom.

The antibacterials are preferably resisting pseudomonas aeruginosa drug.

A kind of drug prevented and/or treat charrin disease, the drug is with c-di-GMP receptor egg White PA4608 (MapZ) is used as target spot, and the drug can reduce the pathogenic of pseudomonas aeruginosa.

The drug can contain one or more kinds of pharmaceutically acceptable carriers.

The carrier be preferably diluent, excipient, filler, adhesive, wetting agent, disintegrating agent, sorbefacient, Absorption carrier, surfactant or lubricant etc..

The diversified forms such as tablet, granule, capsule, oral solution or injection can be further made in the drug, respectively The drug of kind dosage form can be prepared according to the conventional method of pharmaceutical field.

The present invention utilizes homologous recombination technique, constructs the c-di-GMP binding site mutant strain of PA4608 (MapZ) Mapz_R13A is killed infection model fastly by nematode, scratches cell model and Murine Model of Intraperitoneal Infection model, had studied the bacterial strain and exist With the difference of the pathogenecity of wild-type strain PAO1 in multi-infection model, it is found that the mapZ_R13A mutant strain significantly drops It is low to scratch cell taxis, to the Infective ability of nematode and mouse.

The present invention has the following advantages and effects with respect to the prior art:

1. the present invention provides novel targets --- the c-di-GMP receptor proteins for preventing and/or treating pseudomonas aeruginosa PA4608(MapZ).Influence of the mutation of the 13rd binding site of PA4608 to flagellum is only rotation direction, at present not The rotation direction of report flagellum can influence pathogenic, the two non-correlation.The present invention, which passes through, scratches the taxis of cell, to line The innovation research of the Infective ability of worm and mouse, killing or lethal ability, has been put forward for the first time the c-di- of PA4608 albumen GMP binding site plays important adjusting function in charrin disease process, proposes that the site is that pseudomonas aeruginosa is caused a disease The critical sites of property.

2. applicant takes the lead in proposing that the mutation of the 13rd binding site of PA4608 might not only influence flagellum rotation direction, While also result in pathogenic change.PA4608 (MapZ) is disclosed for the first time in the important work of charrin disease process With for Development of Novel antibacterials (be based especially on c-di-GMP receptor induction mechanism and design novel antibacterials) prevention and treatment Drug-fast bacteria infection has important theoretical and practical significance.

Detailed description of the invention

Fig. 1 is MapZ albumen and MapZ^R13AThe amino acid alignment result figure of albumen.

Fig. 2 is that mapZ_R13A mutant strain and wild type PAO1 kill caused nemic death rate knot to nematode fastly in embodiment 2 Fruit analysis chart.

Fig. 3 is wild type PAO1 and Δ mapZ mutant strain, Δ hapZ mutant strain, Δ PA4324 mutant strain and Δ PA0012 mutant strain quickly kills the result analysis chart of pathogenecity to nematode.

Fig. 4 is that mapZ_R13A mutant strain and wild type PAO1 are thin in trend scuffing cell ability research in embodiment 4 Bacterium fluorescence intensity results analysis chart.

Fig. 5 is in embodiment 9 produced by wild-type strain PAO1 and point mutation bacterial strain every milligram of mycoprotein of mapZ_R13A C-di-GMP concentration result analysis chart.

Fig. 6 is that mapZ_R13A mutant strain and wild type PAO1 dye microscope photo to the HE of mouse pulmonary infection situation Figure；Wherein, A is wild-type strain PAO1, and B is mapZ_R13A bacterial strain.

Fig. 7 is that embodiment 7 has infected point mutation bacterial strain mapZ_R13A respectively and the mouse of wild type pseudomonas aeruginosa is deposited The result analysis chart of motility rate.

Specific embodiment

Present invention will now be described in further detail with reference to the embodiments and the accompanying drawings, but embodiments of the present invention are unlimited In this.

DH5 α competent cell used in following embodiment is purchased from Beijing Quanshijin Biotechnology Co., Ltd's (article No. CD201-02)；Escherichia coli containing helper plasmid pRK2013 are purchased from ATCC (article No.37159^TM)；False unit cell point Qingdao Hai Bo Bioisystech Co., Ltd (article No. HB6275) is purchased from from agar (PIA) plate.

The building of 1 mapZ_R13A mutant strain of embodiment

The present embodiment carries out the building of mapZ_R13A mutant strain by Homo~logous exchange recombinant technique.

1. the 13rd arginine (R13) of the c-di-GMP binding site of albumen coded by couple gene PA4608 a little dash forward Become, MapZ albumen (its amino acid sequence as shown in SEQ ID NO.1, nucleotide sequence such as SEQ ID NO.2) and MapZ^R13AEgg White amino acid alignment is as shown in Figure 1, include the mapZ of upper and lower homology arm using method for synthesizing gene synthesis^R13AGene Segment, nucleotide sequence is as shown in SEQ ID NO.3.

2. design primer F (CGCGGATCCTGGCGAAGATCGAGCGGCCG, SEQ IDNO.6) and primer R (CCCAAGCTTTGCCGAGCGGCCAGGAGCGC, SEQ ID NO.7) carries out PCR expansion as template using the DNA that step 1 obtains Increase, reaction system is as shown in table 1:

1 PCR reaction system of table

PCR amplification condition are as follows: 98 DEG C of initial denaturations 30s, 98 DEG C of denaturation 10s, 65 DEG C of annealing 30s, 72 DEG C of extension 1min, totally 30 A circulation, then 72 DEG C of extension 5min, 12 DEG C of preservations.

PCR carries out 1% agarose gel electrophoresis detection to PCR product after reaction, using Axygen glue reclaim reagent Box carries out purification and recovery, obtains target fragment, by the segment be connected to pK18Gm carrier (pK18Gm carrier in document An S, Wu J,Zhang LH.2010.Modulation of Pseudomonas aeruginosa biofilm dispersal by a cyclic-Di-GMP phosphodiesterase with a putative hypoxia-sensing domain.Appl It is disclosed in Environ Microbiol 76:8160-73., applicant's guarantee is from the applying date of the application to public affairs in 20 years Crowd provides the biomaterial.) on, obtain connection product.Connection product addition DH5 α competent cell progress thermal shock conversion coated plate, 37 It DEG C is incubated overnight.The single colonie grown on picking plate carries out bacterium colony PCR, selects the correct bacterium colony of stripe size to shake bacterium and carries out plasmid It is small to submit sequencing.

