CN109486775A - Fungal enzyme of gasifiable oil content and preparation method thereof and application method in a kind of raising crude oil - Google Patents
Fungal enzyme of gasifiable oil content and preparation method thereof and application method in a kind of raising crude oil Download PDFInfo
- Publication number
- CN109486775A CN109486775A CN201811416137.XA CN201811416137A CN109486775A CN 109486775 A CN109486775 A CN 109486775A CN 201811416137 A CN201811416137 A CN 201811416137A CN 109486775 A CN109486775 A CN 109486775A
- Authority
- CN
- China
- Prior art keywords
- crude oil
- oil
- gasifiable
- enzyme
- fungal enzyme
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 239000010779 crude oil Substances 0.000 title claims abstract description 110
- 102000004190 Enzymes Human genes 0.000 title claims abstract description 92
- 108090000790 Enzymes Proteins 0.000 title claims abstract description 92
- 238000000034 method Methods 0.000 title claims abstract description 77
- 239000003921 oil Substances 0.000 title claims abstract description 55
- 230000002538 fungal effect Effects 0.000 title claims abstract description 53
- 238000002360 preparation method Methods 0.000 title claims abstract description 36
- 241000233866 Fungi Species 0.000 claims abstract description 27
- 239000007788 liquid Substances 0.000 claims abstract description 23
- 239000001963 growth medium Substances 0.000 claims abstract description 16
- 238000009938 salting Methods 0.000 claims abstract description 14
- 238000006073 displacement reaction Methods 0.000 claims abstract description 11
- 238000004519 manufacturing process Methods 0.000 claims abstract description 8
- 235000015099 wheat brans Nutrition 0.000 claims abstract description 8
- 239000002994 raw material Substances 0.000 claims abstract description 4
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 claims description 14
- 230000007071 enzymatic hydrolysis Effects 0.000 claims description 12
- 238000006047 enzymatic hydrolysis reaction Methods 0.000 claims description 12
- FGIUAXJPYTZDNR-UHFFFAOYSA-N potassium nitrate Chemical compound [K+].[O-][N+]([O-])=O FGIUAXJPYTZDNR-UHFFFAOYSA-N 0.000 claims description 12
- 230000010355 oscillation Effects 0.000 claims description 9
- CSNNHWWHGAXBCP-UHFFFAOYSA-L Magnesium sulfate Chemical compound [Mg+2].[O-][S+2]([O-])([O-])[O-] CSNNHWWHGAXBCP-UHFFFAOYSA-L 0.000 claims description 6
- 238000002386 leaching Methods 0.000 claims description 6
- 229910000402 monopotassium phosphate Inorganic materials 0.000 claims description 6
- 235000019796 monopotassium phosphate Nutrition 0.000 claims description 6
- PJNZPQUBCPKICU-UHFFFAOYSA-N phosphoric acid;potassium Chemical compound [K].OP(O)(O)=O PJNZPQUBCPKICU-UHFFFAOYSA-N 0.000 claims description 6
- 235000010333 potassium nitrate Nutrition 0.000 claims description 6
- 239000004323 potassium nitrate Substances 0.000 claims description 6
- 241000750638 Aspergillus spelunceus Species 0.000 claims description 5
- 241001277988 Aspergillus sydowii Species 0.000 claims description 5
- 241000913229 Lecanicillium aphanocladii Species 0.000 claims description 5
- 238000001035 drying Methods 0.000 claims description 5
- 230000004913 activation Effects 0.000 claims description 4
- 241000894006 Bacteria Species 0.000 claims description 3
- 239000003365 glass fiber Substances 0.000 claims description 3
- 239000002054 inoculum Substances 0.000 claims description 3
- 238000013327 media filtration Methods 0.000 claims description 3
- 241000228212 Aspergillus Species 0.000 claims description 2
- 238000012549 training Methods 0.000 claims description 2
- 230000002255 enzymatic effect Effects 0.000 abstract description 55
- 238000006243 chemical reaction Methods 0.000 abstract description 54
- 230000015556 catabolic process Effects 0.000 abstract description 25
- 238000006731 degradation reaction Methods 0.000 abstract description 25
- 229930195734 saturated hydrocarbon Natural products 0.000 abstract description 21
- 150000004945 aromatic hydrocarbons Chemical class 0.000 abstract description 16
- 239000002283 diesel fuel Substances 0.000 abstract description 11
- 239000003502 gasoline Substances 0.000 abstract description 11
- 150000003384 small molecules Chemical class 0.000 abstract description 8
- 238000009835 boiling Methods 0.000 abstract description 7
- 238000007670 refining Methods 0.000 abstract description 5
- 230000009466 transformation Effects 0.000 abstract description 5
- 238000013461 design Methods 0.000 abstract description 4
- 239000003245 coal Substances 0.000 abstract description 3
- 230000010354 integration Effects 0.000 abstract description 2
- 230000000694 effects Effects 0.000 description 14
- 239000011521 glass Substances 0.000 description 14
- 101710088194 Dehydrogenase Proteins 0.000 description 11
- 239000000047 product Substances 0.000 description 10
- VLKZOEOYAKHREP-UHFFFAOYSA-N n-Hexane Chemical compound CCCCCC VLKZOEOYAKHREP-UHFFFAOYSA-N 0.000 description 9
- 239000000470 constituent Substances 0.000 description 8
- 239000003350 kerosene Substances 0.000 description 8
- 239000010426 asphalt Substances 0.000 description 7
- 230000000875 corresponding effect Effects 0.000 description 7
- 238000012545 processing Methods 0.000 description 7
- VZGDMQKNWNREIO-UHFFFAOYSA-N tetrachloromethane Chemical compound ClC(Cl)(Cl)Cl VZGDMQKNWNREIO-UHFFFAOYSA-N 0.000 description 6
- 238000007667 floating Methods 0.000 description 5
- 238000005259 measurement Methods 0.000 description 5
- 239000000203 mixture Substances 0.000 description 5
- 230000008569 process Effects 0.000 description 5
- 238000004064 recycling Methods 0.000 description 5
- PNEYBMLMFCGWSK-UHFFFAOYSA-N Alumina Chemical compound [O-2].[O-2].[O-2].[Al+3].[Al+3] PNEYBMLMFCGWSK-UHFFFAOYSA-N 0.000 description 4
- 240000006439 Aspergillus oryzae Species 0.000 description 4
- 235000002247 Aspergillus oryzae Nutrition 0.000 description 4
- 241000196324 Embryophyta Species 0.000 description 4
- 239000007789 gas Substances 0.000 description 4
- 230000014759 maintenance of location Effects 0.000 description 4
- 238000005303 weighing Methods 0.000 description 4
- 230000003321 amplification Effects 0.000 description 3
- 239000004615 ingredient Substances 0.000 description 3
- 230000006799 invasive growth in response to glucose limitation Effects 0.000 description 3
- 238000003199 nucleic acid amplification method Methods 0.000 description 3
- 238000000926 separation method Methods 0.000 description 3
- 238000010129 solution processing Methods 0.000 description 3
- RTAQQCXQSZGOHL-UHFFFAOYSA-N Titanium Chemical compound [Ti] RTAQQCXQSZGOHL-UHFFFAOYSA-N 0.000 description 2
- 230000002776 aggregation Effects 0.000 description 2
- 238000004220 aggregation Methods 0.000 description 2
- 230000008901 benefit Effects 0.000 description 2
- 238000004364 calculation method Methods 0.000 description 2
- 230000008859 change Effects 0.000 description 2
- 239000000084 colloidal system Substances 0.000 description 2
- 238000004440 column chromatography Methods 0.000 description 2
- 230000002596 correlated effect Effects 0.000 description 2
- 238000005516 engineering process Methods 0.000 description 2
- 239000007791 liquid phase Substances 0.000 description 2
- 239000000463 material Substances 0.000 description 2
- 230000007246 mechanism Effects 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 239000012074 organic phase Substances 0.000 description 2
- 239000003208 petroleum Substances 0.000 description 2
- 239000012071 phase Substances 0.000 description 2
- 239000000843 powder Substances 0.000 description 2
- 238000011160 research Methods 0.000 description 2
- 239000011347 resin Substances 0.000 description 2
- 229920005989 resin Polymers 0.000 description 2
- 230000001954 sterilising effect Effects 0.000 description 2
- 239000000126 substance Substances 0.000 description 2
- 238000012360 testing method Methods 0.000 description 2
- 239000010936 titanium Substances 0.000 description 2
- 229910052719 titanium Inorganic materials 0.000 description 2
- 241000228257 Aspergillus sp. Species 0.000 description 1
- OKTJSMMVPCPJKN-UHFFFAOYSA-N Carbon Chemical compound [C] OKTJSMMVPCPJKN-UHFFFAOYSA-N 0.000 description 1
- 239000004215 Carbon black (E152) Substances 0.000 description 1
- 229920000742 Cotton Polymers 0.000 description 1
- 241000589517 Pseudomonas aeruginosa Species 0.000 description 1
- 238000012300 Sequence Analysis Methods 0.000 description 1
- 238000010521 absorption reaction Methods 0.000 description 1
- 238000007605 air drying Methods 0.000 description 1
- 150000001335 aliphatic alkanes Chemical class 0.000 description 1
- 239000004411 aluminium Substances 0.000 description 1
- 229910052782 aluminium Inorganic materials 0.000 description 1
- XAGFODPZIPBFFR-UHFFFAOYSA-N aluminium Chemical compound [Al] XAGFODPZIPBFFR-UHFFFAOYSA-N 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 230000001580 bacterial effect Effects 0.000 description 1
- 238000005842 biochemical reaction Methods 0.000 description 1
- 229920001222 biopolymer Polymers 0.000 description 1
- 239000008280 blood Substances 0.000 description 1
- 210000004369 blood Anatomy 0.000 description 1
- 229910052799 carbon Inorganic materials 0.000 description 1
- 239000003795 chemical substances by application Substances 0.000 description 1
- 150000001875 compounds Chemical class 0.000 description 1
- 238000002591 computed tomography Methods 0.000 description 1
- 238000012790 confirmation Methods 0.000 description 1
- NWFNSTOSIVLCJA-UHFFFAOYSA-L copper;diacetate;hydrate Chemical compound O.[Cu+2].CC([O-])=O.CC([O-])=O NWFNSTOSIVLCJA-UHFFFAOYSA-L 0.000 description 1
- 238000010219 correlation analysis Methods 0.000 description 1
- 230000007423 decrease Effects 0.000 description 1
- 238000003795 desorption Methods 0.000 description 1
- 238000006477 desulfuration reaction Methods 0.000 description 1
- 230000023556 desulfurization Effects 0.000 description 1
- 238000004090 dissolution Methods 0.000 description 1
- 239000012153 distilled water Substances 0.000 description 1
- 238000009826 distribution Methods 0.000 description 1
- 230000002708 enhancing effect Effects 0.000 description 1
- 229910052564 epsomite Inorganic materials 0.000 description 1
- 239000000706 filtrate Substances 0.000 description 1
- 238000002309 gasification Methods 0.000 description 1
- 239000003292 glue Substances 0.000 description 1
- 229930195733 hydrocarbon Natural products 0.000 description 1
- 150000002430 hydrocarbons Chemical class 0.000 description 1
- 229910052739 hydrogen Inorganic materials 0.000 description 1
- 239000001257 hydrogen Substances 0.000 description 1
- 230000001678 irradiating effect Effects 0.000 description 1
- 238000002955 isolation Methods 0.000 description 1
- 229920002521 macromolecule Polymers 0.000 description 1
- 239000002609 medium Substances 0.000 description 1
- 230000000813 microbial effect Effects 0.000 description 1
- 244000005700 microbiome Species 0.000 description 1
- 230000000877 morphologic effect Effects 0.000 description 1
- 238000011392 neighbor-joining method Methods 0.000 description 1
- 239000012188 paraffin wax Substances 0.000 description 1
- 230000035515 penetration Effects 0.000 description 1
- 238000007781 pre-processing Methods 0.000 description 1
- 239000002244 precipitate Substances 0.000 description 1
- 230000001376 precipitating effect Effects 0.000 description 1
- 238000004321 preservation Methods 0.000 description 1
- 108090000623 proteins and genes Proteins 0.000 description 1
- 102000004169 proteins and genes Human genes 0.000 description 1
- 150000003839 salts Chemical class 0.000 description 1
- 238000012216 screening Methods 0.000 description 1
- 239000002689 soil Substances 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P5/00—Preparation of hydrocarbons or halogenated hydrocarbons
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P5/00—Preparation of hydrocarbons or halogenated hydrocarbons
- C12P5/002—Preparation of hydrocarbons or halogenated hydrocarbons cyclic
- C12P5/005—Preparation of hydrocarbons or halogenated hydrocarbons cyclic aromatic
Abstract
It include following raw material the invention discloses fungal enzyme of gasifiable oil content in a kind of raising crude oil and preparation method thereof and application method, the fungal enzyme: displacement of reservoir oil fungi and culture medium；Wherein, the culture medium includes wheat bran, salting liquid and crude oil.The present invention carries out enzymatic conversion method to crude oil using the fungal enzyme, can be the gasifiable component of small molecule by the high molecular component Degradation and Transformation in crude oil including asphalitine, significantly improve saturated hydrocarbons and aromatic hydrocarbon content in crude oil enzymatic conversion method product；Preparation method is simple, implementation easy to operate, the present invention can for using fungal enzyme improve crude quality theories integration be provided, while also for using fungi enzymatic conversion method raising crude refining when gasoline and low boiling point coal production of diesel oil technological design scientific basis is provided.
Description
Technical field
The present invention relates to microorganisms technical fields, and in particular to it is a kind of improve crude oil in gasifiable oil content fungal enzyme and
Preparation method and application method.
Background technique
Gasoline, kerosene and diesel oil are the annoying carburetion in crude oil, and main component is saturated hydrocarbons and partial aromatic hydrocarbon, boiling
Journey is respectively 34 DEG C -205 DEG C, 180 DEG C -310 DEG C and 180 DEG C -370 DEG C.Annoying carburetion in the present invention refers in crude oil at 230 DEG C
When gasifiable gasoline and part low boiling is lighted kerosene and diesel oil.Gasoline, kerosene and diesel oil are the blood of industry and transportation,
It is closely bound up with human lives.Under conditions of petroleum resources are increasingly depleted, crude oil utilization rate is improved, is that solution petroleum resources are short
One of scarce important channel.If the high molecular component in crude oil can be converted to the gasifiable component of small molecule, so that it may improve former
Oil refining when gasoline and part low boiling is lighted kerosene and production of diesel oil, and then improve crude oil resource utilization and economic benefit.
Biological enzyme is the protein for being catalyzed various biochemical reactions.Enzyme is applied to by Harris and McKay proposal
Crude oil and gas industry desulfurization and biopolymer preprocessing process.Recent studies have found that fungi ectoenzyme is in normal temperature and pressure
Under the conditions of, it can be small molecule by macromolecules degradations such as asphalitine, paraffin in crude oil, Crude viscosity is greatly lowered.But fungi
Can the conversion ratio that macromolecular components in crude oil are degraded to the gasifiable component of small molecule by enzyme be unclear, by heavys such as asphalitines
Component is converted into saturated hydrocarbons subject to confirmation.
