CN109486835B - Alkane-producing key gene mutant from blue-green algae and application thereof - Google Patents
Alkane-producing key gene mutant from blue-green algae and application thereof Download PDFInfo
- Publication number
- CN109486835B CN109486835B CN201811481544.9A CN201811481544A CN109486835B CN 109486835 B CN109486835 B CN 109486835B CN 201811481544 A CN201811481544 A CN 201811481544A CN 109486835 B CN109486835 B CN 109486835B
- Authority
- CN
- China
- Prior art keywords
- alkane
- producing
- gene mutant
- nucleotide sequence
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P5/00—Preparation of hydrocarbons or halogenated hydrocarbons
Abstract
The invention discloses a key alkane-producing gene mutant from blue-green algae, wherein the gene has the nucleotide sequence shown in SEQ ID NO: 1, or a nucleotide sequence corresponding to the nucleotide sequence shown as SEQ ID NO: 1, or a nucleotide sequence complementary to the nucleotide sequence shown in 1. The invention also discloses a method for obtaining the hydrocarbon-producing key gene mutant by using the plasmid pEASY-1594-1711 constructed by the wild type hydrocarbon-producing key gene derived from blue-green algae as a template and application thereof. The hydrocarbon-producing gene is a mutant of wild hydrocarbon-producing gene derived from blue algae, and the total quantity of the biologically produced alkane of the strain based on the hydrocarbon-producing gene mutant is improved by 2.9 times compared with the wild strain, so that the yield of the biologically produced alkane is improved, the cost of the biologically produced oil is reduced, and the commercialization process of the biologically produced oil is accelerated.
Description
Technical Field
The invention relates to the field of bioenergy of genetic engineering, in particular to a key gene mutant for producing alkane from blue-green algae and application thereof.
Background
With the rapid increase of global economy and the decrease of fossil fuel resources such as petroleum, and the increase of environmental problems caused by the combustion of fossil fuels, the development of renewable biofuels has attracted attention (g. stephanopoulos, change in engineering microorganisms for biological fuels, Science 315(2007) 801-. As a renewable energy source, further research on the biological energy source can alleviate and even eventually eliminate the energy crisis.
The alkane is used as the main component of gasoline, diesel oil and aviation kerosene, and the biologically produced alkane is closer to the existing diesel oil of fossil origin and is an ideal diesel oil substitute. Hydrocarbons are widely found in nature and can be produced by many organisms including plants, algae, fungi. For example, plants synthesize waxes to prevent moisture evaporation, insects produce pheromones based on hydrocarbons, and in photosynthetic cyanobacteria produce hydrocarbons based on heptadecane (M.Dennis, P.E.Kolattukudy, Acobalt-lipid enzymes a surface aldehyde to a hydrocarbonand CO, proceedings Nature orange Academy of Sciences 89(1992) 5306-5310; Mata. TM., Martins AA, Caetano NS.Microalgae for biodisel production and other applications: A review, recoverable and stable Energy Reviews 14(2010) (217-32)).
The blue algae oil production has more ideal development prospect compared with the oil crops, forest trees and the like which are researched earlier. The blue algae is a prokaryotic microorganism capable of carrying out plant type oxygen production photosynthesis and has the following advantages as a new generation energy microorganism system: (1) the solar energy is absorbed, the carbon dioxide is fixed to be used as a carbon source for growth, the culture cost is low, and the vitality is strong; (2) the gene operation is simple, and genetic modification can be carried out; (3) the unit biomass contains higher energy; (4) can grow in fresh water, seawater or sewage, does not compete for land and water sources, and has the lowest influence on the environment (5). In order to continue to develop human society, renewable energy is needed to replace non-renewable fossil energy. The blue algae produces biodiesel, on one hand, the blue algae can directly use sunlight as energy, and on the other hand, CO is fixed in the process of producing the biodiesel2As a carbon source, the greenhouse effect can be relieved. Therefore, the biodiesel produced by the blue algae not only can relieve the energy crisis, but also can relieve the environmental pollution.