3. by be sequenced correct transformant with containing helper plasmid pRK2013 Escherichia coli (37159^TM, purchase (Washington, DC university, mutant library, http://www.gs.washington.edu/ are purchased from from ATCC) and wild type PAO1 Labs/manoil/libraryindex.htm triparental cross) is carried out, dilutes bacterium with sterile water after 37 DEG C of 6~8h of co-cultivation It is coated on pseudomonas isolation agar (PIA) plate containing 100 μ g/mL gentamicins afterwards, 37 DEG C are incubated overnight, on picking plate In the 10% flat lining out of sucrose LB, 37 DEG C are incubated overnight the single colonie grown, and the single colonie grown on picking plate carries out bacterium PCR is fallen, send PCR product to sequencing, the successful bacterium colony of mapZ_R13A point mutation is chosen and carries out shaking bacterium, -80 DEG C of preservations.

The building of 2 Δ mapZ mutant strain of embodiment

The present embodiment carries out the building of Δ mapZ mutant strain by Homo~logous exchange recombinant technique.

1. a pair mapZ gene knocks out, design primer P1 (CGCGGATCCAAGTGCGCCCGGTCCTTGGCTT, SEQ ID NO.8) and P2 (CCCTCTTCGAGTGACCCGCCTCTCATGTCGCGATCCCTTGGTGC, SEQ ID NO.9), with PAO1 Genomic DNA is homology arm on template amplification mapZ gene, and it is shown that reaction system such as table 2；Design primer P3 (GCACCAAGGGA TCGCGACATGAGAGGCGGGTCACTCGAAGAGGG, SEQ ID NO.10) and P4 (CCCAAGCTTCCGTACTGTATTTCGAGGGCGA, SEQ ID NO.11), using PAO1 genomic DNA as template amplification mapZ Homology arm under gene, reaction system are as shown in table 3.

2 PCR reaction system of table

3 PCR reaction system of table

PCR amplification condition are as follows: 98 DEG C of initial denaturations 30s, 98 DEG C of denaturation 10s, 65 DEG C of annealing 30s, 72 DEG C of extension 30s, totally 30 A circulation, then 72 DEG C of extension 5min, 12 DEG C of preservations.PCR carries out 1% agarose gel electrophoresis inspection to PCR product after reaction It surveys, purification and recovery is carried out using Axygen plastic recovery kit, obtains target fragment.

2. with homology arm above and below homology arm amplimer P1 on mapZ and lower homology arm amplimer P4 fusion mapZ gene Segment, reaction system are as shown in table 4.

4 PCR reaction system of table

Gained nucleotide sequence is as shown in SEQ ID NO.12.

PCR amplification condition are as follows: 98 DEG C of initial denaturations 30s, 98 DEG C of denaturation 10s, 65 DEG C of annealing 30s, 72 DEG C of extension 1min, totally 30 A circulation, then 72 DEG C of extension 5min, 12 DEG C of preservations.PCR carries out 1% agarose gel electrophoresis inspection to PCR product after reaction It surveys, purification and recovery is carried out using Axygen plastic recovery kit, obtains target fragment.The segment is connected to pK18Gm carrier On, obtain connection product.Connection product is added DH5 α competent cell and carries out thermal shock conversion coated plate, and 37 DEG C are incubated overnight.Picking is flat The single colonie that grows on plate carries out bacterium colony PCR, selects the correct bacterium colony of stripe size to shake bacterium and carries out that plasmid is small to submit sequencing.

3. by be sequenced correct transformant with containing helper plasmid pRK2013 Escherichia coli (37159^TM) and Wild type PAO1 carries out triparental cross, is coated in after diluting bacterium with sterile water after 37 DEG C of 6~8h of co-cultivation containing 100 μ g/mL On pseudomonas isolation agar (PIA) plate of gentamicin, 37 DEG C are incubated overnight, and the single colonie grown on picking plate is 10% The flat lining out of LB of sucrose (Sigma Corporation, the U.S., article No. S7903), 37 DEG C are incubated overnight, the list grown on picking plate Bacterium colony carries out bacterium colony PCR, send PCR product to sequencing, chooses the successful bacterium colony of mapZ gene knockout and carries out shaking bacterium, -80 DEG C of preservations.

The building of 3 Δ hapZ mutant strain of embodiment

The present embodiment carries out the building of Δ hapZ mutant strain by Homo~logous exchange recombinant technique.

1. a pair hapZ gene (i.e. PA2799) knocks out, design primer P5 (CGCGGATCCAAAGTACGATGATCGGCGTTTC, SEQ ID NO.13) and P6 (CGCCTTTCGTCGTTTCAGTGGAGCT CGATGGGCTGCATGGGCTG, SEQ ID NO.14), using PAO1 genomic DNA as homology arm on template amplification hapZ gene, Reaction system is the same as table 2；Design primer P7 (CAGCCCATGCAGCCCATCGAGCTCCACTGAAACGACGAAAGGCG, SEQ ID NO.15) and P8 (CCCAAGCTTTTGCAGGCCAAGTTCCACAATG, SEQ ID NO.16), using PAO1 genomic DNA as mould Plate expands homology arm under hapZ gene, and reaction system is the same as table 3.

2. with homology arm above and below homology arm amplimer P5 on hapZ and lower homology arm amplimer P8 fusion hapZ gene Segment, reaction system is the same as table 4.Gained nucleotide sequence is as shown in SEQ ID NO.17.