Summary of the invention
Aiming at the problems existing in the prior art, the purpose of the present invention is to provide annoying carburetion in a kind of raising crude oil to contain
Fungal enzyme of amount and preparation method thereof and application method carry out enzymatic conversion method to crude oil using the fungal enzyme, can will wrap in crude oil
The high molecular component Degradation and Transformation included including asphalitine is the gasifiable component of small molecule, is significantly improved in crude oil enzymatic conversion method product
Saturated hydrocarbons and aromatic hydrocarbon content；Preparation method is simple, implementation easy to operate, and the present invention can be that fungal enzyme is utilized to improve crude quality
Theories integration is provided, while being also gasoline and low boiling point coal production of diesel oil technique when fungi enzymatic conversion method being utilized to improve crude refining
Design provides scientific basis.
In order to achieve the above object, the present invention is achieved by the following scheme.
(1) a kind of fungal enzyme for improving gasifiable oil content in crude oil, including following raw material: displacement of reservoir oil fungi and producing enzyme training
Support base；Wherein, the culture medium includes wheat bran, salting liquid and crude oil.
Preferably, the displacement of reservoir oil fungi includes Aspergillus oryzae Z3, Aspergillus spelunceus
Z05, Aphanocladium aranearum Z06 or Aspergillus sydowii Z10.
Preferably, the inoculum concentration of the displacement of reservoir oil fungi is 0.1%-0.5%.
Preferably, the salting liquid includes potassium nitrate, potassium dihydrogen phosphate, anhydrous magnesium sulfate and water.
Preferably, the culture medium includes wheat bran 7-13 parts, 5-11 parts of salting liquid and 0.5-2.0 parts of crude oil.
Preferably, the salting liquid includes potassium nitrate 2-8 parts, 0.2-2 parts of potassium dihydrogen phosphate, anhydrous magnesium sulfate 0.1-0.9
Part and 1000 parts of water.
(2) a kind of preparation method for improving the fungal enzyme of gasifiable oil content in crude oil, comprising the following steps:
Step 1, potassium nitrate, potassium dihydrogen phosphate, anhydrous magnesium sulfate and water are mixed, obtains salting liquid；
Step 2, the salting liquid is uniformly mixed with wheat bran, crude oil, sterilizes, obtains culture medium；
Step 3, displacement of reservoir oil fungi is inoculated in the culture medium, culture to white hypha is covered with culture medium table
Face and when there is spore, takes out culture, dries, crush, obtain fungal enzyme.
Preferably, in step 2, the temperature of the sterilizing is 121 DEG C, and the time of sterilizing is 60min.
Preferably, in step 3, the temperature of the culture is 28-30 DEG C.
Preferably, in step 3, the temperature of the drying is 40-45 DEG C, and the time of drying is 36-72 hours.
Preferably, described to crush to be crushed to 20-100 mesh in step 3.
(3) a kind of application method for improving the fungal enzyme of gasifiable oil content in crude oil, comprising the following steps:
Step 1, water is added into fungal enzyme, shaking table oscillation uses glass fibre for media filtration residue, obtains Fungous Enzyme Preparation
Activate leaching liquor；
Step 2, the Fungous Enzyme Preparation activation leaching liquor, enzymatic hydrolysis are added into crude oil.
Preferably, in step 1, the temperature of the shaking table oscillation is 28-30 DEG C, and the revolving speed of shaking table oscillation is 100-120r/
Min, the time of shaking table oscillation are 12-18h.
Preferably, in step 2, the concentration of the Fungous Enzyme Preparation is 14-20g/L.
Preferably, in step 2, the temperature of the enzymatic hydrolysis is 37-42 DEG C, and the time of enzymatic hydrolysis is 2-5d.
Compared with prior art, the invention has the benefit that
The present invention identifies 4 plants of oil degradation fungies, has studied 4 fungal strain enzyme preparation enzymatic conversion methods to crude oil race
The influence of composition and 230 DEG C of gasifiable components, and enzymolysis of the fungal enzyme to asphalitine is demonstrated with pitch matter.As a result table
It is bright, enzymatic conversion method is carried out using Fungous Enzyme Preparation, can be by the high molecular component Degradation and Transformation in crude oil including asphalitine
The gasifiable component of small molecule significantly improves saturated hydrocarbons and aromatic hydrocarbon content in crude oil enzymatic conversion method product, thus deduces, to crude oil
Enzymatic conversion method is carried out, the yield of the gasifiable oil ingredient such as gasoline, kerosene and diesel oil, is also demonstrate,proved when being remarkably improved crude oil following process
It is theoretically feasible for being illustrated through gasifiable oil content in fungi enzymatic conversion method raising crude oil, it is shown that Fungous Enzyme Preparation exists
There is important commercial application potentiality in crude oil enzymatic conversion method.
Detailed description of the invention
The present invention is described in further details in the following with reference to the drawings and specific embodiments.
Fig. 1 is the colony morphology characteristic of 4 fungal strains；
Fig. 2 is the conidium micro-morphology of 4 fungal strains；
Fig. 3 is 4 fungal strain phylogenetic trees；
Fig. 4 be enzymatic conversion method after 230 DEG C of gasifiable components and its relative amount, abscissa be retention time, unit is
min；Ordinate is absorption value；Wherein, figure (A) is the 230 DEG C of gasifiable components and its relative amount of the full oil of enzymatic conversion method；Figure
(B) the 230 DEG C of gasifiable components and its relative amount of state crude oil are floated for enzymatic conversion method；
Fig. 5 is that 4 fungal strains act on distribution and form of the asphalitine on slide after asphalitine slide；Wherein, a, b, c in figure
Respectively amplify 2,20,40 times of figures, black portions are asphalitine in figure, and white portion is the speculum for losing asphalitine.
Specific embodiment
Embodiment of the present invention is described in detail below in conjunction with embodiment, but those skilled in the art will
It will be appreciated that the following example is merely to illustrate the present invention, and it is not construed as limiting the scope of the invention.
1 materials and methods
1.1 material
(1) for trying strain: totally 4 plants, Z3 is Aspergillus oryzae, and the accession number on Genbank is
KT189153 is preserved in China typical culture collection center on December 30th, 2016, and deposit number is CCTCC NO:
M2016789, preservation address are Wuhan, China university；Z05 is Aspergillus spelunceus, the login on Genbank
Number be KT189154；Z06 is Aphanocladium aranearum, and the accession number on Genbank is KT189155；Z10 is
Aspergillus sydowii, the accession number on Genbank are KT189156.Strains tested is big by northwest agriculture and forestry science and technology
Microbial resources research department separation screening is learned, separation source is that China extends oil field petroleum-contaminated soil, and isolation medium is only with crude oil
One carbon source.
(2) culture medium: in wheat bran: salting liquid: crude oil=10:8:1 ratio mixes well raw material, weighs
Mixture 60g is in 600mL tissue culture flasks, and the 60min that sterilizes under the conditions of 121 DEG C is to get culture medium；Wherein, salt is molten
Liquid includes 5g KNO3、1g KH2PO3、0.5g MgSO4·7H2O, 1000mL water.
(3) pitch matter: weight glue asphalitine, the production of Shaanxi Bao Li asphalitine Co., Ltd, needle penetration are 91 (0.1mm),
Ductility when softening point is 46 DEG C, 10 DEG C, 15 DEG C is respectively 45cm, 102cm.
(4) crude oil: North Shaanxi Province of China extends oil field oil sample, saturated hydrocarbon content 218.9g/kg, aromatic hydrocarbon content 56.0g/
Kg, gum level 34.7g/kg, asphalt content 333.3g/kg, unknown component content are 227.0g/kg；At 37 DEG C
Viscosity 160mPas.
1.2 method
(1) for trying Fungal identification
Colony characteristics are observed, using scanning electric mirror observing cell form, ITS sequence analysis are carried out, according to the sequence of acquisition
Similarity search is carried out in ncbi database Blast program, using the Neighbor-joining method structure of 5.0 software of Mega
Build phylogenetic tree.
(2) preparation of fungi enzymolysis liquid
4 plants of displacement of reservoir oil fungies are respectively connected in culture medium, the inoculum concentration of displacement of reservoir oil fungi is 0.3%, in 28 DEG C of conditions
When lower culture is covered with culture medium surface and spore occur to white hypha, culture is all taken out and is put into baking oven,
It is dried 72 hours under the conditions of 45 DEG C, and is crushed to 90 mesh, obtain the thick enzyme powder of fungal enzyme.
It weighs thick enzyme powder 1.50g to be added in the 250mL triangular flask equipped with 100mL pure water, in 28 DEG C, 120 r/min shaking tables
Middle oscillation 15h makes zymoprotein rehydration post activation；Using 2-3g glass fibre as media filtration residue, gained filtrate is fungal enzyme
Preparation activates leaching liquor.Measuring crude enzyme liquid dehydrogenase activity according to prosperous equal (2016) method of horse is 63.49-80.38U.
(3) influence of the enzymatic conversion method to crude oil chemical constituent
18.00g crude oil is put into 500mL triangular flask, it is 15.0g/L fungal enzyme system that every bottle, which is separately added into 300mL concentration,
Agent activates leaching liquor, and triangular flask is placed in 4 DEG C of refrigerators, to crude oil cooled and solidified at oil after digesting by 37 DEG C of enzymatic hydrolysis 5d
Shell is carefully poured out liquid phase in triangular flask, and is cleaned 3 times with ice pure water, and warm water dissolves oilcan, must digest recycling crude oil, collect to
With.
2.000g enzymatic hydrolysis recycling crude oil is weighed, is dissolved in 35mL n-hexane, stands for 24 hours, 3500r/min is centrifuged 5min, point
It Shou Ji not precipitate and organic liquid phase.Precipitating is placed in drier dry weighing to get asphalt quality.Organic phase uses aluminium oxide
Column chromatography measures race's composition.
Chromatographic column internal oxidition aluminium, absorbent cotton and (NH are recycled after measurement4)2SO4, drying is weighed, after calculating computed tomography
The difference of gross mass and initial mass is in column to get unknown component quality remaining in chromatographic column.The above measurement is repeated 3 times.
Calculate each component quality according to formula (1) and account for the ratio P of crude oil gross mass, according to formula (2) calculate enzymatic conversion method processing each component with compare
The multiplying power n of corresponding constituent content.
By race form in saturated hydrocarbons and aromatic hydrocarbon total content be defined as gasifiable oil content in crude oil；Gasifiable oil content with
The ratio of crude content summation is annoying carburetion proportion in crude oil；By enzymatic conversion method handle in annoying carburetion ratio with
The difference of annoying carburetion ratio is defined as annoying carburetion gaining rate Δ P, calculation formula in crude oil and sees formula (3) in control.
In formula (1): W2And W1Receiving flask and certain component gross mass and empty bottle matter when respectively indicating alumina column chromatography separation
Amount, W0Indicate the sample gross mass that chromatographic column is added.In formula (2): Dt and Dck be respectively enzymatic conversion method processing with compare corresponding to
Each location parameter value.In formula (3): Pa、PbAnd PTotalRespectively indicate saturated hydrocarbons, aromatic hydrocarbon content and each component content summation, T,
CK respectively indicates enzymatic conversion method and handles and compare.
(4) influence of the enzymatic conversion method to 230 DEG C of gasifiable components of crude oil
It converts crude oil A (whole crude oil of recycling, referred to as " full oil "): weighing the enzymatic hydrolysis recycling crude oil in above-mentioned (2)
0.200g is dissolved in 3.5mL n-hexane, with gas chromatograph (model Trace GC Ultra, Thermo Finnigan
Company production) measurement crude oil in 230 DEG C of gasifiable each components peak area, indicate its relative amount with the value.With processing with it is right
The influence taken a picture with the reflection crude enzyme liquid of same component relative amount difference corresponding to retention time to each component content in crude oil, and root
Gaining rate according to formula (4) calculation processing compared with control each component relative amount.
In formula (4): St is respectively to handle and compare corresponding peak area with Sck.
It converts crude oil B (crude oil is desorbed in the filter paper of recycling, because it is in floating state, referred to as " floating oil "): fast qualitative is filtered
Paper is cut into the filter paper of 4.5cm × 4.5cm, and crude oil is adsorbed on filter paper, and the filter paper for having adsorbed crude oil is put into 100mL tri-
In the bottle of angle, 50mL fungi enzyme solution, 37 DEG C of enzymatic hydrolysis 3d are added.After enzymatic hydrolysis, 10mL hexane solution is added into triangular flask, it will
It is careful that upper layer n-hexane phase is sucked out after what crude oil filter paper was desorbed after enzyme solution acts on floats on the crude oil dissolution on liquid level upper layer, it uses
Gas chromatograph for determination floats the relative amount (being indicated with peak area) of 230 DEG C of gasifiable components in crude oil.
(5) influence of the enzymatic conversion method to pitch matter component
Preparation asphalitine solution: 5 drops are added to be dissolved in the asphalitine solution of carbon tetrachloride in the (m that weighed0) on glass slide, turn
Dynamic load slide paves asphalitine solution, volatilizees naturally to carbon tetrachloride, weighing (m after asphalitine is evenly affixed on glass slide1)。
Asphalitine glass slide is set after irradiating 30min under ultraviolet light, is placed horizontally at the 500mL wide mouth glass bottle of the crude enzyme liquid containing 100mL
In, 37 DEG C of enzymatic hydrolysis 35d gently shake 4 times daily.After digesting, asphalitine glass slide is taken out, distilled water softly rinses 3
Secondary, natural air drying weighs asphalitine glass slide quality (m at this time2)；100mL carbon tetrachloride is added into crude enzyme liquid, sufficiently shakes
It is even, organic phase is recycled, weighing (m is evaporated3).Fungi crude enzyme liquid is m to the degradation amount of asphalitine1+m3-m2, by crude enzyme liquid to pitch
The ratio that the degradation amount of matter accounts for initial bitumen matter adhesion amount is defined as asphalitine degradation rate (Asphalt Degradation
Efficiency, ADE%), it is calculated according to formula (5).Enzymatic treatment constituent content is enzymatic treatment times with the ratio between certain constituent content n is compareed
Rate is calculated with formula (2).Titanium miniplate observation method is shown in Gao (2017a) after the degradation of pitch matter, joins to components influence measuring method
It is admitted to the measuring method stated in influence of the enzymatic conversion method to crude oil chemical constituent.
(6) result calculating and data processing
Using SAS 9.2 (SAS Institute Inc, Cary, NC, USA) to all data carry out correlation analysis and
Significance test of difference.
2, test results and analysis
(1) Fungal identification
Colony morphology characteristic and the observation of thallus microscopic morphology: the colonial morphology and conidial fructification microscopic morphology of 4 fungal strains point
Not not as depicted in figs. 1 and 2.By the colony morphology characteristic to bacterial strain, the observation of conidial fructification microscopic morphology, according to Chinese fungi will
Morphologic description (Qi Zutong 1997), Preliminary Identification Z3, Z05 and Z10 are aspergillus (Aspergillus sp.).
Fungi ITS sequence measurement result is as follows:
Z3Aspergillus oryzae strain, accession number KT189153, sequence such as SEQ ID No.1, specifically such as
Under:
GCGAGCCCAACCTCCCACCCGTGTTTACTGTACCTTAGTTGCTTCG GCGGGCCCGCCATTCATGGCC
GCCGGGGGCTCTCAGCCCCGGGCCCGC GCCCGCCGGAGACACCACGAACTCTGTCTGATCTAGTGAAGTCTGAGTT
GATTGTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCC GGCATCGATGAAGAACGCAGCGAAAT
GCGATAACTAGTGTGAATTGCA GAATTCCGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTA TTC
CGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCACGG CTTGTGTGTTGGGTCGTCGTCCCCTCTCC
GGGGGGGACGGGCCCCAAAG GCAGCGGCGGCACCGCGTCCATCCTCGAGCGTATGGGGCTTTGTCACCC GCTCT
GTAGGCCCGGCCGGCGCTTGCCGAACGCAAATCAATCTTTTTCC AGGTTGACCTCGGATCAGGTAGGGATACCCG
CTGAACTTAAGCATATC AAGCCGGAGGAAA。
Z05Aspergillus spelunceus strain, accession number KT189154, sequence such as SEQ ID No.2,
It is specific as follows:
TGACTACCTAACACTGTTGCTTCGGCGGGGAGCGCCCCTCGGGGA GCGAGCCGCCGGGGACCACCGA
ACTTCATGCCTGAGAGTAATGCAGTC TGAGCCTGAATAGTATAATCAGTCAAAACTTTCAACAATGGATCTCTTG
GTTCCGGCATCGATGAAGAACGCAGCGAACTGCGATAAGTAATGTGAA TTGCAGAATTCAGTGAATCATCGAGTC
TTTGAACGCACATTGCGCCCCC TGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAG CCC
GGCTTGTGTGTTGGGTCGTCGTCCCCCCTTCCGGGGAGGGACGGAC CCGAAAGGCAGTGGCGGCACCGTGTCCGG
TCCTCGAGCGTATGGGGCT TTGTCACCCGCTCGACTAGGGCCGGCCGGGCGCCAGCCGGCGTCTCCA ACCATTT
TTTTTTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGA ACTTAAGCATATCAATAAGCGGAG。
Z06Aphanocladium aranearum strain, accession number KT189155, sequence such as SEQ ID No.3,
It is specific as follows:
TGAACATACCACGATGTTGCTTCGGCGGACTCGCCCCGGCGTCCGG ACGGCCTAGCGCCGCCCGCGG
CCCGGATCCAGGCGGCCGCCGGAGACC ACCAAAACTATTTTGTATCAGCAGTTTTTTCTGAATCCGCCGCAAGGCA
AAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATC GATGAAGAACGCAGCGAAATGCGATA
AGTAATGTGAATTGCAGAATTC AGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGG CGG
GCATGCCTGTTCGAGCGTCATTTCAACCCTCGACTTCCCTTTGGGG AAATCGGCGTTGGGGACTGGCAGCATACC
GCCGGCCCCGAAATGGAGT GGCGGCCCGTCCGCGGCGACCTCTGCGTAGTAATCCAACCTCGCACCG GAACCCC
GACGTGGCCACGCCGTAAAACACCCCACTTTCTGAACGTTG ACCTCGGATCAGGTAGGAATACCCGCTGAACTTA
AGCATATCAATAAG CGGA。
Z10Aspergillus sydowii strain, accession number KT189156, sequence such as SEQ ID No.4, specifically
It is as follows:
CCTCCGGGCGCCCAACCTCCCACCCGTGAATACCTAACACTGTTGC TTCGGCGGGGAACCCCCTCGG
GGGCGAGCCGCCGGGGACTACTGAACT TCATGCCTGAGAGTGATGCAGTCTGAGTCTGAATATAAAATCAGTCAA
AACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGC GAACTGCGATAAGTAATGTGAATTGC
AGAATTCAGTGAATCATCGAGT CTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTCC GAG
CGTCATTGCTGCCCATCAAGCCCGGCTTGTGTGTTGGGTCGTCGTC CCCCCCGGGGGACGGGCCCGAAAGGCAGC
GGCGGCACCGTGTCCGGTC CTCGAGCGTATGGGGCTTTGTCACCCGCTCGACTAGGGCCGGCCGGGC GCCAGCC
GACGTCTCCAACCATTTTTCTTCAGGTTGACCTCGGATCAGG TAGGGATACCCGCTGAACTTAAGCATATCAATA
AGCGGAGGAA。
It is determined according to ITS sequence measurement result using the phylogenetic tree (Fig. 3) of 4 fungal strain of MEGA4.0 software building
Z3 is Aspergillus oryzae, and Z05 is Aspergillus spelunceus, Z06 Aphanocladium
Aranearum, Z10 are Aspergillus sydowii.
(2) enzymatic conversion method product of the fungal enzyme to crude oil
2.1 saturated hydrocarbons and aromatic hydrocarbon
Saturated hydrocarbons and aromatic hydrocarbon are the main components of gasoline, kerosene and diesel oil.As can be seen from Table 1, after enzymatic conversion method in crude oil
Saturated hydrocarbons, aromatic hydrocarbon and gum level increase considerably, and 2.2-2.5 times, 1.3-2.1 times respectively compareed and 1.2-1.8
Times, wherein saturated hydrocarbons and aromatic hydrocarbon content reach the level of signifiance (P < 0.05) compared with the amplification of control.It can caused by enzymatic conversion method
The gaining rate that gasification oil (saturated hydrocarbons with aromatic hydrocarbon total content) relatively compares is 30.3%-44.4%, wherein through Fungous Enzyme Preparation Z3 and
Z10 enzymatic conversion method, gasifiable oil content increases separately 44.4% and 42.1% in crude oil.During enzymatic conversion method, asphalitine
And the heavy components contents such as unknown component substantially reduce (P < 0.05), the asphalt content in converted product is only to compare
, unknown component content is about 1/2 compareed.
As can be seen from Table 1,4 fungal strain enzyme preparation enzyme dehydrogenase activities are 63.49U-80.38U；Dehydrogenase activity and enzyme process turn
The saturated hydrocarbon content changed in product is positively correlated (P < 0.01) in significant, is in significant (P < 0.05) or pole with pitch and unknown component
Significantly (P < 0.01) is negatively correlated, shows that the increased saturated hydrocarbons of enzymatic conversion method is derived partly from crude oil studies on asphaltene and unknown component
Degradation.The gaining rate of the annoying carburetion of dehydrogenase activity higher Z3 and Z10 alignment processing is also higher, also reveals that enzyme process turns
Change the causality in product between annoying carburetion increase and dehydrogenase activity.But the phase of dehydrogenase activity and annoying carburetion gaining rate
Closing property is not up to the statistical level of signifiance (P > 0.05).
4 kinds of Contents of Main Components in crude oil after 1 fungal enzyme dehydrogenase activity of table and enzymatic conversion method
In table 1: with significant difference (P < 0.05) between lowercase expression processing different after column data；R is each in crude oil
The related coefficient of constituent content and corresponding crude enzyme preparation dehydrogenase activity, *, * * respectively represent significant related (P < 0.05), extremely show
Related (P < 0.01).
2.2 230 DEG C of gasifiable components
From table 2, Fig. 4 A it is found that in the enzymatic conversion method product for examination crude oil (full oil), 23 230 DEG C of gas are detected altogether
Change component.In the enzymatic conversion method crude oil of Fungous Enzyme Preparation Z05, Z06, the relative amount of 22 components relatively compares significant increase
Adding, average amplification is respectively 59.1%, 76.1%, is shown by enzymatic conversion method, and gasifiable oil content increases considerably in crude oil,
Heavy component in crude oil has been converted into the light components that can gasify at 230 DEG C.The changing effect of remaining two fungal strain enzyme preparation
It is slightly poor.
The relative amount of 230 DEG C of gasifiable components in 2 enzymatic conversion method crude oil of table (full oil)
Found out by Fig. 4 B and table 3, from floating state crude oil (filter paper desorption crude oil) obtained by enzymatic conversion method, detects 14 altogether
230 DEG C of gasifiable components.Wherein, in the floating state crude oil of fungal enzyme Z3, Z06 enzymatic conversion method, retention time 13-31min
The relative amount of 1-11 component increase separately 19.8%-97.4%, 34.3%-113.8% compared with control, show by enzyme
Method converts, and light components content increases in most of 230 DEG C of gasifiable components in crude oil, i.e., the gasifiable oil content in crude oil increases
Add.At the same time, retention time is that the 12-14 component relative amount of 32-35min decreases compared with control.Fungi Z05, Z10
No. 1-7 obtained by enzymatic conversion method, the relative amount of 1-10 component increase separately 8.9%-89.7%, 2.5%- compared with control
82.9%, remaining component relative amount is declined slightly, poor to the enzymatic conversion method effect of crude oil.
230 DEG C of gasifiable component relative amounts in 3 enzymatic conversion method crude oil of table (floating oil)
The enzymatic conversion method product of 2.3 pitch matter
As can be seen from Table 4, being handled by fungi enzyme solution, degradation rate of the 4 fungal strain enzymes to pitch matter on asphalitine glass slide
It is 39.7-61.6 times of control for 9.1%-14.2%, reaches the level of signifiance (P < 0.05) with contrast difference.Wherein Z3 with
Fungal enzyme corresponding to Z10 is best to the degradation effect of pitch matter.It is handled through fungi enzyme solution, saturated hydrocarbon content in pitch matter
It is 1.0-1.2 times of control；Aromatic hydrocarbon, colloid and unknown component content be respectively compare 0.9-1.0 times, 0.2-0.6 times (P <
And 0.4-0.5 times (P < 0.05) 0.05).Annoying carburetion gaining rate is 13.2%-17.5%, wherein fungi corresponding to Z3 and Z10
Enzyme can make gasifiable oil content in pitch matter increase 17.4%-17.5%.
It can be seen from Fig. 5 that handling through fungi enzyme solution, significant changes are had occurred in the titanium miniplate of glass slide attachment asphalitine.Carry glass
When piece amplifies 2 times, the pitch matter of control slide surface attachment is in uniform opaque black, is adhered on enzyme solution processing glass slide
Asphalitine surface there is more speculum, wherein it is more to handle speculum in the asphalitine adhered on glass slide by Z3.Amplification 20
Times when, the only a small amount of small speculum of control, and speculum area is much larger than control in the asphalitine of enzyme solution processing glass slide attachment.
When amplifying 40 times, the asphalitine adhered on control treatment glass slide is in uniform and thin state, is adhered on enzyme solution processing glass slide
Asphalitine is in different degrees of aggregation protuberance state.
Asphalitine degradation rate and asphalitine enzymolysis product race composition after 4 enzymatic conversion method of table
The present invention identifies 4 plants of oil degradation fungies, has studied 4 fungal strain enzyme preparation enzymatic conversion methods to crude oil race
The influence of composition and 230 DEG C of gasifiable components, and enzymolysis of the fungal enzyme to asphalitine is demonstrated with pitch matter.As a result table
It is bright, enzymatic conversion method is carried out using Fungous Enzyme Preparation, can be by the high molecular component Degradation and Transformation in crude oil including asphalitine
The gasifiable component of small molecule significantly improves saturated hydrocarbons and aromatic hydrocarbon content in crude oil enzymatic conversion method product, thus deduces, to crude oil
Enzymatic conversion method is carried out, the yield of the gasifiable oil ingredient such as gasoline, kerosene and diesel oil, is also demonstrate,proved when being remarkably improved crude oil following process
It is theoretically feasible for being illustrated through gasifiable oil content in fungi enzymatic conversion method raising crude oil, it is shown that Fungous Enzyme Preparation exists
There is important commercial application potentiality in crude oil enzymatic conversion method.
The ingredient and design feature of compound, are classified as saturated hydrocarbons, aromatic hydrocarbon, resin and asphalt etc. in based on crude
Component.Resin and asphalt is the maximum component of crude oil middle-molecular-weihydroxyethyl.Structure of asphaltene is complicated, and content is very high in viscous crude, right
The viscosity influence of crude oil is very big, influences crude oil production and utilization.It is recent the study found that pitch matter can be false single by verdigris
Born of the same parents bacterium (Pseudomonas aeruginosa) degradation, degradation rate is up to 10%, but in relation to Fungous Enzyme Preparation to the drop of asphalitine
Solution research is few.
The study find that Fungous Enzyme Preparation has stronger degradation to the asphalitine in crude oil, fungal enzyme Z10 is to original
The degradation rate of oily studies on asphaltene is up to 86.4%.Fungal enzyme also has preferable degradation effect to pitch matter, can increase pitch
Saturated hydrocarbon content in matter catabolite reduces aromatic hydrocarbon, colloid and unknown component content, makes asphalitine by uniform attachment state
Protuberance state of aggregation is changed into, this is degraded to short chain alkanes with long-chain component in asphalitine, and viscosity reduces, and mobility enhancing is related,
The result confirms that Fungous Enzyme Preparation is implicitly present in the degradation of crude oil studies on asphaltene.Fungous Enzyme Preparation is to the strong of asphalitine
Strong degradation is one of gasifiable increased mechanism of oil content in enzymatic conversion method crude oil.The main enzyme system of enzymatic conversion method is de-
Hydrogen enzyme.When using dehydrogenase enzymatic conversion method crude oil, dehydrogenase activity significantly affect saturated hydrocarbons (light components) and asphalitine with not
Main constituent (heavy component) content.In the present invention, between dehydrogenase activity and saturated hydrocarbons and asphalitine and unknown component content
With significant or extremely significant correlation, the mechanism that enzymatic conversion method causes gasifiable hydrocarbon to increase considerably is disclosed: heavy component
Enzymic degradation.
In conclusion the present invention can be by heavys macromolecular groups such as asphalitines in crude oil by Fungous Enzyme Preparation enzymatic conversion method
Dividing Degradation and Transformation is the gasifiable component of small molecule, increases substantially gasifiable constituent content in crude oil, improves crude quality, is improved
Gasoline, low boiling are lighted kerosene and the annoying oil yields such as diesel oil when crude refining, provide reason to improve crude quality using fungal enzyme
By support, gasoline and low boiling point coal production of diesel oil technological design provide scientific basis when improving crude refining for fungi enzymatic conversion method
And feasible technical solution.
Although the present invention is described in detail with a general description of the specific embodiments in this specification,
But on the basis of the present invention, it can be made some modifications or improvements, this will be apparent to those skilled in the art.
Therefore, these modifications or improvements without departing from theon the basis of the spirit of the present invention, belong to claimed model
It encloses.
Sequence table
<110>Xibei Univ. of Agricultural & Forest Science & Technology, Shaanxi Bo Qin bioengineering Co., Ltd
<120>a kind of to improve fungal enzyme of gasifiable oil content and preparation method thereof and application method in crude oil
<130> 2018
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 546
<212> DNA
<213> Aspergillus oryzae strain
<400> 1
gcgagcccaa cctcccaccc gtgtttactg taccttagtt gcttcggcgg gcccgccatt 60
catggccgcc gggggctctc agccccgggc ccgcgcccgc cggagacacc acgaactctg 120
tctgatctag tgaagtctga gttgattgta tcgcaatcag ttaaaacttt caacaatgga 180
tctcttggtt ccggcatcga tgaagaacgc agcgaaatgc gataactagt gtgaattgca 240
gaattccgtg aatcatcgag tctttgaacg cacattgcgc cccctggtat tccggggggc 300
atgcctgtcc gagcgtcatt gctgcccatc aagcacggct tgtgtgttgg gtcgtcgtcc 360
cctctccggg ggggacgggc cccaaaggca gcggcggcac cgcgtccatc ctcgagcgta 420
tggggctttg tcacccgctc tgtaggcccg gccggcgctt gccgaacgca aatcaatctt 480
tttccaggtt gacctcggat caggtaggga tacccgctga acttaagcat atcaagccgg 540
aggaaa 546
<210> 2
<211> 506
<212> DNA
<213> Aspergillus spelunceus strain
<400> 2
tgactaccta acactgttgc ttcggcgggg agcgcccctc ggggagcgag ccgccgggga 60
ccaccgaact tcatgcctga gagtaatgca gtctgagcct gaatagtata atcagtcaaa 120
actttcaaca atggatctct tggttccggc atcgatgaag aacgcagcga actgcgataa 180
gtaatgtgaa ttgcagaatt cagtgaatca tcgagtcttt gaacgcacat tgcgccccct 240
ggcattccgg ggggcatgcc tgtccgagcg tcattgctgc ccatcaagcc cggcttgtgt 300
gttgggtcgt cgtcccccct tccggggagg gacggacccg aaaggcagtg gcggcaccgt 360
gtccggtcct cgagcgtatg gggctttgtc acccgctcga ctagggccgg ccgggcgcca 420
gccggcgtct ccaaccattt ttttttcagg ttgacctcgg atcaggtagg gatacccgct 480
gaacttaagc atatcaataa gcggag 506
<210> 3
<211> 534
<212> DNA
<213> Aphanocladium aranearum strain
<400> 3
tgaacatacc acgatgttgc ttcggcggac tcgccccggc gtccggacgg cctagcgccg 60
cccgcggccc ggatccaggc ggccgccgga gaccaccaaa actattttgt atcagcagtt 120
ttttctgaat ccgccgcaag gcaaaacaaa tgaatcaaaa ctttcaacaa cggatctctt 180
ggttctggca tcgatgaaga acgcagcgaa atgcgataag taatgtgaat tgcagaattc 240
agtgaatcat cgaatctttg aacgcacatt gcgcccgcca gcattctggc gggcatgcct 300
gttcgagcgt catttcaacc ctcgacttcc ctttggggaa atcggcgttg gggactggca 360
gcataccgcc ggccccgaaa tggagtggcg gcccgtccgc ggcgacctct gcgtagtaat 420
ccaacctcgc accggaaccc cgacgtggcc acgccgtaaa acaccccact ttctgaacgt 480
tgacctcgga tcaggtagga atacccgctg aacttaagca tatcaataag cgga 534
<210> 4
<211> 525
<212> DNA
<213> Aspergillus sydowii strain
<400> 4
cctccgggcg cccaacctcc cacccgtgaa tacctaacac tgttgcttcg gcggggaacc 60
ccctcggggg cgagccgccg gggactactg aacttcatgc ctgagagtga tgcagtctga 120
gtctgaatat aaaatcagtc aaaactttca acaatggatc tcttggttcc ggcatcgatg 180
aagaacgcag cgaactgcga taagtaatgt gaattgcaga attcagtgaa tcatcgagtc 240
tttgaacgca cattgcgccc cctggcattc cggggggcat gcctgtccga gcgtcattgc 300
tgcccatcaa gcccggcttg tgtgttgggt cgtcgtcccc cccgggggac gggcccgaaa 360
ggcagcggcg gcaccgtgtc cggtcctcga gcgtatgggg ctttgtcacc cgctcgacta 420
gggccggccg ggcgccagcc gacgtctcca accatttttc ttcaggttga cctcggatca 480
ggtagggata cccgctgaac ttaagcatat caataagcgg aggaa 525
Claims (10)
1. a kind of fungal enzyme for improving gasifiable oil content in crude oil, which is characterized in that including following raw material: displacement of reservoir oil fungi and production
Enzyme culture medium；Wherein, the culture medium includes wheat bran, salting liquid and crude oil.
2. the fungal enzyme according to claim 1 for improving gasifiable oil content in crude oil, which is characterized in that the displacement of reservoir oil is true
Bacterium bag oryzae containing Aspergillus Z3, Aspergillus spelunceus Z05, Aphanocladium
Aranearum Z06 or Aspergillus sydowii Z10.
3. the fungal enzyme according to claim 1 for improving gasifiable oil content in crude oil, which is characterized in that the displacement of reservoir oil is true
The inoculum concentration of bacterium is 0.1%-0.5%.
4. the fungal enzyme according to claim 1 for improving gasifiable oil content in crude oil, which is characterized in that the salting liquid
Include potassium nitrate, potassium dihydrogen phosphate, anhydrous magnesium sulfate and water.
5. the fungal enzyme according to claim 4 for improving gasifiable oil content in crude oil, which is characterized in that the producing enzyme training
It supports base and includes wheat bran 7-13 parts, 5-11 parts of salting liquid and 0.5-2.0 parts of crude oil；Wherein, the salting liquid includes potassium nitrate
2-8 parts, 0.2-2 parts of potassium dihydrogen phosphate, 0.1-0.9 parts of anhydrous magnesium sulfate and 1000 parts of water.
6. a kind of preparation method for improving the fungal enzyme of gasifiable oil content in crude oil, which comprises the following steps:
Step 1, potassium nitrate, potassium dihydrogen phosphate, anhydrous magnesium sulfate and water are mixed, obtains salting liquid；
Step 2, the salting liquid is uniformly mixed with wheat bran, crude oil, sterilizes, obtains culture medium；
Step 3, displacement of reservoir oil fungi is inoculated in the culture medium, culture to white hypha is covered with culture medium surface simultaneously
When there is spore, culture is taken out, is dried, crushes, obtains fungal enzyme.
7. the preparation method according to claim 6 for improving the fungal enzyme of gasifiable oil content in crude oil, which is characterized in that
In step 3, the temperature of the culture is 28-30 DEG C；The temperature of the drying is 40-45 DEG C, and the time of drying is that 36-72 is small
When.
8. a kind of application method for improving the fungal enzyme of gasifiable oil content in crude oil, which comprises the following steps:
Step 1, water is added into fungal enzyme, shaking table oscillation uses glass fibre for media filtration residue, obtains Fungous Enzyme Preparation activation
Leaching liquor；
Step 2, the Fungous Enzyme Preparation activation leaching liquor, enzymatic hydrolysis are added into crude oil.
9. the application method according to claim 8 for improving the fungal enzyme of gasifiable oil content in crude oil, which is characterized in that
In step 1, the temperature of shaking table oscillation is 28-30 DEG C, and the revolving speed of shaking table oscillation is 100-120r/min, shaking table oscillation when
Between be 12-18h.
10. the application method according to claim 8 for improving the fungal enzyme of gasifiable oil content in crude oil, feature exist
In in step 2, the concentration of the Fungous Enzyme Preparation is 14-20g/L；The temperature of the enzymatic hydrolysis is 37-42 DEG C, the time of enzymatic hydrolysis
For 2-5d.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811416137.XA CN109486775B (en) | 2018-11-26 | 2018-11-26 | Fungal enzyme for increasing content of gasifiable oil in crude oil and preparation method and use method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811416137.XA CN109486775B (en) | 2018-11-26 | 2018-11-26 | Fungal enzyme for increasing content of gasifiable oil in crude oil and preparation method and use method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109486775A true CN109486775A (en) | 2019-03-19 |
| CN109486775B CN109486775B (en) | 2024-03-26 |
Family
ID=65696618
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811416137.XA Active CN109486775B (en) | 2018-11-26 | 2018-11-26 | Fungal enzyme for increasing content of gasifiable oil in crude oil and preparation method and use method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109486775B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110438012A (en) * | 2019-08-05 | 2019-11-12 | 四川大学 | It is a kind of produce anthocyanidin aspergillus sydowi H-1 and its application |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4415661A (en) * | 1981-07-30 | 1983-11-15 | Thirumalachar Mandayam J | Microbial degradation of petroleum materials |
| WO1985002197A1 (en) * | 1983-11-14 | 1985-05-23 | Thirumalachar Mandayam J | Method, compound and composition for effecting degradation of crude petroleum and petroleum products in an environment |
| WO1985002196A1 (en) * | 1983-11-14 | 1985-05-23 | Thirumalachar Mandayam J | Method, compound and composition for effecting degradation of crude petroleum and petroleum products in an environment |
| CN101765661A (en) * | 2007-06-01 | 2010-06-30 | 索拉兹米公司 | In microorganism, produce oil |
| CN103103135A (en) * | 2012-12-07 | 2013-05-15 | 沈阳科纳提克生物科技有限公司 | Aspergillus oryzae strain and method for producing fungal alpha-amylase by liquid-state fermentation of aspergillus oryzae strain |
| CN105112303A (en) * | 2015-09-06 | 2015-12-02 | 江南大学 | Aspergillus niger strain of complex enzyme for liquor making |
| CN105624061A (en) * | 2016-01-08 | 2016-06-01 | 陕西博秦生物工程有限公司 | Bacillus amyloliquefaciens subsp.amyloliquefaciens as well as preparation and application of solid bacterial preparation of bacillus amyloliquefaciens subsp.amyloliquefaciens |
| CN107165610A (en) * | 2017-06-06 | 2017-09-15 | 陕西博秦生物工程有限公司 | Utilize fungi ectoenzyme and the dual intensified oil reduction method of microorganism alternately |
-
2018
- 2018-11-26 CN CN201811416137.XA patent/CN109486775B/en active Active
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4415661A (en) * | 1981-07-30 | 1983-11-15 | Thirumalachar Mandayam J | Microbial degradation of petroleum materials |
| WO1985002197A1 (en) * | 1983-11-14 | 1985-05-23 | Thirumalachar Mandayam J | Method, compound and composition for effecting degradation of crude petroleum and petroleum products in an environment |
| WO1985002196A1 (en) * | 1983-11-14 | 1985-05-23 | Thirumalachar Mandayam J | Method, compound and composition for effecting degradation of crude petroleum and petroleum products in an environment |
| CN101765661A (en) * | 2007-06-01 | 2010-06-30 | 索拉兹米公司 | In microorganism, produce oil |
| CN103103135A (en) * | 2012-12-07 | 2013-05-15 | 沈阳科纳提克生物科技有限公司 | Aspergillus oryzae strain and method for producing fungal alpha-amylase by liquid-state fermentation of aspergillus oryzae strain |
| CN105112303A (en) * | 2015-09-06 | 2015-12-02 | 江南大学 | Aspergillus niger strain of complex enzyme for liquor making |
| CN105624061A (en) * | 2016-01-08 | 2016-06-01 | 陕西博秦生物工程有限公司 | Bacillus amyloliquefaciens subsp.amyloliquefaciens as well as preparation and application of solid bacterial preparation of bacillus amyloliquefaciens subsp.amyloliquefaciens |
| CN107165610A (en) * | 2017-06-06 | 2017-09-15 | 陕西博秦生物工程有限公司 | Utilize fungi ectoenzyme and the dual intensified oil reduction method of microorganism alternately |
Non-Patent Citations (2)
| Title |
|---|
| JUN HUI ZHANG等: "Degradation of crude oil by fungal enzymepreparations fromAspergillusspp. for potentialuse in enhanced oil recovery", 《J CHEM TECHNOL BIOTECHNOL》 * |
| 马鑫;高卉;张俊会;王平;薛泉宏;: "3株原油降解细菌鉴定及其降解和驱油特性研究", 中国石油大学学报(自然科学版) * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110438012A (en) * | 2019-08-05 | 2019-11-12 | 四川大学 | It is a kind of produce anthocyanidin aspergillus sydowi H-1 and its application |
| CN110438012B (en) * | 2019-08-05 | 2021-10-26 | 四川大学 | Aspergillus sakazakii H-1 for producing anthocyanin and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109486775B (en) | 2024-03-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102220270B (en) | Screening method for producing chondroitin sulfate bacterial strain and application of bacterial strain fermentation method in production of chondroitin sulfate | |
| CN102321563B (en) | Amycolatopsis sp. and method for preparing vanillin through whole-cell transformation of Amycolatopsis sp. | |
| CN103667132A (en) | Bacillus cereus and application thereof to improve plant drought-resistant capability | |
| CN106834140B (en) | A kind of anaerobic fungi and the method with its wheat stalk production ethyl alcohol that ferments | |
| CN106834141B (en) | A kind of anaerobic fungi and the method with its rice straw production formic acid that ferments | |
| Rishi et al. | Utilization of kitchen waste for production of pullulan to develop biodegradable plastic | |
| Uchida et al. | Production of 16.5% v/v ethanol from seagrass seeds | |
| CN105567609B (en) | One plant of high temperature resistant garden waste decomposer ST2 and its application | |
| Adeoye et al. | Biotechnological valorization of cashew apple juice for the production of citric acid by a local strain of Aspergillus niger LCFS 5 | |
| Nouri et al. | Xylan-hydrolyzing thermotolerant Candida tropicalis HNMA-1 for bioethanol production from sugarcane bagasse hydrolysate | |
| Adetunji et al. | Production of phytotoxic metabolites with bioherbicidal activities from Lasiodiplodia pseudotheobromae produced on different agricultural wastes using solid-state fermentation | |
| El-Sheekh et al. | Application of a novel biological-nanoparticle pretreatment to Oscillatoria acuminata biomass and coculture dark fermentation for improving hydrogen production | |
| CN105670966B (en) | One plant of high temperature resistant garden waste decomposer ST4 and its application | |
| CN105018352A (en) | Fungal strain capable of producing kojic acid and preparation method of fungal strain | |
| CN109486775A (en) | Fungal enzyme of gasifiable oil content and preparation method thereof and application method in a kind of raising crude oil | |
| CN104560731A (en) | Yeast-like fungi in high yield of squalene and application of yeast-like fungi | |
| CN104611236A (en) | Cumminghamella echinulata(Thaxter) thaxter FAR3 and method for fermentation preparation of Gamma-linolenic acid grease with Cumminghamella echinulata(Thaxter) thaxter FAR3 | |
| CN102643754B (en) | Aspergillus oryzae and application thereof in aspect of improving yield of alcohol | |
| CN105567608B (en) | One plant of high temperature resistant garden waste decomposer ST1 and its application | |
| CN114032187A (en) | Kluyveromyces marxianus strain derived from Tibetan yogurt and application thereof | |
| US8642300B2 (en) | Method for production of bio-ethanol using watermelon seeds | |
| CN105695529A (en) | Method for preparing exopolysaccharides from ganoderma lucidum | |
| CN105087427A (en) | Vibrio natriegens for producing agarase and application of vibrio natriegens | |
| CN104372062A (en) | Method for producing fatty acid by mixing and fermenting oil-producing yeast and bacillus to degrade lignocellulose | |
| CN106467894B (en) | One plant height produces single needle algae and its culture application of starch and grease |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |