CN109486835A

CN109486835A - It is a kind of derived from the production alkane key gene muton of cyanobacteria and its application

Info

Publication number: CN109486835A
Application number: CN201811481544.9A
Authority: CN
Inventors: 李鹿之; 陈少鹏; 吴李君
Original assignee: Hefei Institutes of Physical Science of CAS
Current assignee: Hefei Institutes of Physical Science of CAS
Priority date: 2018-12-05
Filing date: 2018-12-05
Publication date: 2019-03-19
Anticipated expiration: 2038-12-05
Also published as: CN109486835B

Abstract

The present invention discloses a kind of production alkane key gene muton derived from cyanobacteria, and the gene has the nucleotide sequence as shown in SEQ ID NO:1, or the nucleotide sequence complementary with such as nucleotide sequence shown in SEQ ID NO:1.The method and application for producing hydrocarbon key gene muton are obtained as template invention additionally discloses a kind of plasmid pEASY-1594-1711 that the wild type using derived from cyanobacteria produces the building of alkane key gene.The hydrocarbon-producing genes are derived from the muton of the wild type hydrocarbon-producing genes of cyanobacteria, the biological production alkane total amount of bacterial strain based on the hydrocarbon-producing genes muton improves 2.9 times compared with wild type, to improve biological production alkane yield, reduce biological oil-producing cost, the commercialization process of biological oil-producing is helped speed up.

Description

It is a kind of derived from the production alkane key gene muton of cyanobacteria and its application

Technical field

The present invention relates to the field of biological energy source of genetic engineering, more particularly to are a kind of production alkane key bases derived from cyanobacteria Because of muton and its application.

Background technique

Surge with global economy rapid growth to energy demand, the fossil fuel resources such as petroleum are constantly reduced, and companion It increasingly increases sharply with environmental problem caused by combustion of fossil fuel, the development of recyclable organism fuel gradually causes the attention of people (G.Stephanopoulos,Challenges in enginerrting microbes forbiofuels production, Science 315(2007)801-804).Bioenergy can be relieved its further research as a kind of reproducible energy It is even final to eliminate energy crisis.

Alkane as gasoline, diesel oil, aviation kerosine main ingredient, biological production alkane closer to existing fossil come Source diesel oil is very ideal substitute of diesel fuel.Hydrocarbon is widespread in nature, and many biologies include plant, algae, fungi Hydrocarbon can be produced.For example, induction biosynthesis wax to be to prevent water point evaporation, insect is generated with hydrocarbon pheromones as main component, It generates in photosynthetic cyanobacteria with heptadecane hydrocarbon hydrocarbon (M.Dennis, P.E.Kolattukudy, Acobalt- as main component porphyrin enzyme converts a fatty aldehyde to a hydrocarbon and CO,Proceeding ofthe Natioanl Academy of Sciences 89(1992)5306-5310；Mata TM,Martins AA, Caetano NS.Microalgae for biodiesel production and other applications:A review,Renewable and Sustainable Energy Reviews 14(2010)217-32)。

Cyanobacteria oil-producing has more ideal development prospect compared to the oil plant crops more early studied and forest etc..Cyanobacteria Be one kind be able to carry out plant type produce the photosynthetic prokaryotic micro-organisms of oxygen, as energy microflora of new generation its have with Lower advantage: (1) solar energy, fixed carbon dioxide are absorbed as carbon source for growth, toxigenic capacity is low, vitality is strong；(2) genetic manipulation Simply, genetic modification can be carried out；(3) unit biomass contained energy is higher；(4) it can be grown in fresh water, seawater or sewage, no It fights for soil and water source, effect on environment is minimum (5).Human society needs renewable energy to take eventually to sustainable development For non-renewable fossil energy.On the one hand on the other hand cyanobacteria generation diesel oil can exist directly using sunlight as the energy Produce the fixed CO of process of biodiesel₂As carbon source, greenhouse effects can be alleviated.Therefore cyanobacteria generation diesel oil not only can be with Alleviating energy crisis, and environmental pollution can be alleviated.

Although cyanobacteria generation diesel oil has many big advantages, industrialization process is carried out slowly always.Cyanobacteria Bioenergy is limited in development by several factors, such as expensive bioreactor, the cost of incubation, higher richness Collection expense lacks the standard method etc. of algae culture and bio-fuel production.High production cost is algae generation bavin Primary bottleneck problem (V.L.Colin, A.Rodrfguez, H.A.Cristobal, The the role of that oil is faced synthetic biology in the design ofmicrobial cell factories for biofuel production,Journal ofBiomedicine and Biotechnology 2011(2011)1-9).So grinding at present The hot spot studied carefully is to filter out the cyanobacteria of high oil-producing, shortens the incubation time of cyanobacteria, and simplified culture condition reduces cyanobacteria generation The cost of the energy.

In recent years, with the development of synthetic biology and metabolic engineering, people utilize science of heredity, zymetology and metabolic engineering hand Section obtains many progress by the yield that transformation microbial metabolism approach improves aliphatic hydrocarbon in cyanobacteria.Tan etc. is in cyanobacteria Overexpression ACC to improve the content of intracellular acyl ACP, by cyanobacteria aliphatic hydrocarbon output increased 50% (X.Tan, L.Yao,Q.Gao,et al.Photosynthesis driven conversion of carbon dioxide to fatty alcohols and hydrocarbons in cyanobacteria,Metabolic Engineering 13(2011)169- 176).Wang etc. in wild type DNC wireless by being overexpressed two copy acyl ACP reductase genes and fatty aldehyde Deformylase monooxygenase gene, make the yield of aliphatic hydrocarbon than wild type improve 8 times (W.Wang, X.Liu, X.Lu, Engineering cyanobacteria to improve photosynthetic production of alkanes, Biotechnology forBiofuels 6(2013)69)

The method for improving paraffin production in cyanobacteria at present is mainly to be realized by transformation microbial metabolism approach, this Evolvement method is although motivated, feasibility is high, but requires Evolutionary Design thinking high and can not be to being short in understanding Object is transformed, using being limited by very large, and mutation cyanobacteria bacterial strain alkane production efficiency obtained still without Method meets the requirement of modernization business application.Directed evolution technologies do not need the molecular mechanism and structure that accurately understand object to be evolved Functional relationship, but by introducing random mutation and recombination, the diversity muton being not present originally is artificially produced, and press According to specifically needing to impose selection pressure, the muton with desired character is filtered out, realizes the Simulating Evolution of molecular level, into Change more targeted and possesses better application value (W.Johannes Tyler and H.M.Zhao, Directed evolution of enzymes and biosynthetic pathways,Current Opinion in Microbiology 9(2006)261-267)。

With the sustainable development of human society, renewable energy replaces non-renewable fossil energy to be inexorable trend.It is logical Cross bioengineering and genetic engineering techniques, using qualitative evolution means obtain high yield alkyl because muton, construct high yield alkane Hydrocarbon bacterial strain.Production cost can be reduced, is had to the industrialization that realization cyanobacteria produces alkane important by improving biological production oil yield Meaning, and solve energy crisis and to provide inexhaustible new cleaning fuel for the mankind.

Summary of the invention

It is an object of the invention to overcome the deficiencies in the prior art, to solve the existing life based on wild type hydrocarbon-producing genes Produce paraffin production is lower, is difficult to meet the insufficient technical problem of industrialization demand.

The present invention is achieved by the following technical solutions: a kind of production alkane key gene muton derived from cyanobacteria, institute Gene is stated with the nucleotide sequence as shown in SEQ ID NO:1, or with as nucleotide sequence shown in SEQ ID NO:1 it is complementary Nucleotide sequence.The nucleotide sequence coded amino acid sequence is as shown in SEQ ID NO:2.

It is invention additionally discloses a kind of recombinant vector containing the above-mentioned production alkane key gene muton derived from cyanobacteria, i.e., prominent The recombinant vector obtained after change.

Preferably, the recombinant vector derives from pEASY-1594-1711.

Invention additionally discloses a kind of plasmid pEASY-1594- to produce the building of alkane key gene derived from the wild type of cyanobacteria 1711 methods for obtaining hydrocarbon-producing genes muton for template, comprising the following steps:

(1) using the pEASY-1594-1711 plasmid of wild type as template, primer SEQ ID NO:12 and SEQ ID are used NO:13 carries out fallibility PCR to hydrocarbon key gene npun_R1711 is produced, and introduces I two restriction enzyme sites of EcoR I and Sal；

(2) by fallibility PCR product after purification pass through I double digestion of EcoR I and Sal, with also pass through double digestion processing PEASY-1594-1711 is stayed overnight in 16 DEG C of connections；

(3) connection product imports E.coliDH5 α competent cell and (is purchased from TaKaRa company, article No. through electrotransformation 9057) it, obtains containing the random mutant libraries for producing hydrocarbon key gene.

Preferably, the response procedures of the fallibility PCR are as follows: 94 DEG C of initial denaturation 3min, 94 DEG C of denaturation 30s, 65 DEG C are annealed 45s, 72 DEG C of extension 1.5min after 25 circulations, then continue after extending 5min at 72 DEG C, are placed at 4 DEG C and save backup.

Preferably, in linked system, the molar ratio of Insert Fragment and carrier is 3:1, or adds in every 100ul linked system Enter 50ng carrier and 25ng segment, connection reaction condition is 16 DEG C and connects 5 hours.

Invention additionally discloses a kind of engineering bacteria, the engineering bacteria contains the production alkane key gene muton derived from cyanobacteria Recombinant vector；The gene have the nucleotide sequence as shown in SEQ ID NO:1, or with the core as shown in SEQ ID NO:1 The nucleotide sequence of nucleotide sequence complementation.

The present invention also provides a kind of application of engineering bacteria containing above-mentioned recombinant vector in biological production alkane.The work Journey bacterium is that the prokaryotic expression host Trans BL21 (DE3) containing the recombinant vector (is purchased from TRANSGEN company, article No. CD601), which can produce alkane bacterial strain directly as bacterium, and specific incubation step includes:

(1) engineering bacteria is activated prior to LB plate containing kanamycin, it is containing kanamycin is then inoculated in 5mL LB liquid medium in, be incubated overnight under 37 DEG C, 200rpm, obtain starting bacterium solution；

(2) the starting bacterium solution of step (1) is inoculated in by 1:100 with improvement M9 fluid nutrient medium containing kanamycin In, it is cultivated under 30 DEG C, 200rpm；

(3) by after culture 7 hours of step (2), the inducer IPTG of 0.5M is added, is cultivated for 40 hours；

(4) bacterium solution of step (3) is collected, that is, completes biological production alkane；

(5) by bacterium solution ultrasonication, and supernatant is collected by centrifugation, quantitative analysis can be carried out to wherein paraffin production.

The present invention has the advantage that the hydrocarbon-producing genes are derived from the wild type hydrocarbon-producing genes of cyanobacteria compared with prior art Muton, the biological production alkane total amount of the bacterial strain based on the hydrocarbon-producing genes muton improves 2.9 times compared with wild type, thus It improves biological production alkane yield, reduce biological oil-producing cost, help speed up the commercialization process of biological oil-producing.

Detailed description of the invention

Fig. 1 is the plasmid map containing production alkyl because of the recombinant vector pEASY-1594-1711 of muton；

Fig. 2 is that GC-MS analysis produces alkyl because of the yield comparison knot of muton bacterial strain and wild-type strain biological production alkane Fruit column diagram.

Specific embodiment

It elaborates below to the embodiment of the present invention, the present embodiment carries out under the premise of the technical scheme of the present invention Implement, the detailed implementation method and specific operation process are given, but protection scope of the present invention is not limited to following implementation Example.

Embodiment 1

1, test material

1) preparation of LB culture medium:

LB liquid medium: 10g/L tryptone, 5g/L yeast extract, 10g/L sodium chloride；

LB solid medium: agar 15g is added in every liter of LB liquid medium；

The LB solid medium of kalamycin resistance: the heating of configured LB solid medium is completely dissolved, to temperature 55 DEG C or so the kanamycins that total amount 2 ‰ (v/v) is added are down to, are then slowly poured into culture dish, cooled and solidified is spare.

2) it improves M9 buffer: weighing the Na of 6g₂HPO₄, 3g KH₂PO₄, 0.5g Nacl dissolution and constant volume it is ultrapure in 1L In water, autoclave sterilization obtains A liquid.Remaining ingredient individually high temperature and pressure or filtration sterilization are weighed, and is added in A liquid Following components: the NH of 2g/L₄The MgSO of Cl, 0.25g/L₄ⅹ7H₂O, the CaCl of 11mg/L₂, 27mg/L FeCl₃ⅹ6H₂O、 The ZnCl X 4H of 2mg/L₂O, the Na of 2mg/L₂MoO₄ⅹ2H₂O, the CuSO of 1.9mg/L₄ⅹ5H₂O, the H of 0.5mg/L₃BO₃、1mg/L Thiamine, 200mM Bis-Tris (PH 7.25) and 0.1% (v/v) Triton-X100, be mixedly configured into 1L jointly Improvement M9 buffer.