PCR amplification condition are as follows: 98 DEG C of initial denaturations 30s, 98 DEG C of denaturation 10s, 65 DEG C of annealing 30s, 72 DEG C of extension 1min, totally 30 A circulation, then 72 DEG C of extension 5min, 12 DEG C of preservations.PCR carries out 1% agarose gel electrophoresis inspection to PCR product after reaction It surveys, purification and recovery is carried out using Axygen plastic recovery kit, obtains target fragment.The segment is connected to pK18Gm carrier In (with embodiment 2), connection product is obtained.Connection product is added DH5 α competent cell and carries out thermal shock conversion coated plate, and 37 DEG C overnight Culture.The single colonie that grows on picking plate carries out bacterium colony PCR, selects the correct bacterium colony of stripe size to shake bacterium and carries out that plasmid is small to be submitted Sequencing.

3. by be sequenced correct transformant with containing helper plasmid pRK2013 Escherichia coli (37159^TM) and Wild type PAO1 carries out triparental cross, is coated in after diluting bacterium with sterile water after 37 DEG C of 6~8h of co-cultivation containing 100 μ g/mL On pseudomonas isolation agar (PIA) plate of gentamicin, 37 DEG C are incubated overnight, and the single colonie grown on picking plate is 10% The flat lining out of LB of sucrose (Sigma Corporation, the U.S., article No. S7903), 37 DEG C are incubated overnight, the list grown on picking plate Bacterium colony carries out bacterium colony PCR, send PCR product to sequencing, chooses the successful bacterium colony of hapZ gene knockout and carries out shaking bacterium, -80 DEG C of preservations.

The building of 4 Δ PA4324 mutant strain of embodiment

The present embodiment carries out the building of Δ PA4324 mutant strain by Homo~logous exchange recombinant technique.

1. a pair PA4324 gene knocks out, design primer P9 (CGCGGATCCCTTCGACCATGCCCTCAACGCC, SEQ ID NO.18) and P10 (TAGCGAAATGCCATTATGGGTCAGTCGGTCTGATCCGTCAAAGC, SEQ ID NO.19), with PAO1 genomic DNA is homology arm on template amplification PA4324 gene, and reaction system is the same as table 2；Design primer P11 (GCTTTGAC GGATCAGACCGACTGACCCATAATGGCATTTCGCTA, SEQ ID NO.20) and P12 (CCCAAGCTTCCTGGATTTCACGGAGGAGGTT, SEQ ID NO.21), using PAO1 genomic DNA as template amplification Homology arm under PA4324 gene, reaction system is the same as table 3.

2. being merged on PA4324 gene similarly hereinafter with homology arm amplimer P9 on PA4324 and lower homology arm amplimer P12 Source arm segment, reaction system is the same as table 4.Gained nucleotide sequence is as shown in SEQ ID NO.22.

3. by be sequenced correct transformant with containing helper plasmid pRK2013 Escherichia coli (37159^TM) and Wild type PAO1 carries out triparental cross, is coated in after diluting bacterium with sterile water after 37 DEG C of 6~8h of co-cultivation containing 100 μ g/mL On pseudomonas isolation agar (PIA) plate of gentamicin, 37 DEG C are incubated overnight, and the single colonie grown on picking plate is 10% The flat lining out of LB of sucrose (Sigma Corporation, the U.S., article No. S7903), 37 DEG C are incubated overnight, the list grown on picking plate Bacterium colony carries out bacterium colony PCR, send PCR product to sequencing, chooses the successful bacterium colony of PA4324 gene knockout and carries out shaking bacterium, -80 DEG C of guarantors It deposits.

The building of 5 Δ PA0012 mutant strain of embodiment

The present embodiment carries out the building of Δ PA0012 mutant strain by Homo~logous exchange recombinant technique.

1. a pair PA0012 gene knocks out, design primer P13 (CGCGGATCCTCACCTGGGAAACTGGGAAGTA, SEQ ID NO.23) and P14 (CACGTGGAACATCACCGTTCAGTATTGTCGTTGATTATCCATCG, SEQ ID NO.24), using PAO1 genomic DNA as homology arm on template amplification PA0012 gene, reaction system is the same as table 2；Design primer P15 (CGATGGATAATCAACGACAATACTGAACGGTGATGTTCCACGTG, SEQ ID NO.25) and P16 (CCCAAGCTTATATCCGTGCGACGAAGGTGTT, SEQ ID NO.26), using PAO1 genomic DNA as template amplification Homology arm under PA0012 gene, reaction system is the same as table 3.

2. above and below homology arm amplimer P13 on PA0012 and lower homology arm amplimer P16 fusion PA0012 gene Homology arm segment, reaction system is the same as table 4.Gained nucleotide sequence is as shown in SEQ ID NO.27.

3. by be sequenced correct transformant with containing helper plasmid pRK2013 Escherichia coli (37159^TM) and Wild type PAO1 carries out triparental cross, is coated in after diluting bacterium with sterile water after 37 DEG C of 6~8h of co-cultivation containing 100 μ g/mL On pseudomonas isolation agar (PIA) plate of gentamicin, 37 DEG C are incubated overnight, and the single colonie grown on picking plate is 10% The flat lining out of LB of sucrose (Sigma Corporation, the U.S., article No. S7903), 37 DEG C are incubated overnight, the list grown on picking plate Bacterium colony carries out bacterium colony PCR, send PCR product to sequencing, chooses the successful bacterium colony of PA0012 gene knockout and carries out shaking bacterium, -80 DEG C of guarantors It deposits.

6 point mutation bacterial strain mapZ_R13A of embodiment kills the detection of ability to nematode fastly

1. the food bacterial strain E.coli OP50 for taking out nematode from -80 DEG C (is purchased from Caenorhabditis Genetics Center (CGC)) activated strains on LB plate, 37 DEG C of inversion overnight incubations.The activated OP50 single colonie 10mL of picking LB liquid (Bi Di company, the U.S., article No. 244620) shakes bacterium in 50mL centrifuge tube and stays overnight, and 5000 × g is centrifuged 5min, abandons supernatant, Again plus 100 μ L LB are resuspended, and the 100 μ L of bacterium solution of resuspension is coated in 10cm NGM plate, and [every liter of NGM culture medium contains: 2.5g bacterium egg White peptone (Bi Di company, the U.S., article No. 211677), 3g sodium chloride (Sigma Corporation, the U.S., article No. S7653), 17g bacteria Agr (Bi Di company, the U.S., article No. 214010), 1mL 1M magnesium sulfate (Sigma Corporation, the U.S., article No. M7506), 25mL 1M KH₂PO₄(pH=6) (Sigma Corporation, the U.S., article No. P5655), 1mL 1M calcium chloride (Sigma Corporation, the U.S., article No. C1016), 1mL 5mg/mL cholesterol solution (Sheng Gong bioengineering limited liability company, article No. A100433)] on, it is careful not to Encounter the edge of plate.37 DEG C of cultures are for 24 hours.One piece of band Caenorhabditis elegans is cut in super-clean bench (purchased from Caenorhabditis Genetics Center (CGC)) NGM culture medium go on the NGM culture medium of long good OP50, be placed on 24 DEG C and just setting culture.

2. -80 DEG C of pseudomonas aeruginosas (PAO1, mapZ_R13A bacterial strain) of taking-up in 4~5 days are respectively in LB before experiment starts Flat lining out activation, while to activate E.coli OP50 as negative control, 37 DEG C, 200rpm cultivates 12~18h, at 4 DEG C Plate is saved to be no more than 2 weeks.The single colonie of every kind of bacterium of 60h picking before experiment starts, with 3~5mL LB in 15mL centrifuge tube Bacterium is shaken, 37 DEG C, 200rpm shakes 12~16h.It inhales 5 μ L bacterium solutions and is coated in 3.5cm PGS plate [1% bacto peptone (the green enlightening public affairs in the U.S. Department, article No. 211677), 1% sodium chloride (Sigma Corporation, the U.S., article No. S7653), 1% glucose (Sigma Corporation, the U.S., Article No. G8270), 0.15M sorbierite (Sigma Corporation, the U.S., article No. S1876), 1.7% bacteria Agr (Bi Di company, the U.S., Article No. 214010)] on, it is careful not to encounter plate edge.The PGS plate of coated bacterium solution is allowed to blow 20min in safety cabinet.37℃ It is inverted culture for 24 hours.It is transferred to 23 DEG C of cultures for 24 hours.The nematodes of picking 10 pregnancies in 2 days are to 6cm NGM-OP50 before experiment starts On plate (the NGM culture medium for having grown OP50).In 15 DEG C of 12~18h of culture nematode.All adults are gone out with needle is chosen, will be contained There is the plate of worm's ovum to place 15 DEG C of 8~10h of culture.Nematode is transferred to 20 DEG C of incubator 36~40h of culture, after they are arrived The L4 phase.30~40 nematodes of picking are transferred on the PGS plate of the good bacterium of each length.Place 25 DEG C of cultures.

3. counting the The dead quantity of nematode from choosing multiple time points 4h.In various time points by dead line Worm is chosen.

As a result as shown in Figure 2, the results showed that nemic death rate caused by mapZ_R13A bacterial strain kills nematode fastly is significant always Lower than wild-type strain PAO1, compared to wild-type strain PAO1, mapZ_R13A bacterial strain quickly kills pathogenecity to nematode and goes out Apparent reduction is showed.

The different mutant strains of embodiment 7 kill the detection of ability to nematode fastly

Δ mapZ mutant strain, Δ hapZ mutant strain, Δ PA4324 mutant strain, Δ PA0012 mutant bacteria are detected respectively Strain is compared to wild-type strain PAO1 to the fast kill ability of nematode, and specific detection method is the same as embodiment 6.

As a result it as shown in figure 3, only Δ mapZ mutant strain has dropped the ability that nematode kills fastly, shows at this In albuminoid (including PA2799, PA4608, PA4324 and PA0012), and the not all gene mutation for encoding this albuminoid can Pseudomonas aeruginosa is caused to kill the decline of ability fastly to nematode.MapZ full genome knockout mutations body strikes with remaining with albuminoid full genome Except mutant is not quite similar to the ability that nematode kills fastly.

8 point mutation bacterial strain mapZ_R13A of embodiment tends to the detection for scratching cell ability

1. with DMEM (match is silent to fly, article No. 10569044) culture A549 cell (being purchased from Chinese Academy of Sciences Shanghai cell bank) to cell It covers with, discards culture solution, wash cell with HBSS (match is silent to fly, article No. 14175079) buffer and cell is transferred to 35mm culture In ware (Yi Bidi, article No. 8013).By pseudomonas aeruginosa with LB liquid medium in 37 DEG C of cultures to OD₆₀₀=0.6.Centrifugation Culture medium is discarded, then wash cell with the HBSS buffer containing 1% (w/v) tryptone and is resuspended.

2. using Vybrant^TMDyeCycle^TMGreen coloring agent (silent winged purchased from match) dyes pseudomonas aeruginosa at 37 DEG C 30 minutes.Extra coloring agent is washed off with the HBSS buffer containing 1%tryptone before taking pictures.In A549 cell institute Culture dish in final concentration of 1 μM of propidium iodide (match silent fly) is added, to detect dead cell.Pseudomonas aeruginosa is suspended 1 μ L of liquid is added in the 35mm culture dish equipped with 9 μ L HBSS buffer cells containing A549, balances 5 minutes.

3. first shooting difference picture and fluorescence picture, microscope used are Zeiss Axiovert aobvious before scratching cell Micro mirror (karr Zeiss microscope, Jena, Germany), with the eyepiece of 20 × 1.4NA.Cell is scratched with syringe needle, A549 cell With difference picture observation, the pseudomonas aeruginosa with green fluorescence is shot using excitation wavelength 488nm, uses excitation wavelength 561nm shoots dead cell.Every 30s shoots a picture, claps 15 minutes altogether.

4. experiment chooses at least ten and scratches the Fluorescence Intensity Assays that cell carries out its periphery bacterium every time.Using Axiovision 4.7 quantifies fluorescence.The data obtained is that the opposite fluorescence compared with fluorescence intensity before scuffing is strong Degree variation, wherein fluorescence intensity shows that more by force bacterial number is more.