Although the blue algae produces biodiesel with a plurality of great advantages, the industrialization process is always carried out slowly. The development of cyanobacteria bioenergy is limited by many factors, such as expensive bioreactors, the cost of the culture process, higher enrichment costs, lack of standard methods for algal seed culture and biofuel production, etc. High production costs are The primary bottleneck problems faced by algae producing biodiesel (V.L. Colin, A.Rodrfguez, H.A. Cristobject, The role of synthetic biology in The design of microbial cell industries for biological production, Journal of biomedicine and Biotechnology 2011(2011) 1-9). Therefore, the research focus at present is to screen out the blue algae with high oil yield, shorten the culture time of the blue algae, simplify the culture conditions and reduce the cost of the biological energy generated by the blue algae.
In recent years, with the development of synthetic biology and metabolic engineering, many advances have been made in improving the yield of aliphatic hydrocarbons in cyanobacteria by modifying microbial metabolic pathways by means of genetics, enzymology and metabolic engineering. Tan et al overexpress ACC in cyanobacteria to increase the intracellular content of acyl-ACP, increasing cyanobacteria aliphatic hydrocarbon production by 50% (X.Tan, L.Yao, Q.Gao, et al. Photosynthetic drive conversion of carbon dioxide to fat alcohols and hydrocarbons in cyanobacteria, Metabolic Engineering 13(2011) 169-176). Wang et al enhanced the production of aliphatic hydrocarbons by 8-fold over the wild type by overexpressing two copies of the acyl-ACP reductase gene and the fatty aldehyde deformylase gene in the wild type Synechocystis PCC6803 (W.Wang, X.Liu, X.Lu, Engineering cyanobacteria to immunological reduction of alkanes, Biotechnology for biofuels 6(2013)69)
The existing method for improving the alkane yield in the blue algae is mainly realized by modifying a microbial metabolic pathway, although the evolution method has a definite purpose and high feasibility, the requirement on the evolution design concept is extremely high, the target object which is not understood can not be modified, the use is greatly limited, and the alkane production efficiency of the obtained mutant blue algae strain can not meet the requirement of modern commercial application. The Directed evolution technology does not need to accurately know the molecular mechanism and structural functional relationship of the substance to be evolved, but artificially produces diversity mutants which do not exist originally by introducing random mutation and recombination, and applies selection pressure according to specific needs to screen out the mutants with expected characteristics, thereby realizing simulated evolution at the molecular level, and the evolution is more targeted and has better application value (W.Johannes Tyler and H.M.ZHao, direct evolution of enzymes and biochemical pathways, Current Opinion in Microbiology 9 (261) -.
With the continuous development of human society, it is a necessary trend that renewable energy replaces non-renewable fossil energy. Obtaining mutator of high-yield alkane gene by using a qualitative evolution method through biological engineering and genetic modification technology, and constructing a high-yield alkane strain. Can reduce the production cost by improving the biological oil production yield, has important significance for realizing the industrialization of producing alkane by blue algae, solves the energy crisis for human beings and provides inexhaustible novel clean energy.
Disclosure of Invention
The invention aims to overcome the defects of the prior art and solve the technical problems that the yield of biologically produced alkane based on wild type hydrocarbon producing genes is low and the industrialization requirement is difficult to meet.
The invention is realized by the following technical scheme: a key alkane-producing gene mutant derived from blue algae, wherein the gene has a nucleotide sequence shown in SEQ ID NO: 1, or a nucleotide sequence corresponding to the nucleotide sequence shown as SEQ ID NO: 1, or a nucleotide sequence complementary to the nucleotide sequence shown in 1. The amino acid sequence coded by the nucleotide sequence is shown as SEQ ID NO: 2, respectively.
The invention also discloses a recombinant vector containing the alkane-producing key gene mutant derived from the blue-green algae, namely the recombinant vector obtained after mutation.
Preferably, the recombinant vector is derived from pEASY-1594-1711.