The improvement M9 buffer liq culture medium of kalamycin resistance: it is added in configured improvement M9 fluid nutrient medium The kanamycins of total amount 2 ‰ (v/v).

2, derived from the acquisition of the production hydrocarbon key gene of cyanobacteria:

1) wild type produces the acquisition of hydrocarbon key gene:

Using plasmid pAL112 as template, PCR amplification is done with primer described in SEQ ID NO:3 and SEQ ID NO:4, is obtained Wild type produces hydrocarbon key gene, the opinion that the preparation method of the plasmid pAL112 was delivered referring to Xuefeng Lu et al. in 2013 Text (Aiqiu, Liu., et al., Fatty alcohol production in engineered E.coli Marinobacter fatty acyl-CoA reductases,Appl Microbiol Biotechnol,97(2013) 7061-7071.)。

SEQ ID NO:3:P1:AACCGCTCGAGTGCCATGTCCGGTTTTCAAC；

SEQ ID NO:4:P2:AACCGCTCGAGCGCAAAAAGGCCATCCGTCAGGATG.

2) wild type produces the building of hydrocarbon key gene recombinant vector

Bacterium living beings produce alkane and need while including two crucial hydrocarbon-producing genes, for convenience of fallibility PCR and mutant is passed through Library database technology studies hydrocarbon-producing genes, need to add respectively at two genes, that is, both ends orf1594 and npun_R1711 Restriction enzyme site, and they are regulated and controled respectively using two ptrc promoters, construct plasmid pEASY- as shown in Figure 1 1594-1711。

(1) using plasmid pAL112 as template, using primer SEQ ID NO:3 and SEQ ID NO:4 amplification containing there are two produce The segment of hydrocarbon key gene is connected into carrier T pEASY-T5 after PCR product is then added " A ", identifies through sequencing, obtains plasmid pEASY-1594-1711-RC；

(2) using plasmid pEASY-1594-1711-RC as template, both ends has been used to have the primer of II restriction enzyme site of Bgl SEQ ID NO:5 and SEQ ID NO:6 amplified fragments, then by PCR product from connecting, acquisition introduces restriction enzyme site Bgl's II Plasmid pEASY-1594-1711-RC-Bgl2；

(3) using plasmid pEASY-1594-1711-RC-Bgl2 as template, used both ends with I restriction enzyme site of EcoR Primer SEQ ID NO:7 and SEQ ID NO:8 amplified fragments, then by PCR product from connecting, acquisition introduces restriction enzyme site EcoR I plasmid pEASY-1594-1711-RC-Bgl2-EcoR1；

(4) using plasmid pEASY-1594-1711-RC-Bgl2-EcoR1 as template, respectively with primer SEQ ID NO:9 and SEQ ID NO:10 expands ptrc promoter, and introduces I restriction enzyme site of Cla；With primer SEQ ID NO:5 and SEQ ID NO:11 Amplification vector, and I restriction enzyme site of Cla is introduced, by obtaining matter as shown in Figure 1 by both ends PCR product double digestion and after connecting Grain pEASY-1594-1711.

The PCR primer and its restriction enzyme site of table 1:GFP and AID

3) directed evolution obtains hydrocarbon-producing genes muton

Using pEASY-1594-1711 plasmid as template, using primer pair SEQ ID NO:12 and SEQ ID NO:13 to production Hydrocarbon key gene npun_R1711 carries out fallibility PCR, and introduces I two restriction enzyme sites of EcoR I and Sal.By fallibility after purification PCR product passes through I double digestion of EcoR I and Sal, connect with the pEASY-1594-1711 by the processing of same double digestion in 16 DEG C Overnight.Wherein in linked system, the molar ratio of Insert Fragment and carrier is 3:1, or 50ng is added in every 100ul linked system Carrier and 25ng segment, connection reaction condition are 16 DEG C and connect 5 hours；Connection product imports E.coliDH5 α through electrotransformation Competent cell (is purchased from TaKaRa company, article No. 9057), obtains random mutant libraries.

The primer is as shown in table 2 below:

Table 2: primer sequence and its restriction enzyme site

The reaction system of the fallibility PCR, is shown in Table 3

Table 3

The response procedures of the fallibility PCR are as follows: 94 DEG C of initial denaturation 3min, 94 DEG C of denaturation 30s, 65 DEG C of annealing 45s, 72 DEG C are prolonged It stretches 1.5min, after 25 circulations, then continues after extending 5min at 72 DEG C, be placed at 4 DEG C and save backup.

The passage dilution taken turns by 10, which is evolved, screens, and contains hydrocarbon-producing genes muton after finally being evolved, by its turn Entering expressive host Trans BL21 (DE3) (being purchased from TRANSGEN company, article No. CD601) is the biological production alkane work after evolving Journey bacterium.

3, the hydrocarbon-producing genes muton biological production alkane experiment after evolving

1) by the engineering bacteria containing muton plasmid after the engineering bacteria containing hydrocarbon-producing genes wild plasmid and evolution point It is not inoculated in the LB solid medium tablets containing kalamycin resistance, 37 DEG C of overnight incubations；

2) picking single colonie is inoculated in 5mL LB liquid medium containing kanamycin, and at 37 DEG C, 200rpm was descended Night culture obtains starting bacterium solution；

3) the starting bacterium solution of step (2) is inoculated in by 1:100 volume ratio and is trained with improvement M9 liquid containing kanamycin It supports in base (100mL system is in 250mL conical flask), is cultivated under 30 DEG C, 200rpm；

4) after step 3) is cultivated 7 hours, the inducer IPTG of 0.5M is added, is cultivated for 40 hours；

5) bacterium solution is collected, that is, completes biological production alkane；

4, the hydrocarbon-producing genes muton biological production alkane experiment after GC-MS detection is evolved

1) bacterium solution containing alkane is subjected to ultrasonication 30 minutes (power 30%, 10s in Ultrasonic Cell Disruptor；5s off)；

2) 5000g is centrifuged 10 minutes, collects supernatant；

3) culture medium for taking 2mL to contain alkane is added 2mL and contains 7 μ g/mL icosane hydrocarbon as interior target ethyl acetate Solution is uniformly mixed；

4) it is centrifuged 10 minutes in 5000g, collects upper solution, carry out GC-MS analysis；

5) the alkane mixed sample for being dissolved in ethyl acetate that each component concentration is 7 μ g/mL is configured simultaneously, carries out GC-MS Analysis；

As a result as shown in Fig. 2, wt is the engineering bacteria containing wild type hydrocarbon-producing genes, and M28 is to be mutated containing hydrocarbon-producing genes The engineering bacteria of son.As can be seen that the paraffin production of the production hydrocarbon key gene muton after evolving has 2.9 times compared with wild type in figure Promotion, illustrate evolve after hydrocarbon-producing genes muton improve biological production alkane yield.It is mutated with the hydrocarbon-producing genes after evolving Daughter bacteria strain carries out biological production alkane, is expected to reduce biological oil-producing cost, helps speed up the commercialization process of biological oil-producing.

It should be noted that, in this document, such as first and second or the like relational terms are used merely to one if it exists A entity or operation with another entity or operate distinguish, without necessarily requiring or implying these entities or operation it Between there are any actual relationship or orders.Moreover, the terms "include", "comprise" or its any other variant are intended to Cover non-exclusive inclusion, so that the process, method, article or equipment for including a series of elements not only includes those Element, but also including other elements that are not explicitly listed, or further include for this process, method, article or setting Standby intrinsic element.In the absence of more restrictions, the element limited by sentence "including a ...", it is not excluded that There is also other identical elements in the process, method, article or apparatus that includes the element.

The above embodiments are merely illustrative of the technical solutions of the present invention, rather than its limitations；Although with reference to the foregoing embodiments Invention is explained in detail, those skilled in the art should understand that: it still can be to aforementioned each implementation Technical solution documented by example is modified or equivalent replacement of some of the technical features；And these modification or Replacement, the spirit and scope for technical solution of various embodiments of the present invention that it does not separate the essence of the corresponding technical solution.

SEQUENCE LISTING

<110>Hefei Institutes of Physical Science, Chinese Academy of Sciences

<120>a kind of derived from the production alkane key gene muton of cyanobacteria and its application

<130> 2018

<160> 13

<170> PatentIn version 3.3

<210> 1

<211> 702

<212> DNA

<213>artificial sequence

<400> 1

atggcacagc agcttacaga ccaatctaaa gaattagatt tcaagagcga aacatacaaa 60

gatgcttata gccggattaa tgcgatcgtg attgaagggg aacaagaagc ccatgaaaat 120

tacatcacac tagcccaact gctgccagaa tctcatgatg aattgattcg cctatccaag 180

atggaaagcc gccataagaa aggatttgaa gcttgtgggc gcaatttagc tgttacccca 240

gatttgcaat ttgccaaaga gtttttctcc ggcctacacc aaaattttca aacagctgcc 300

gcagaaggga aagtggttac ttgtctgttg attcagtctt taattattga atgttttgcg 360

atcgcagcat ataacattta catccccgtt gccgacgatt tcgcccgtaa aattactgaa 420

ggagtagtta aagaagaata cagccacctc aattttggag aagtttggtt gaaagaacac 480

tttgcaggat ccaaagctga acttgaactt gcaaatcgcc agaacctacc catcgtctgg 540

aaaatgctca accaagaaga aggtgatgcc cacacaatgg caatggaaaa agatgctttg 600

gtagaagact tcatgattca gtatggtgaa gcattgagta acattggttt ttcgactcgc 660

gatattatgc gcttgtcagc ctacggactc ataggtgctt aa 702

<210> 2

<211> 233

<212> PRT

<213>artificial sequence

<400> 2

Met Ala Gln Gln Leu Thr Asp Gln Ser Lys Glu Leu Asp Phe Lys Ser

1 5 10 15

Glu Thr Tyr Lys Asp Ala Tyr Ser Arg Ile Asn Ala Ile Val Ile Glu

20 25 30

Gly Glu Gln Glu Ala His Glu Asn Tyr Ile Thr Leu Ala Gln Leu Leu

35 40 45

Pro Glu Ser His Asp Glu Leu Ile Arg Leu Ser Lys Met Glu Ser Arg

50 55 60

His Lys Lys Gly Phe Glu Ala Cys Gly Arg Asn Leu Ala Val Thr Pro

65 70 75 80

Asp Leu Gln Phe Ala Lys Glu Phe Phe Ser Gly Leu His Gln Asn Phe

85 90 95

Gln Thr Ala Ala Ala Glu Gly Lys Val Val Thr Cys Leu Leu Ile Gln

100 105 110

Ser Leu Ile Ile Glu Cys Phe Ala Ile Ala Ala Tyr Asn Ile Tyr Ile

115 120 125

Pro Val Ala Asp Asp Phe Ala Arg Lys Ile Thr Glu Gly Val Val Lys

130 135 140

Glu Glu Tyr Ser His Leu Asn Phe Gly Glu Val Trp Leu Lys Glu His

145 150 155 160

Phe Ala Gly Ser Lys Ala Glu Leu Glu Leu Ala Asn Arg Gln Asn Leu

165 170 175

Pro Ile Val Trp Lys Met Leu Asn Gln Glu Glu Gly Asp Ala His Thr

180 185 190

Met Ala Met Glu Lys Asp Ala Leu Val Glu Asp Phe Met Ile Gln Tyr

195 200 205

Gly Glu Ala Leu Ser Asn Ile Gly Phe Ser Thr Arg Asp Ile Met Arg

210 215 220

Leu Ser Ala Tyr Gly Leu Ile Gly Ala

225 230

<210> 3

<211> 31

<212> DNA

<213>artificial sequence

<400> 3

aaccgctcga gtgccatgtc cggttttcaa c 31

<210> 4

<211> 36

<212> DNA

<213>artificial sequence

<400> 4

aaccgctcga gcgcaaaaag gccatccgtc aggatg 36

<210> 5

<211> 34

<212> DNA

<213>artificial sequence

<400> 5

cagaccagat ctatggcatt cggtcttatc ggtc 34

<210> 6

<211> 32

<212> DNA

<213>artificial sequence

<400> 6

caacgcagat ctcgtaatag cgaagaggcc cg 32

<210> 7

<211> 33

<212> DNA

<213>artificial sequence

<400> 7

cagaccgaat tcatggcaca gcagcttaca gac 33

<210> 8

<211> 33

<212> DNA

<213>artificial sequence

<400> 8

cagaccgaat tcatggcaca gcagcttaca gac 33

<210> 9

<211> 35

<212> DNA

<213>artificial sequence

<400> 9

cagaccagat ctggtctgtt tcctgtgtga aattg 35

<210> 10

<211> 33

<212> DNA

<213>artificial sequence

<400> 10

caacgcatcg attcaaggcg cactcccgtt ctg 33

<210> 11

<211> 34

<212> DNA

<213>artificial sequence

<400> 11

caacgcatcg atagcgaaga ggcccgcacc gatc 34

<210> 12

<211> 26

<212> DNA

<213>artificial sequence

<400> 12

caggaaacag accgaattca tggcac 26

<210> 13

<211> 24

<212> DNA

<213>artificial sequence

<400> 13

gcatgcctgc aggtcgactt aagc 24

Claims

1. a kind of production alkane key gene muton derived from cyanobacteria, which is characterized in that the gene has such as SEQ ID NO:1 Shown in nucleotide sequence, or the nucleotide sequence complementary with such as nucleotide sequence shown in SEQ ID NO:1.

2. being derived from the production alkane key gene muton of cyanobacteria according to claim 1, which is characterized in that the nucleotides sequence The amino acid sequence of coding is arranged as shown in SEQ ID NO:2.

3. a kind of recombinant vector containing the production alkane key gene muton as described in claim 1 derived from cyanobacteria.

4. the recombinant vector according to claim 3 containing the production alkane key gene muton derived from cyanobacteria, feature It is, the recombinant vector is pEASY-1594-1711.

5. a kind of plasmid pEASY-1594-1711 that the wild type using derived from cyanobacteria produces the building of alkane key gene is obtained as template The method of hydrocarbon-producing genes muton, which comprises the following steps:

(1) using the pEASY-1594-1711 plasmid of wild type as template, using primer pair produce hydrocarbon key gene npun_R1711 into Row fallibility PCR, and introduce I two restriction enzyme sites of EcoR I and Sal；

(3) connection product imports E.coli DH5 α competent cell through electrotransformation, obtains containing the random of production hydrocarbon key gene Mutant library.

6. the plasmid pEASY- according to claim 5 to produce the building of alkane key gene derived from the wild type of cyanobacteria 1594-1711 is the method that template obtains hydrocarbon-producing genes muton, which is characterized in that the response procedures of the fallibility PCR are as follows: 94 DEG C initial denaturation 3min, 94 DEG C of denaturation 30s, 65 DEG C of annealing 45s, 72 DEG C of extension 1.5min after 25 circulations, then continue at 72 DEG C After extending 5min, it is placed at 4 DEG C and saves backup.

7. the plasmid pEASY- according to claim 5 to produce the building of alkane key gene derived from the wild type of cyanobacteria 1594-1711 is the method that template obtains hydrocarbon-producing genes muton, which is characterized in that in linked system, Insert Fragment and carrier Molar ratio be 3:1, or 50ng carrier and 25ng segment are added in every 100ul linked system, connection reaction condition is 16 DEG C connection 5 hours.

8. a kind of engineering bacteria, which is characterized in that the engineering bacteria contains the weight of the production alkane key gene muton derived from cyanobacteria Group carrier；The gene have the nucleotide sequence as shown in SEQ ID NO:1, or with the nucleosides as shown in SEQ ID NO:1 The nucleotide sequence of sequence complementary.

9. a kind of application using engineering bacteria as claimed in claim 8 in biological production alkane.

10. application of the engineering bacteria according to claim 9 in biological production alkane, it is characterised in that:

The following steps are included:

(1) engineering bacteria is activated prior to LB plate containing kanamycin, is then inoculated in 5mL LB containing kanamycin It in fluid nutrient medium, is incubated overnight under 37 DEG C, 200rpm, obtains starting bacterium solution；

(2) starting bacterium solution is inoculated in by 1:100 volume ratio in M9 fluid nutrient medium containing kanamycin, in 30 DEG C, It is cultivated under 200rpm；

(3) after cultivating 7 hours, the inducer IPTG of 0.5M is added, is cultivated for 40 hours；

(4) bacterium solution is collected, i.e. completion biological production alkane.