The present embodiment result is as shown in figure 4, show that mapZ_R13A bacterial strain is substantially less than open country to cell chemotaxis is scratched always Raw type bacterial strain PAO1.

The detection of c-di-GMP concentration caused by 9 point mutation bacterial strain every milligram of mycoprotein of mapZ_R13A of embodiment

Overnight bacterial is shaken into bacterium with LB liquid medium (Bi Di company, the U.S.), OD is collected by centrifugation₆₀₀The bacterium of ≈ 1.2 50mL washes thallus twice with ammonium acetate (Sigma Corporation, the U.S.) solution of 5mL 1mM, is finally resuspended in the extraction of 10mL pre-cooling In solvent (acetonitrile/methanol/water, volume ratio 40/40/20, Merck KGaA company).Then by 95 DEG C of heating 10min of suspension, to After cooling, 20000 × g is centrifuged 10min, collects supernatant.Supernatant is lyophilized, products therefrom is dissolved in 400 μ L water and is vortexed, Then using c-di-GMP (Sigma Corporation, the U.S.) as standard items, analyzed with HPLC (Agilent).It is collected simultaneously 1mL bacterium After body is dissolved with 800 μ L 0.1M sodium hydroxide (Sigma Corporation, the U.S.) solution, 95 DEG C of heating 15min then use Bradford Assay kit (Bio Rad Laboratories) detects every milliliter of protein-contg amount (milligram) of thallus institute, finally obtains every milligram of thallus The concentration (pmol/mg) of albumen generation c-di-GMP.

As a result as shown in figure 5, produced by wild-type strain PAO1 and point mutation bacterial strain every milligram of mycoprotein of mapZ_R13A C-di-GMP concentration there is no difference.

Detection of the 10 point mutation bacterial strain mapZ_R13A of embodiment to mouse pulmonary infection ability

1. examination and approval that all mouse experiments have all obtained the care of animal committee, Agricultural University Of South China.

2. buying 8~10 weeks sizes, 20~25 grams of weight of male Babl/C mouse from Guangdong Province's animal experimental center.

3. 37 DEG C are shaken bacterium extremely by the pseudomonas aeruginosa bacterium solution renewed vaccination being incubated overnight to fresh LB liquid medium OD₆₀₀=0.2~0.4.Bacterium solution is washed three times with PBS, and adjusts bacterial concentration to OD₆₀₀=0.1.

4. being injected to 200 μ L bacterium re-suspension liquids into mouse abdominal cavity, euthanasia is carried out to mouse after 24 hours and solution takes 4% paraformaldehyde solution of lung channel is fixed out, conventional to draw materials, dehydration, paraffin embedding, film-making (4 μ m-thick), HE dyeing, optical microphotograph Sem observation is simultaneously taken pictures.(microscope: NIKON Eclipse Ci, imaging system: NIKON digital sight DS-FI2, MADE IN JAPAN, takes the photograph piece multiple: 200 ×)

As a result as shown in Figure 6, wherein A is wild-type strain PAO1, and B is mapZ_R13A bacterial strain；The result shows that wild type Bacterial strain PAO1 infection lead to mouse lung tissue larger range structure disturbance, alveolar wall construction is unclear, and it is visible bleed profusely, also It is oozed out with a small amount of inflammatory cell.And mapZ_R13A strain infection only results in the visible alveolar wall thickening of mouse lung tissue local, And with a small amount of inflammatory cell infiltration.

Detection of the 11 point mutation bacterial strain mapZ_R13A of embodiment to mouse lethal ability

3. 37 DEG C are shaken bacterium to OD by the pseudomonas aeruginosa liquid renewed vaccination being incubated overnight to fresh LB liquid medium₆₀₀ =0.2~0.4.Bacterium solution is washed three times with PBS, and adjusts bacterial concentration to OD₆₀₀=0.1.200 μ L bacterium re-suspension liquids are injected into Mouse abdominal cavity, after observation within 60 hours mouse state.

As a result as shown in fig. 7, the mouse of abdominal cavity infection point mutation bacterial strain mapZ_R13A all survives after 60 hours； And infect all dying in 40 hours for wild type pseudomonas aeruginosa.This example demonstrates that mapZ_R13A mutant strain energy Enough significantly reduce the death rate after mouse infection pseudomonas aeruginosa；The mutation of the 13rd binding site of mapZ is to P. aeruginosa The prevention and treatment of bacterium infection is significant.

The above embodiment is a preferred embodiment of the present invention, but embodiments of the present invention are not by above-described embodiment Limitation, other any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present invention, It should be equivalent substitute mode, be included within the scope of the present invention.

Sequence table

<110>Agricultural University Of South China

<120>application of the PA4608 albumen as target spot in preparation antibacterials

<160> 27

<170> SIPOSequenceListing 1.0

<210> 1

<211> 125

<212> PRT

<213> Pseudomonas aeruginosa

<400> 1

Met Ser Asp Gln His Asp Glu Arg Arg Arg Phe His Arg Ile Ala Phe

1 5 10 15

Asp Ala Asp Ser Glu Ile Leu Gln Gly Glu Arg Arg Trp Glu Val Leu

20 25 30

Leu His Asp Val Ser Leu His Gly Ile Leu Val Gly Gln Pro Gln Asp

35 40 45

Trp Asn Gly Asp Pro Gln Arg Pro Phe Glu Ala Arg Leu Tyr Leu Gly

50 55 60

Leu Asp Val Leu Ile Arg Met Glu Ile Ser Leu Ala Trp Ala Arg Asp

65 70 75 80

Gly Leu Leu Gly Phe Glu Cys Gln His Ile Asp Leu Asp Ser Ile Ser

85 90 95

His Leu Arg Arg Leu Val Glu Leu Asn Leu Gly Asp Glu Glu Leu Leu

100 105 110

Glu Arg Glu Leu Ala Leu Leu Val Ser Ala His Asp Asp

115 120 125

<210> 2

<211> 378

<212> DNA

<213> Pseudomonas aeruginosa

<400> 2

atgagtgacc agcacgacga acgtcgacgt ttccaccgga tcgccttcga cgccgacagc 60

gagatcctcc agggcgaacg gcgctgggag gtcttgctcc acgacgtctc cctgcacggc 120

atcctggtcg gccagccgca ggactggaac ggcgacccgc aacggccctt cgaggcccgc 180

ctgtacctgg gcctggatgt actgatccgc atggagatca gcctggcctg ggctcgcgac 240

ggcctgctcg gcttcgaatg ccagcacatc gacctcgact ccatcagcca cctgcgccgc 300

ctggtggaac tgaacctggg cgacgaggaa ctcctcgagc gcgagctggc cctgctggtc 360

agcgcccacg acgactga 378

<210> 3

<211> 1003

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 3

tggcgaagat cgagcggccg ccgtagccca ggcgagcatt ggtgttgcaa ccgttggtcc 60

cggaggtcat gccgaaggtg gcgttgcccg aggtaccgtt ggtggtggtg gccagcaggt 120

gcgggaacag gccgcgctgg ccctcgaaca ccatgttgcc ccaaccacag ccattaccgc 180

ctgccgcgtc ggcgtgtgcc gtcatgctgc ccaggctcag cagccccaga accaacccct 240

tgctcaaaag tcgcttgtcc atgtctgcgc tccgcagttg tattttggag aaaaacgctt 300

tagcagcttt ggcgagactt gacgaactgt caaactcgga cacatgccgc cgatccagcc 360

gcacaggcgg ggacggacgg caccgccgat cgaattccgc cacttccccg ccggcatggc 420

ttggctatag tggtatccag cagcgcgcac caagggatcg cgacatgagt gaccagcacg 480

acgaacgtcg acgtttccac gcgatcgcct tcgacgccga cagcgagatc ctccagggcg 540

aacggcgctg ggaggtcttg ctccacgacg tctccctgca cggcatcctg gtcggccagc 600

cgcaggactg gaacggcgac ccgcaacggc ccttcgaggc ccgcctgtac ctgggcctgg 660

atgtactgat ccgcatggag atcagcctgg cctgggctcg cgacggcctg ctcggcttcg 720

aatgccagca catcgacctc gactccatca gccacctgcg ccgcctggtg gaactgaacc 780

tgggcgacga ggaactcctc gagcgcgagc tggccctgct ggtcagcgcc cacgacgact 840

gaggcgggtc actcgaagag ggcgtccagg gcctgctcga ggcgcgtcac ggcgatcacc 900

tgcaatcccg ccggcgcctc cttcggcgcg ttgccgaggg gtacgatggc acgcttgaaa 960

ccatgcttgc cggcttcctt caggcgctcc tggccgctcg gca 1003

<210> 4

<211> 125

<212> PRT

<213>artificial sequence (Artificial Sequence)

<400> 4

Met Ser Asp Gln His Asp Glu Arg Arg Arg Phe His Ala Ile Ala Phe

1 5 10 15

Asp Ala Asp Ser Glu Ile Leu Gln Gly Glu Arg Arg Trp Glu Val Leu

20 25 30

Leu His Asp Val Ser Leu His Gly Ile Leu Val Gly Gln Pro Gln Asp

35 40 45

Trp Asn Gly Asp Pro Gln Arg Pro Phe Glu Ala Arg Leu Tyr Leu Gly

50 55 60

Leu Asp Val Leu Ile Arg Met Glu Ile Ser Leu Ala Trp Ala Arg Asp

65 70 75 80

Gly Leu Leu Gly Phe Glu Cys Gln His Ile Asp Leu Asp Ser Ile Ser

85 90 95

His Leu Arg Arg Leu Val Glu Leu Asn Leu Gly Asp Glu Glu Leu Leu

100 105 110

Glu Arg Glu Leu Ala Leu Leu Val Ser Ala His Asp Asp

115 120 125

<210> 5

<211> 378

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 5

atgagtgacc agcacgacga acgtcgacgt ttccacgcga tcgccttcga cgccgacagc 60

gagatcctcc agggcgaacg gcgctgggag gtcttgctcc acgacgtctc cctgcacggc 120

atcctggtcg gccagccgca ggactggaac ggcgacccgc aacggccctt cgaggcccgc 180

ctgtacctgg gcctggatgt actgatccgc atggagatca gcctggcctg ggctcgcgac 240

ggcctgctcg gcttcgaatg ccagcacatc gacctcgact ccatcagcca cctgcgccgc 300

ctggtggaac tgaacctggg cgacgaggaa ctcctcgagc gcgagctggc cctgctggtc 360

agcgcccacg acgactga 378

<210> 6

<211> 29

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 6

cgcggatcct ggcgaagatc gagcggccg 29

<210> 7

<211> 29

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 7

cccaagcttt gccgagcggc caggagcgc 29

<210> 8

<211> 31

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 8

cgcggatcca agtgcgcccg gtccttggct t 31

<210> 9

<211> 44

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 9

ccctcttcga gtgacccgcc tctcatgtcg cgatcccttg gtgc 44

<210> 10

<211> 44

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 10

gcaccaaggg atcgcgacat gagaggcggg tcactcgaag aggg 44

<210> 11

<211> 31

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 11

cccaagcttc cgtactgtat ttcgagggcg a 31

<210> 12

<211> 1250

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 12

aagtgcgccc ggtccttggc ttccacgccg agcagcacgg cataggcgtc gagcgcttcg 60

ccctggccct tggccatgtc ctcggcgatg ttgtcgagca tcccgttcat ggcgaagatc 120

gagcggccgc cgtagcccag gcgagcattg gtgttgcaac cgttggtccc ggaggtcatg 180

ccgaaggtgg cgttgcccga ggtaccgttg gtggtggtgg ccagcaggtg cgggaacagg 240

ccgcgctggc cctcgaacac catgttgccc caaccacagc cattaccgcc tgccgcgtcg 300

gcgtgtgccg tcatgctgcc caggctcagc agccccagaa ccaacccctt gctcaaaagt 360

cgcttgtcca tgtctgcgct ccgcagttgt attttggaga aaaacgcttt agcagctttg 420

gcgagacttg acgaactgtc aaactcggac acatgccgcc gatccagccg cacaggcggg 480

gacggacggc accgccgatc gaattccgcc acttccccgc cggcatggct tggctatagt 540

ggtatccagc agcgcgcacc aagggatcgc gacatgagag gcgggtcact cgaagagggc 600

gtccagggcc tgctcgaggc gcgtcacggc gatcacctgc aatcccgccg gcgcctcctt 660

cggcgcgttg ccgaggggta cgatggcacg cttgaaacca tgcttgccgg cttccttcag 720

gcgctcctgg ccgctcggca ccggacgcac ctcgccggac agcccgacct cgccgaacac 780

cagcaggtcg tgcggcagcg ggcggttgcg caggctggac atcaccgccg ccatcaacgc 840

caggtcggag gcggtttcca gcaccttgac cccacccacc acgttgagga acacgtcctg 900

gtcgtaggtc gggataccgc cgtgccggtg cagcaccgcc agcagcatcg ccaggcggtt 960

ctggtcgagg cccagggtca cccgccgcgg attcgccagg tgactggtgt cgaccagcgc 1020

ctggacctcc accagcatcg gccgcgagcc ttcccaggtg gccatcacca cgctgccggg 1080

caccgcttcc tgggcccgcg tgaggaagat cgccgaaggg ttgctcactt ccttcaggcc 1140

tttgtcggtc atgccgaaca ctcccagttc gttgaccgcg ccgaagcggt tcttcaccgc 1200

ccgcagcagg cgcaggcggc cgtctgattc gccctcgaaa tacagtacgg 1250

<210> 13

<211> 31

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 13

cgcggatcca aagtacgatg atcggcgttt c 31

<210> 14

<211> 44

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 14

cgcctttcgt cgtttcagtg gagctcgatg ggctgcatgg gctg 44

<210> 15

<211> 44

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 15

cagcccatgc agcccatcga gctccactga aacgacgaaa ggcg 44

<210> 16

<211> 31

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 16

cccaagcttt tgcaggccaa gttccacaat g 31

<210> 17

<211> 1006

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 17

aaagtacgat gatcggcgtt tccgaagcgg tctggcggat gcggcggatc agttcgaggc 60

cgtcgatctg cggcatgcgc aaatcgcaaa tgaccaggtc cggctgttcg ctttcgaaga 120

tctgcaggcc ctgcagaccg ttgagggcct gcaacacctt gaagttgctg tcttccaagt 180

aggcggcgag gctttcgcgc accacctcgt cgtcatcgat gatcagcagc gtggcactga 240

ctttatgcat gggtcatcca ggcaaacggc gccggaaaca gtgggtccta ggcgcttatt 300

gtaagtgaca acagcgcggc tacggggttc gacaaggcgc agacggtact cccatccgtt 360

gagcagttca agccgttgac ctttgccgga aaatccgcct ttgtccgtcc gatcccgtcc 420

gcacggtata aactttgacg ataatcgcca ggattgccag tcgccctccc atcgccccga 480

ccatgaggat cagcccatgc agcccatcga gctccactga aacgacgaaa ggcgacccaa 540

gggccgcctt tccaggtgtc gcacgaagcg ggtcgactta gaagtcgtcc tccacctcgc 600

cgtccttgac cttgaactcg cggttctgca ggtaggcgtt gcggatgaag atgtacttgt 660

cgccgctgat cagtttttcc gacttcagca ggttggcacg ggtgtcgacg gtattgatgc 720

cgaacatcac gttgcgcgcg cgtacgtcgt ccatgtagtg gtagggactg acatagatgt 780

ccgggatctt cgccggggca tcgcgcagcg tgctcgggcc gaggaacggc agcatcacgt 840

acgggccgct gccgacgccc caataaccca gggtctggcc gaagtcctca tcgttgcgct 900

gcaggcccat cggggtcgcc acgtcgatca agccggccag gccgaaggtg ctgttgaaca 960

gcaggcggct ggtgtccacg ccggcattgt ggaacttggc ctgcaa 1006

<210> 18

<211> 31

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 18

cgcggatccc ttcgaccatg ccctcaacgc c 31

<210> 19

<211> 44

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 19

tagcgaaatg ccattatggg tcagtcggtc tgatccgtca aagc 44

<210> 20

<211> 44

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 20

gctttgacgg atcagaccga ctgacccata atggcatttc gcta 44

<210> 21

<211> 31

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 21

cccaagcttc ctggatttca cggaggaggt t 31

<210> 22

<211> 1083

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 22

cttcgaccat gccctcaacg ccagcctgct gctggcctac gtggccctgc gccagggcga 60

cgcggtgggc gccatgacct tcgccggcga cgaccgccgg catctcccgc cgggcaaggg 120

cagcgcccag ctcggcgcgc tgctcaacac cgtctacgac ctgcagacca gccagcgtcc 180

cgccgatttc ccggaagccg tgcaggcggt gctgtcccgc cagcggcggc gggccctggt 240

gatcctggta accaacctgc gcgacgagga cgacgaagaa ctgctcggcg cggtgaaacg 300

cctgggccgc cagcaccggg tgctggtcgc cagcctgcgc gaggaagtgc tcgacaccct 360

gcgccacgag ccggtcgccc gctacgagca ggcgctcgcc tacaccggca ccatcgacta 420

cctgaatgcg cgcaacggcc tccacgagaa gctcgcggcc cacggcgtgc cagtgctcga 480

tgcgcgtccc agcgaactcg ggccggagct gatcagccgc tacctgggct ggaagcgcgc 540

cggcgtgctt tgacggatca gaccgactga cccataatgg catttcgcta tgatttgcag 600

tccagtatga cgatgccggc gctcggggaa caagctcagc ggcagcgttc ggactcccgc 660

gaggccagtt cgcgacgaat ggcgtccagc tcggcatcgc tcagataaac cggcccgccg 720

ccggcgtcct gccgatagaa gcggccgccg cgttcgagct gggacaactg ttgccgcaag 780

cgcccgcatt cctcggccag cgcagcctgg cgctggccgg cacgttcggc ggcggcggtg 840

cgttcctcgc gacgagcatc gaaatactcc tgggtgcgct gctcgcgctg gcgggtcgcg 900

gcgtcacgtt ccaccacctg cggcctgact tcgacgcgtt gcgcgccggc cggtggcgtg 960

gcggagaagt gtaccttgcc ctgggcatcg gtccagcgat agatgtccgc ctgcgccagc 1020

acgggcatca gggcgacaca gaaccacagg gcacgcatgc gaacctcctc cgtgaaatcc 1080

agg 1083

<210> 23

<211> 31

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 23

cgcggatcct cacctgggaa actgggaagt a 31

<210> 24

<211> 44

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 24

cacgtggaac atcaccgttc agtattgtcg ttgattatcc atcg 44

<210> 25

<211> 44

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 25

cgatggataa tcaacgacaa tactgaacgg tgatgttcca cgtg 44

<210> 26

<211> 31

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 26

cccaagctta tatccgtgcg acgaaggtgt t 31

<210> 27

<211> 1120

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 27

tcacctggga aactgggaag tactcaacca cttctattgc tcctacgcca agccgatcat 60

cttctatcgt ccgcccaagc tgaaggcagt ggacgagttg ctgaagaagc aacgcgtgca 120

attgggcaat cgcgtcgcac cttccactcc ggagggtatc ctcagtgtca tcaaggaagt 180

gaagaaaggc ggttgcgtag ggattcccgc cgaccccgag cccgcgcgta ccgctgggct 240

cttcgtgccc tacctgggca ccactgcatt gatcagcaag ttcgtcccgc agttgctttc 300

acgcggcaag gcgcgtggag tgttcttcca tgcggtgcgc ctgcccgatg gtagcggtta 360

caaggtgatc ctcgaagcgg ctccggcgga catgtacgac aaggacctgg aagtgtctgt 420

agcagccatg agccgcgagt tggcgaagta tgtacgagcc tatcccagcc agtacatgtg 480

gagcatgaag cgcttcaaga accgcccgga tggcgagaaa aaatggtatt gaggaaaggg 540

cgtcggaaga cgcctttttc atatccgggt actatgctca gctctgccgc ctcctccgca 600

ggtcccgagg gactcgatgg ataatcaacg acaatactga acggtgatgt tccacgtgga 660

accccaggca tgagccactg atcacagagt gggcgaaacc gctgccggtt atcggctaga 720

atgcgcgccg ctcggcatgg tgccgggcat gggttccctc accccatcgc gcaaaaagga 780

cagcacatgt cagcctcttc tccggcggcc tggcgcggca ccctggccgg cctgatcgcc 840

ttccacatct tcatcatcat cgccagcaac tacctggtgc agttgccgat caccctgttt 900

ggctggcaca ccacctgggg cgccttcagc tttccgttca tcttcctggc taccgacctc 960

accgtgcgct tgctgggcaa gggccctgcc cggctggtca tcgcccgggt catgatcccg 1020

gcgttgatcg cctcctacgt ggtctcggtg ttgttccagg aagcggcgtt ccgtggtttc 1080

tccgcgctgc tggagttcaa caccttcgtc gcacggatat 1120

Claims

1. application of the c-di-GMP receptor PA4608 as target spot in preparation antibacterials.

2. application of the c-di-GMP receptor PA4608 according to claim 1 as target spot in preparation antibacterials, It is characterized by:

3. application of the c-di-GMP receptor PA4608 according to claim 1 as target spot in preparation antibacterials, It is characterized by:

The drug is to make the 13rd arginine of PA4608 albumen that amino acid mutation occur.

4. application of the c-di-GMP receptor PA4608 according to claim 1 as target spot in preparation antibacterials, It is characterized by:

The drug is that the 13rd arginine of PA4608 albumen is sported alanine；

5. application of the c-di-GMP receptor PA4608 according to claim 3 as target spot in preparation antibacterials, It is characterized by:

Amino acid sequence after described the 13rd arginine generation amino acid mutation of PA4608 albumen is such as SEQ ID NO.4 institute Show；

The antibacterials are resisting pseudomonas aeruginosa drug.

6. application of the c-di-GMP receptor PA4608 according to claim 3 as target spot in preparation antibacterials, It is characterized by:

The 37th~39 of the nucleotide sequence of the PA4608 albumen of amino acid mutation occurs for coding the 13rd arginine At least one site of nucleotide mutate and make the 37th~39 nucleotide coding amino acid occur nonsynonymous mutation.

7. application of the c-di-GMP receptor PA4608 according to claim 6 as target spot in preparation antibacterials, It is characterized by:

Coding the 13rd arginine occur the 37th of the nucleotide sequence of the PA4608 albumen of amino acid mutation and/or 38th nucleotide mutates；

The nonsynonymous mutation is missense mutation.

8. application of the c-di-GMP receptor PA4608 according to claim 3 as target spot in preparation antibacterials, It is characterized by:

37th nucleosides of the nucleotide sequence of the PA4608 albumen of amino acid mutation occurs for coding the 13rd arginine Acid sports G and/or the 38th nucleotide by C and sports C by G；

The nucleotide sequence such as SEQ ID of PA4608 albumen after amino acid mutation occurs for coding the 13rd arginine Shown in NO.5.

9. the drug of a kind of prevention and/or treatment charrin disease, it is characterised in that:

For the drug using c-di-GMP receptor PA4608 as target spot, the drug can reduce causing a disease for pseudomonas aeruginosa Property.

10. the drug of prevention according to claim 9 and/or treatment charrin disease, it is characterised in that:

The drug can contain one or more kinds of pharmaceutically acceptable carriers；

Relative medicine preparation can be further made by the conventional method of pharmaceutical field in the drug.