The invention also discloses a method for obtaining hydrocarbon-producing gene mutant by using plasmid pEASY-1594-1711 constructed by wild type paraffin-producing key gene from blue-green algae as a template, which comprises the following steps:
(1) taking a wild-type pEASY-1594-1711 plasmid as a template, and using primers SEQ ID NO: 12 and SEQ ID NO: 13, carrying out error-prone PCR on a key hydrocarbon production gene npun _ R1711, and introducing two enzyme cutting sites of EcoRI and SalI;
(2) carrying out double enzyme digestion on the purified error-prone PCR product by EcoRI and SalI, and connecting the error-prone PCR product with pEASY-1594-one 1711 which is also subjected to double enzyme digestion treatment at 16 ℃ for overnight;
(3) the ligation product was electrically transformed and introduced into E.coli DH5. alpha. competent cells (purchased from TaKaRa, Cat. 9057) to obtain a library of random mutants containing a key gene for hydrocarbon production.
Preferably, the error-prone PCR reaction procedure is: pre-denaturation at 94 deg.C for 3min, denaturation at 94 deg.C for 30s, annealing at 65 deg.C for 45s, extension at 72 deg.C for 1.5min, 25 cycles, further extension at 72 deg.C for 5min, and storing at 4 deg.C for use.
Preferably, the ligation system is performed with a molar ratio of insert to vector of 3:1, or 50ng vector and 25ng fragment per 100ul ligation system is added and ligation is performed at 16 ℃ for 5 hours.
The invention also discloses an engineering bacterium, which contains a recombinant vector of the alkane-producing key gene mutant from the blue-green algae; the gene has the sequence shown in SEQ ID NO: 1, or a nucleotide sequence corresponding to the nucleotide sequence shown as SEQ ID NO: 1, or a nucleotide sequence complementary to the nucleotide sequence shown in 1.
The invention also provides an application of the engineering bacteria containing the recombinant vector in biological alkane production. The engineering bacteria are prokaryotic expression host Trans BL21(DE3) (purchased from TRANSGEN corporation, goods number CD601) containing the recombinant vector, can be directly used as bacterial alkane-producing strains, and specifically comprises the following culture steps:
(1) activating engineering bacteria prior to an LB flat plate containing kanamycin, then inoculating the engineering bacteria into 5mL of LB liquid culture medium containing kanamycin, and culturing overnight at 37 ℃ and 200rpm to obtain initial bacterial liquid;
(2) and (3) mixing the initial bacterial liquid obtained in the step (1) according to the ratio of 1: 100 were inoculated in modified M9 liquid medium containing kanamycin and cultured at 30 ℃ at 200 rpm;
(3) after culturing for 7 hours in the step (2), adding 0.5M inducer IPTG, and continuing culturing for 40 hours;
(4) collecting the bacterial liquid obtained in the step (3) to finish the biological production of alkane;
(5) the bacterial liquid is subjected to ultrasonic crushing, and the supernatant is centrifugally collected, so that the yield of alkane in the bacterial liquid can be quantitatively analyzed.
Compared with the prior art, the invention has the following advantages: the hydrocarbon-producing gene is a mutant of a wild hydrocarbon-producing gene derived from blue algae, and the total quantity of the biologically produced alkane of the strain based on the hydrocarbon-producing gene mutant is improved by 2.9 times compared with the wild strain, so that the yield of the biologically produced alkane is improved, the cost of the biologically produced oil is reduced, and the commercialization process of the biologically produced oil is accelerated.
Drawings
FIG. 1 is a plasmid map of a recombinant vector pEASY-1594-1711 containing a mutant of alkane-producing gene;
FIG. 2 is a bar graph of the results of GC-MS analysis of the comparison of the yields of alkane produced by the alkane producing mutant strain and the wild-type strain.
Detailed Description
The following examples are given for the detailed implementation and specific operation of the present invention, but the scope of the present invention is not limited to the following examples.
Example 1
1. Test materials
1) Preparation of LB medium:
LB liquid medium: 10g/L tryptone, 5g/L yeast extract, 10g/L sodium chloride;
LB solid medium: adding 15g of agar into each liter of LB liquid culture medium;
kanamycin-resistant LB solid medium: heating the prepared LB solid culture medium to be completely dissolved, adding kanamycin with the total amount of 2 per mill (v/v) when the temperature is reduced to about 55 ℃, then slowly pouring the kanamycin into a culture dish, and cooling and solidifying for later use.
2) Modified M9 buffer solution, 6g of Na is weighed2HPO43g KH2PO40.5g of NaCl was dissolved and dissolved in 1L of ultrapure water, and sterilized at high temperature and high pressure to obtain solution A. Weighing the rest components, separately sterilizing at high temperature under high pressure or by filtration, and adding the following components into the solution A: 2g/L NH4Cl, 0.25g/L MgSO4ⅹ7H2O, 11mg/L CaCl227mg/L FeCl3ⅹ6H2O, 2mg/L ZnCl x 4H2O, 2mg/L of Na2MoO4ⅹ2H2O, 1.9mg/L CuSO4ⅹ5H2O, 0.5mg/L H3BO31L of modified M9 buffer was prepared by mixing 1mg/L of thiamine, 200mM Bis-Tris (pH 7.25) and 0.1% (v/v) Triton-X100.
Modified kanamycin-resistant M9 buffer liquid medium: kanamycin was added to the prepared modified M9 liquid medium in a total amount of 2 ‰ (v/v).
2. Obtaining hydrocarbon-producing key genes derived from blue-green algae:
1) obtaining of wild type hydrocarbon-producing key gene:
plasmid pAL112 was used as a template, and SEQ ID NO: 3 and SEQ ID NO: 4, obtaining a wild-type hydrocarbon-producing key gene by performing PCR amplification on the primer, wherein the method for obtaining the plasmid pAL112 is disclosed in a paper published in 2013 by Xuefeng Lu et al (Aiqiu, Liu., et al, fat alcohol production in engineered E. coli Marinobacter fat acyl-CoA derivatives, applied Microbiol Biotechnol,97(2013) 7061-7071.).
SEQ ID NO：3：P1：AACCGCTCGAGTGCCATGTCCGGTTTTCAAC；
SEQ ID NO：4：P2：AACCGCTCGAGCGCAAAAAGGCCATCCGTCAGGATG。
2) Construction of wild hydrocarbon-producing key gene recombinant vector
Two key hydrocarbon-producing genes need to be contained simultaneously in bacterial organism for producing the alkane, in order to conveniently research the hydrocarbon-producing genes through error-prone PCR and mutant library construction technology, enzyme cutting sites are respectively added at two ends of two genes, namely orf1594 and npun _ R1711, and two ptrc promoters are used for respectively regulating and controlling the two genes, so that a plasmid pEASY-1594-one 1711 shown in figure 1 is constructed.
(1) Plasmid pAL112 was used as template, and primers SEQ ID NO: 3 and SEQ ID NO: 4 amplifying a fragment containing two hydrocarbon-producing key genes, adding an A into a PCR product, connecting the PCR product with a T vector pEASY-T5, and obtaining a plasmid pEASY-1594-1711-RC through sequencing identification;
(2) plasmid pEASY-1594-: 5 and SEQ ID NO: 6 amplifying the fragment, and then self-connecting the PCR product to obtain a plasmid pEASY-1594-1711-RC-Bgl2 with the introduced restriction enzyme site Bgl II;
(3) plasmid pEASY-1594-1711-RC-Bgl2 is used as a template, and a primer SEQ ID NO: 7 and SEQ ID NO: 8 amplifying the fragment, and then self-connecting the PCR product to obtain a plasmid pEASY-1594-RC-Bgl 2-EcoR1 with an introduced restriction enzyme site EcoRI;
(4) the plasmid pEASY-1594-1711-RC-Bgl2-EcoR1 is taken as a template, and primers SEQ ID NO: 9 and SEQ ID NO: 10 amplifying ptrc promoter and introducing Cla I enzyme cutting site; with primers SEQ ID NO: 5 and SEQ ID NO: 11, amplifying the vector, introducing ClaI restriction sites, and obtaining a plasmid pEASY-1594-1711 shown in figure 1 after double-restriction and ligation of PCR products at two ends.
Table 1: PCR primers of GFP and AID and enzyme cutting sites thereof
3) Directional evolution to obtain hydrocarbon producing gene mutant
Using pEASY-1594-1711 plasmid as a template and a primer pair SEQ ID NO: 12 and SEQ ID NO: 13, carrying out error-prone PCR on the key hydrocarbon-producing gene npun _ R1711, and introducing two enzyme cutting sites of EcoRI and SalI. The purified error-prone PCR product is subjected to double enzyme digestion by EcoRI and SalI, and is connected with pEASY-1594-1711 subjected to the same double enzyme digestion treatment at 16 ℃ overnight. Wherein in the connection system, the mol ratio of the insert to the carrier is 3:1, or adding 50ng of vector and 25ng of fragment into every 100ul of ligation system, and carrying out ligation for 5 hours at 16 ℃; the ligation product was electrically transformed and introduced into e.coli dh5 α competent cells (purchased from TaKaRa, cat # 9057) to obtain a random mutant library.
The primers are shown in table 2 below:
table 2: primer sequence and its enzyme cutting site
The error-prone PCR reaction system is shown in Table 3
TABLE 3
The reaction procedure of the error-prone PCR is as follows: pre-denaturation at 94 deg.C for 3min, denaturation at 94 deg.C for 30s, annealing at 65 deg.C for 45s, extension at 72 deg.C for 1.5min, 25 cycles, further extension at 72 deg.C for 5min, and storing at 4 deg.C for use.
After 10 rounds of passage dilution, evolution and screening, the evolved hydrocarbon-producing gene-containing mutant is finally obtained and transferred into an expression host Trans BL21(DE3) (purchased from TRANSGEN corporation, the commodity number is CD601), namely the evolved bio-alkane-producing engineering bacteria.
3. Biological alkane production experiment of evolved hydrocarbon production gene mutant
1) Respectively inoculating engineering bacteria containing wild plasmids of hydrocarbon-producing genes and engineering bacteria containing mutant plasmids after evolution on LB solid medium plates containing kanamycin resistance, and culturing overnight at 37 ℃;
2) selecting a single colony, inoculating the single colony in 5mL LB liquid culture medium containing kanamycin, and culturing overnight at 37 ℃ and 200rpm to obtain initial bacterial liquid;
3) and (3) mixing the initial bacterial liquid obtained in the step (2) according to the ratio of 1: 100 volume ratio inoculation in containing kanamycin modified M9 liquid medium (100mL system in 250mL conical flask), 30 degrees C, 200rpm culture;
4) step 3), after culturing for 7 hours, adding 0.5M inducer IPTG, and continuing culturing for 40 hours;
5) collecting bacterial liquid to finish the biological production of alkane;
4. GC-MS (gas chromatography-Mass spectrometer) experiment for detecting evolved hydrocarbon-producing gene mutant biological alkane production
1) The bacterial liquid containing alkane is subjected to ultrasonic disruption in an ultrasonic disruptor for 30 minutes (power is 30%, 10s on; 5s off);
2) centrifuging at 5000g for 10 min, and collecting supernatant;
3) adding 2mL of a culture medium containing alkane into 2mL of an ethyl acetate solution containing 7 mu g/mL of eicosane as an internal standard, and uniformly mixing;
4) centrifuging at 5000g for 10 min, collecting the upper solution, and performing GC-MS analysis;
5) simultaneously preparing a mixed alkane standard sample dissolved in ethyl acetate, wherein the concentration of each component is 7 mu g/mL, and performing GC-MS analysis;
the results are shown in figure 2, wt is engineering bacteria containing wild type hydrocarbon-producing gene, M28 is engineering bacteria containing mutant of hydrocarbon-producing gene. As can be seen in the figure, the alkane yield of the key hydrocarbon-producing gene mutant after the evolution is improved by 2.9 times compared with that of the wild type, which shows that the hydrocarbon-producing gene mutant after the evolution improves the alkane yield of organisms. The evolved hydrocarbon-producing gene mutant strain is used for biologically producing alkane, so that the biological oil production cost is expected to be reduced, and the commercialization process of biological oil production is facilitated to be accelerated.
It is noted that, in this document, relational terms such as first and second, and the like, if any, are used solely to distinguish one entity or action from another entity or action without necessarily requiring or implying any actual such relationship or order between such entities or actions. Also, the terms "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process, method, article, or apparatus. Without further limitation, an element defined by the phrase "comprising an … …" does not exclude the presence of other identical elements in a process, method, article, or apparatus that comprises the element.
The above examples are only intended to illustrate the technical solution of the present invention, but not to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some technical features may be equivalently replaced; and such modifications or substitutions do not depart from the spirit and scope of the corresponding technical solutions of the embodiments of the present invention.
SEQUENCE LISTING
<110> institute of science of fertilizer combination and substance science of Chinese academy of sciences
<120> alkane-producing key gene mutant from blue algae and application thereof
<130> 2018
<160> 13
<170> PatentIn version 3.3
<210> 1
<211> 702
<212> DNA
<213> Artificial sequence
<400> 1
atggcacagc agcttacaga ccaatctaaa gaattagatt tcaagagcga aacatacaaa 60
gatgcttata gccggattaa tgcgatcgtg attgaagggg aacaagaagc ccatgaaaat 120
tacatcacac tagcccaact gctgccagaa tctcatgatg aattgattcg cctatccaag 180
atggaaagcc gccataagaa aggatttgaa gcttgtgggc gcaatttagc tgttacccca 240
gatttgcaat ttgccaaaga gtttttctcc ggcctacacc aaaattttca aacagctgcc 300
gcagaaggga aagtggttac ttgtctgttg attcagtctt taattattga atgttttgcg 360
atcgcagcat ataacattta catccccgtt gccgacgatt tcgcccgtaa aattactgaa 420
ggagtagtta aagaagaata cagccacctc aattttggag aagtttggtt gaaagaacac 480
tttgcaggat ccaaagctga acttgaactt gcaaatcgcc agaacctacc catcgtctgg 540
aaaatgctca accaagaaga aggtgatgcc cacacaatgg caatggaaaa agatgctttg 600
gtagaagact tcatgattca gtatggtgaa gcattgagta acattggttt ttcgactcgc 660
gatattatgc gcttgtcagc ctacggactc ataggtgctt aa 702
<210> 2
<211> 233
<212> PRT
<213> Artificial sequence
<400> 2
Met Ala Gln Gln Leu Thr Asp Gln Ser Lys Glu Leu Asp Phe Lys Ser
1 5 10 15
Glu Thr Tyr Lys Asp Ala Tyr Ser Arg Ile Asn Ala Ile Val Ile Glu
20 25 30
Gly Glu Gln Glu Ala His Glu Asn Tyr Ile Thr Leu Ala Gln Leu Leu
35 40 45
Pro Glu Ser His Asp Glu Leu Ile Arg Leu Ser Lys Met Glu Ser Arg
50 55 60
His Lys Lys Gly Phe Glu Ala Cys Gly Arg Asn Leu Ala Val Thr Pro
65 70 75 80
Asp Leu Gln Phe Ala Lys Glu Phe Phe Ser Gly Leu His Gln Asn Phe
85 90 95
Gln Thr Ala Ala Ala Glu Gly Lys Val Val Thr Cys Leu Leu Ile Gln
100 105 110
Ser Leu Ile Ile Glu Cys Phe Ala Ile Ala Ala Tyr Asn Ile Tyr Ile
115 120 125
Pro Val Ala Asp Asp Phe Ala Arg Lys Ile Thr Glu Gly Val Val Lys
130 135 140
Glu Glu Tyr Ser His Leu Asn Phe Gly Glu Val Trp Leu Lys Glu His
145 150 155 160
Phe Ala Gly Ser Lys Ala Glu Leu Glu Leu Ala Asn Arg Gln Asn Leu
165 170 175
Pro Ile Val Trp Lys Met Leu Asn Gln Glu Glu Gly Asp Ala His Thr
180 185 190
Met Ala Met Glu Lys Asp Ala Leu Val Glu Asp Phe Met Ile Gln Tyr
195 200 205
Gly Glu Ala Leu Ser Asn Ile Gly Phe Ser Thr Arg Asp Ile Met Arg
210 215 220
Leu Ser Ala Tyr Gly Leu Ile Gly Ala
225 230
<210> 3
<211> 31
<212> DNA
<213> Artificial sequence
<400> 3
aaccgctcga gtgccatgtc cggttttcaa c 31
<210> 4
<211> 36
<212> DNA
<213> Artificial sequence
<400> 4
aaccgctcga gcgcaaaaag gccatccgtc aggatg 36
<210> 5
<211> 34
<212> DNA
<213> Artificial sequence
<400> 5
cagaccagat ctatggcatt cggtcttatc ggtc 34
<210> 6
<211> 32
<212> DNA
<213> Artificial sequence
<400> 6
caacgcagat ctcgtaatag cgaagaggcc cg 32
<210> 7
<211> 33
<212> DNA
<213> Artificial sequence
<400> 7
cagaccgaat tcatggcaca gcagcttaca gac 33
<210> 8
<211> 33
<212> DNA
<213> Artificial sequence
<400> 8
cagaccgaat tcatggcaca gcagcttaca gac 33
<210> 9
<211> 35
<212> DNA
<213> Artificial sequence
<400> 9
cagaccagat ctggtctgtt tcctgtgtga aattg 35
<210> 10
<211> 33
<212> DNA
<213> Artificial sequence
<400> 10
caacgcatcg attcaaggcg cactcccgtt ctg 33
<210> 11
<211> 34
<212> DNA
<213> Artificial sequence
<400> 11
caacgcatcg atagcgaaga ggcccgcacc gatc 34
<210> 12
<211> 26
<212> DNA
<213> Artificial sequence
<400> 12
caggaaacag accgaattca tggcac 26
<210> 13
<211> 24
<212> DNA
<213> Artificial sequence
<400> 13
gcatgcctgc aggtcgactt aagc 24
Claims (7)
1. The alkane-producing key gene mutant is derived from blue-green algae, and is characterized in that the nucleotide sequence of the alkane-producing key gene mutant is shown as SEQ ID NO: 1, or a sequence as shown in SEQ ID NO: 1 is complementary to the nucleotide sequence shown in the figure.
2. The alkane-producing key gene mutant derived from cyanobacteria of claim 1, wherein the amino acid sequence encoded by the nucleotide sequence of the alkane-producing key gene mutant is as shown in SEQ ID NO: 2, respectively.
3. A recombinant vector containing the alkane-producing key gene mutant derived from cyanobacteria as claimed in claim 1.
4. The recombinant vector containing the alkane-producing key gene mutant derived from cyanobacteria as claimed in claim 3, wherein the recombinant vector is pEASY-1594-1711.
5. An engineered bacterium comprising the recombinant vector of claim 3.
6. The use of the engineered bacterium of claim 5 in the biological production of alkanes.
7. Use according to claim 6, characterized in that:
the method comprises the following steps:
(1) activating engineering bacteria prior to an LB flat plate containing kanamycin, then inoculating the engineering bacteria into 5mL of LB liquid culture medium containing kanamycin, and culturing overnight at 37 ℃ and 200rpm to obtain initial bacterial liquid;
(2) the initial bacterial liquid is prepared according to the following steps of 1: 100 volume ratio in containing kanamycin M9 liquid medium, at 30 degrees C, 200rpm culture;
(3) after culturing for 7 hours, adding 0.5M inducer IPTG, and continuing culturing for 40 hours;
(4) and collecting bacterial liquid to finish the biological alkane production.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811481544.9A CN109486835B (en) | 2018-12-05 | 2018-12-05 | Alkane-producing key gene mutant from blue-green algae and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811481544.9A CN109486835B (en) | 2018-12-05 | 2018-12-05 | Alkane-producing key gene mutant from blue-green algae and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109486835A CN109486835A (en) | 2019-03-19 |
| CN109486835B true CN109486835B (en) | 2022-02-11 |
Family
ID=65699394
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811481544.9A Active CN109486835B (en) | 2018-12-05 | 2018-12-05 | Alkane-producing key gene mutant from blue-green algae and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109486835B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114107285B (en) * | 2021-12-04 | 2023-09-08 | 安徽大学 | Method for producing long-chain alkane by utilizing alkane sensor evolution hydrocarbon enzyme |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102027109A (en) * | 2008-05-16 | 2011-04-20 | Ls9公司 | Methods and compositions for producing hydrocarbons |
| CN104004790A (en) * | 2013-12-23 | 2014-08-27 | 北京化工大学 | Method for producing medium-chain alkanes |
| CN105802983A (en) * | 2016-03-28 | 2016-07-27 | 中国科学院青岛生物能源与过程研究所 | High-flux screening method of aliphatic hydrocarbon generation gene, obtained mutant and application |
-
2018
- 2018-12-05 CN CN201811481544.9A patent/CN109486835B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102027109A (en) * | 2008-05-16 | 2011-04-20 | Ls9公司 | Methods and compositions for producing hydrocarbons |
| CN105112455A (en) * | 2008-05-16 | 2015-12-02 | Reg生命科学有限责任公司 | Methods and compositions for producing hydrocarbons |
| CN104004790A (en) * | 2013-12-23 | 2014-08-27 | 北京化工大学 | Method for producing medium-chain alkanes |
| CN105802983A (en) * | 2016-03-28 | 2016-07-27 | 中国科学院青岛生物能源与过程研究所 | High-flux screening method of aliphatic hydrocarbon generation gene, obtained mutant and application |
Non-Patent Citations (4)
| Title |
|---|
| Enhancing Alkane Production in Cyanobacterial Lipid Droplets: A Model Platform for Industrially Relevant Compound Production;A. Peramuna等;《Life》;20150326;第5卷;第1111-1126页 * |
| Nostoc punctiforme PCC 73102, complete genome-CP001037.1;NCBI;《GenBank》;20140128;第1-5页 * |
| 利用双报道基因筛选系统改造产烃基因工程细菌;岳海兵等;《生物物理学报》;20141031;第30卷(第6期);第424-432页 * |
| 微生物法生产烷烃研究进展;苏绍洁等;《工业微生物》;20170222;第47卷(第1期);第56-64页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109486835A (en) | 2019-03-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Amer et al. | Low carbon strategies for sustainable bio-alkane gas production and renewable energy | |
| Farrokh et al. | Cyanobacteria as an eco‐friendly resource for biofuel production: a critical review | |
| Shahid et al. | Bioenergy potential of the residual microalgal biomass produced in city wastewater assessed through pyrolysis, kinetics and thermodynamics study to design algal biorefinery | |
| Brentner et al. | Challenges in developing biohydrogen as a sustainable energy source: implications for a research agenda | |
| Sarsekeyeva et al. | Cyanofuels: biofuels from cyanobacteria. Reality and perspectives | |
| Gao et al. | Photosynthetic production of ethanol from carbon dioxide in genetically engineered cyanobacteria | |
| Deenanath et al. | The bioethanol industry in Sub-Saharan Africa: history, challenges, and prospects | |
| Li et al. | Large‐scale biodiesel production from microalga Chlorella protothecoides through heterotrophic cultivation in bioreactors | |
| EP1979481B1 (en) | Methods and compositions for ethanol producing cyanobacteria | |
| RU2723620C2 (en) | System, methods and compositions for bioprocessing | |
| JP2010525816A (en) | Direct conversion of carbon dioxide to hydrocarbons using metabolically modified photosynthetic microorganisms | |
| Wang et al. | Characterization and robust nature of newly isolated oleaginous marine yeast Rhodosporidium spp. from coastal water of Northern China | |
| CN101748069B (en) | Recombinant blue-green algae | |
| Tan et al. | Design and optimization of bioreactor to boost carbon dioxide assimilation in RuBisCo-equipped Escherichia coli | |
| CN109486835B (en) | Alkane-producing key gene mutant from blue-green algae and application thereof | |
| Wang et al. | ASI: Dunaliella marine microalgae to drop‐in replacement liquid transportation fuel | |
| Leite et al. | Engineered cyanobacteria: research and application in bioenergy | |
| Sharma et al. | The economics of cyanobacteria‐based biofuel production: challenges and opportunities | |
| Das et al. | Production of biofuel from genetically modified microalgal biomass and its effects on environment and public health | |
| CN101372669B (en) | Cyanobacteria modified by gene engineering and use thereof for producing ethanol | |
| Hnain et al. | Microbiological processes for waste conversion to bioenergy products: Approaches and directions | |
| CN107400673B (en) | Synechocystis PCC6803 mutant strain and application thereof | |
| Verma et al. | Biomass, bioenergy, and biofuels | |
| CN114107285B (en) | Method for producing long-chain alkane by utilizing alkane sensor evolution hydrocarbon enzyme | |
| CN114015634B (en) | Recombinant escherichia coli for high yield of succinic acid and construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |