CN109468417A - A kind of RPA method of watermelon blood flesh disease diagnosis and cause of disease analyte detection - Google Patents
A kind of RPA method of watermelon blood flesh disease diagnosis and cause of disease analyte detection Download PDFInfo
- Publication number
- CN109468417A CN109468417A CN201910026699.1A CN201910026699A CN109468417A CN 109468417 A CN109468417 A CN 109468417A CN 201910026699 A CN201910026699 A CN 201910026699A CN 109468417 A CN109468417 A CN 109468417A
- Authority
- CN
- China
- Prior art keywords
- rpa
- cgmmv
- disease
- watermelon
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of diagnosis of watermelon blood flesh disease and the RPA methods of cause of disease analyte detection, in conjunction with modern molecular biology investigative technique means, establish a set of efficient, economic and quickly detection CGMMV technical system, RPA rapid detection method is invented, i.e. using the cDNA with malicious sample as template in a RPA reaction, a pair of of detection primer, (37-40 DEG C) reaction 20-30min of water-bath constant temperature is added, sensitivity reaches 10‑6, the higher realization of sensitivity quickly and accurately detects the purpose of CGMMV, while reducing qualification time, has saved biochemical reagents, has reduced costs, monitoring, prediction and the prevention and treatment for this quarantine disease of CGMMV are provided fundamental basis and technical guarantee.
Description
Technical field
The side RPA of technical field of plant quarantine of the present invention more particularly to a kind of diagnosis of watermelon blood flesh disease and cause of disease analyte detection
Method.
Background technique
Cucumber green mottle mosaic virus (Cucumber green mottle mosaic virus, CGMMV) belongs to tobacco
One of mosaic virus category (Tobamovirus) member is a kind of important quarantine virus on ground family crop in world wide, sternly
Threaten the production of the ground family crops such as watermelon, muskmelon, cucumber again.CGMMV can pass through seed, pollen, soil, water and insect matchmaker
It is situated between and Mechanical Contact is propagated.It will appear apparent flower leaf paresthesia, growth retardation, fruit on infection CGMMV plant leaf
Deformity eventually leads to yield reduction, so as to cause huge economic loss.
There are many circulation ways by CGMMV, but based on band seed culture of viruses and mechanical inoculation.(1) seed dispersal: CGMMV is allusion quotation
The Seed-borne Virus of type, virus mainly in seed external skins by seed pass poison, pollen, plant skin, sick seedling plumular axis in
Can discovery, and can in seed long-term surviving.(2) contact is propagated: CGMMV can also pass through contact invalid body, band seed culture of viruses
Seedling etc. enters in plant body from host's microtrauma mouth and propagates；The contagion of artificial juice, such as grafting operation can also be passed through
Deng such as often resulting in disease in watermelon seed growing area to graft production method and occur extensively.(3) soil-borne: the soil of CGMMV passes poison
Rate is lower, and South Korea is it has been reported that soil natural passes malicious rate only 0-3.5%.(4) Semen Cuscutae is propagated: CGMMV can also pass through Semen Cuscutae
It propagates.(5) in addition, also having been reported that discovery CGMMV can also be propagated with river water and irrigation water, the fields such as Chenopodium amaranticolor, purslane are miscellaneous
Grass is also the important medium of disease natural expansion.Many researchers expand research to the infection insect of CGMMV, but at present not yet
It was found that the virus can be propagated by having the insect mediator of specificity.
In order to effectively prevent CGMMV to propagate, a variety of detection methods are had been set up, including immunoelectron microscopic method, enzyme linked immunological
Absorption method (ELISA), RT-PCR, real-time fluorescence quantitative PCR (Real-time PCR) and ring mediated isothermal amplification (LAMP) etc.,
However immuno-electron microscope equipment is expensive, operating difficulties.Cross reactivity limits the application of enzyme-linked immunosorbent assay.RT-PCR,
Real-time fluorescence quantitative PCR is most widely used laboratory diagnostic technique, but its reaction process needs thermal cycle, and equipment is expensive,
Reaction time is typically larger than 1 hour.Ring mediated isothermal amplification is although low for equipment requirements, but its product structure is complicated, can not survey
Sequence, and be difficult in conjunction with probe technique, generation non-specific amplification is fubaritic, and reaction usually requires 1 hour.Above-mentioned side
Method is not able to satisfy the needs that CGMMV is quickly detected.
Chinese invention patent CN108456746A discloses a kind of based on one-step method RPA technology detection cucumber green mottle floral leaf
The method of virus provides the primer pair for detecting cucumber green mottle mosaic virus, and the primer pair is by primer CGMMV-RPA-
F and primer CGMMV-RPA-R composition.The purposes of the primer pair is detection or auxiliary detection cucumber green mottle mosaic virus or inspection
Survey whether plant sample to be measured infects cucumber green mottle mosaic virus.Although this method has substantially met detection cucumber green mottle flower
The requirement of mosaic virus, but space is still greatly improved in terms of sensitivity.
This programme using recombinase polymeric enzymatic amplification technology (Recombinase polymerase amplification,
RPA), a kind of novel isothermal DNA amplification and detection technique extract total using the cucurbit blade of frictional inoculation CGMMV as material
RNA, reverse transcription obtain cDNA, and as template, by reaction condition optimization, the test such as specificity and sensitivity technique is built
A kind of method for having found new quick detection CGMMV.
Summary of the invention
Technical problems based on background technology, the invention proposes a kind of diagnosis of watermelon blood flesh disease and cause of disease analyte detections
RPA method.
Technical scheme is as follows:
A kind of RPA method of watermelon blood flesh disease diagnosis and cause of disease analyte detection, comprising the following steps:
A, the total serum IgE of viral sample to be measured is extracted；
B, the total serum IgE obtained using step A, using specific primer to RPA amplification is carried out, obtains amplified production as template；
Judge whether virus to be measured is cucumber green mottle mosaic virus as follows:
If the amplified production contains the DNA fragmentation (sequence 1) of 140bp, the virus to be measured is cucumber green mottle flower
Mosaic virus；If the amplified production does not contain the DNA fragmentation of 140bp, the virus to be measured is not cucumber green mottle mosaic
Poison.
The DNA fragmentation containing 140bp is DNA fragmentation shown in sequence 1 in sequence table, specific as follows:
ACTTATTGCGTTTAGTGCTTCTTATGTTCCCGTCAGGACTTTACTTAATTTTCTAGTTGCTTCACAAGG
TACCGCTTTCCAGACTCAAGCGGGAAGAGATTCTTTCCGCGAGTCCCTGTCTGCGTTACCCTCGTCTGTCG
Since virus sequence variability is larger, above-mentioned sequence is permissible, and there are 3% differences.
Preferably, the specific primer pair, according to CGMMV-lnxg isolate genome (KY040049.1) sequence,
According to the design principle of RPA primer, software and the specific RPA primer pair CGMMV- of artificial correction design detection CGMMV are utilized
F/CGMMV-R, primer sequence are shown in Table 1.
1 CGMMV specific detection primer of table
Preferably, the condition of RPA amplification are as follows: 37-40 DEG C of reaction 20-30min.
The invention has the beneficial effects that: present invention combination modern molecular biology investigative technique means establish a set of
Efficiently, economic and quickly detection CGMMV technical system, has invented RPA rapid detection method, i.e., in a RPA reaction
Using the cDNA with malicious sample as template, it is added a pair of of detection primer, (37-40 DEG C) of water-bath constant temperature reaction 20-30min is sensitive
Degree reaches 10-6, the higher realization of sensitivity quickly and accurately detects the purpose of CGMMV, while reducing qualification time, saves
Biochemical reagents reduce costs, for this quarantine disease of CGMMV monitoring, prediction and prevention and treatment provide fundamental basis and
Technical guarantee.
Detailed description of the invention
The optimization of Fig. 1: CGMMV-RPA reaction time；Wherein, M:2,000bp DNA Marker；Swimming lane A~D is respectively 10-
The 40min reaction time；
Fig. 2: RT-RPA sensitivity technique；Wherein, M:2,000bp DNA Marker；1~7:PCR template is respectively 100、
10-1、10-2、10-3、10-4、10-5、10-6Reverse transcription product again；8: with ddH2O is the negative control of template；
The detection of Fig. 3: RT-RPA atopic；Wherein, M:2,000bp DNA Marker；A~E be respectively as follows: CGMMV,
ddH2O, watermelon mosaic virus, small zucchini yellow mosaic virus, pumpkin mosaic virus；
Fig. 4: RT-RPA field sample detection；Wherein, M:2,000bp DNA Marker；1,4,9,11 virus is not detected,
2-3,5-8 and 10 testing results are the malicious sample of band, and wherein A is PCR detection, and B is RPA detection.
Specific embodiment
Embodiment:
1.CGMMV gene-specific primer
It is utilized according to CGMMV-lnxg isolate genome (KY040049.1) sequence according to the design principle of RPA primer
The specific RPA primer pair CGMMV-F/CGMMV-R of software and artificial correction design detection CGMMV, primer sequence are shown in Table 1.
2. the rapidly extracting of watermelon sample total serum IgE
0.1g specimen material is put into the mortar for cleaning sterilizing and adds liquid nitrogen grinding, adds 1mL Trizol Reagent
Reagent mixes.The above homogenate sample is transferred in the centrifuge tube of 2ml RNase-free, good rear acutely concussion is covered and mixes, room
Temperature places 5min；0.2mL chloroform is added, turns upside down and mixes 15s, be placed at room temperature for 15min；4 DEG C, 12,000rpm, centrifugation
Upper layer colourless aqueous phase is transferred to new 1.5ml RNase-free centrifuge tube by 20min；Isometric isopropanol (about 400- is added
500uL), it mixes, is stored at room temperature 10min；4 DEG C, 12,000rpm, it is centrifuged 10min；It carefully discards supernatant, it is heavy to obtain gluey RNA
It forms sediment；It is added 75% dehydrated alcohol of 1mL (RNase-free ddH2O configuration), is vortexed and mixes, RNA is enabled to come into full contact with ethyl alcohol, it is quiet
Set 1-2min；4 DEG C, 7,500rpm, it is centrifuged 5min；Carefully discard supernatant liquid.It is step by step rapid to repeat above-mentioned two；It is placed in 5- in air
10min, dry RNA precipitate；Appropriate RNase-free ddH2O dissolution is added, in -80 DEG C after concentration mensuration and electrophoresis detection
It saves.It is detected by ultramicrospectrophotometer, the concentration of total serum IgE is 689.2-863.3ng/ μ l；The A260/A280 of total serum IgE
2.01-2.05 and 1.79-1.92 is distinguished with the ratio of A260/A230.
3. reverse transcription
Taking 2 μ l of total serum IgE (about 2 μ g RNA) is template, and 0.5 μ l Oligo dT (0.5 μ g/ μ l), 0.5 μ l is added with power traction
Object (0.5 μ g/ μ l) and 1 μ l dNTPs (10mM), DEPC water are settled to 14.5 μ l, 70 DEG C of reaction 5min and place 3-5min on ice；
4 μ 5 × reverse transcription of l buffer, 0.5 μ l Ribonuclease Inhibitor (40U/ μ l) and 1 μ l M-MLV reverse transcription is added
Enzyme (200U/ μ l), 42 DEG C of water-bath 1h after mixing.The cDNA of acquisition is placed in -20 DEG C of preservations.
4.CGMMV-RPA reaction system is established --- reaction time optimization
Using the cDNA of total serum IgE reverse transcription preparation as template, RPA amplification is carried out using CGMMV-F and CGMMV-R.RPA amplification
System is as follows: adding into the 0.2ml TwistAmp reaction tube (TwistAmp Basic kits, Twist) containing freeze-drying enzyme powder
Enter 29.5 μ l of rehydration buffer (Rehydration Buffer), 12.5 μ l of deionized water, each 2 μ l of upstream and downstream primer are (dense eventually
Degree is 0.4 μm of ol/L), 1 μ l of template cDNA finally adds 2.5 μ l (280mmol/L) of magnesium acetate solution.RPA is expanded into body
System mixes well, and is placed in 37 DEG C of water-bath and reacts 10min, 20min, 30min, 40min respectively.RPA after reaction, makes
Purified with DNA purification kit to product, and carry out electrophoresis in 1.5% Ago-Gel, seen on gel imaging system
Examine result.The result shows that as shown in Figure 1, after the reaction of 10min, occur the band for being clearly expected size (~
140bp).The density analysis of DNA band shows that the DNA yield after 20min reaction is 2 times of 10min reaction, and 30 and 40min
Product between be not significantly different.Therefore, in subsequent research, by 30 minutes as the anti-of all routine RT-RPA detection
Between seasonable.
5.CGMMV-RPA sensitivity technique
The total serum IgE of extraction is subjected to 10 times of serial dilutions, is followed successively by 100、10-1、10-2、10-3、10-4、10-5、10-6Respectively
Reverse transcription is carried out as template and obtains cDNA, and RPA detection is carried out with optimum reaction condition and sees figure to determine minimum detectability degree
2。
The detection of 6.CGMMV-RPA atopic
For verify CGMMV-RPA reaction system specificity, respectively with watermelon mosaic virus, small zucchini yellow mosaic virus
The watermelon material infected with pumpkin mosaic virus carries out RPA amplification.Electricity is carried out to amplified production using 1.5% Ago-Gel
Swimming observes electrophoresis result using gel imaging system, verifies to the specificity of CGMMV-RPA reaction system, see Fig. 3.Knot
The watermelon material that fruit shows that non-purpose pathogen infects cannot amplify other bands, illustrate the detection of invention design
System high specificity.
The field sample detection of 7.CGMMV-RPA
It is rich from Shenyang City, Liaoning Province Xinmin City Liangshan town, three estrade east Blue.G of Daliang City Wafangdian City, Gaizhou City, Yingkou City
Luo Pu, the right Wei Town in Linghai City, Jinzhou City, Heishan County, Jinzhou City partly pull town, the Panjin City Panshan County town Shi Xin, Chaoyang City Jianping County
The ground such as Heisui River town acquire water melon leaf, carry out RT-RPA detection to sample segment according to the method described above；Meanwhile with conventional RT-PCR
Method carries out Parallel testing to same batch of sample, and carries out observation comparison analysis to result and record.The result shows that 11 parts of samples
In, 7 parts are detected as the malicious sample of band, and testing result is consistent with PCR result, detection accuracy 100%.
The foregoing is only a preferred embodiment of the present invention, but scope of protection of the present invention is not limited thereto,
Anyone skilled in the art in the technical scope disclosed by the present invention, according to the technique and scheme of the present invention and its
Inventive concept is subject to equivalent substitution or change, should be covered by the protection scope of the present invention.
Sequence table
<110>Agricultural University Of Shenyang
<120>a kind of RPA method of watermelon blood flesh disease diagnosis and cause of disease analyte detection
<130> 2010
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 140
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
acttattgcg tttagtgctt cttatgttcc cgtcaggact ttacttaatt ttctagttgc 60
ttcacaaggt accgctttcc agactcaagc gggaagagat tctttccgcg agtccctgtc 120
tgcgttaccc tcgtctgtcg 140
<210> 2
<211> 30
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
acttattgcg tttagtgctt cttatgttcc 30
<210> 3
<211> 30
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
cgacagacga gggtaacgca gacagggact 30
Claims (4)
1. a kind of RPA method of watermelon blood flesh disease diagnosis and cause of disease analyte detection, which comprises the following steps:
A, the total serum IgE of viral sample to be measured is extracted；
B, the total serum IgE obtained using step A, using specific primer to RPA amplification is carried out, obtains amplified production as template；According to
Following method judges whether virus to be measured is cucumber green mottle mosaic virus:
If the amplified production contains the DNA fragmentation of 140bp, the virus to be measured is cucumber green mottle mosaic virus；If institute
The DNA fragmentation that amplified production does not contain 140bp is stated, then the virus to be measured is not cucumber green mottle mosaic virus.
2. the RPA method of watermelon blood flesh disease diagnosis as described in claim 1 and cause of disease analyte detection, which is characterized in that described
Primer pair is specificity RPA primer pair CGMMV-F/CGMMV-R；
The primer CGMMV-F sequence is ACTTATTGCGTTTAGTGCTTCTTATGTTCC；
The primer CGMMV-R sequence is CGACAGACGAGGGTAACGCAGACAGGGACT.
3. the RPA method of watermelon blood flesh disease diagnosis as described in claim 1 and cause of disease analyte detection, which is characterized in that described
The condition of RPA amplification are as follows: 37-40 DEG C of reaction 20-30min.
4. the RPA method of watermelon blood flesh disease diagnosis as described in claim 1 and cause of disease analyte detection, which is characterized in that this method
Detection sensitivity reach 10-6。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910026699.1A CN109468417A (en) | 2019-01-11 | 2019-01-11 | A kind of RPA method of watermelon blood flesh disease diagnosis and cause of disease analyte detection |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910026699.1A CN109468417A (en) | 2019-01-11 | 2019-01-11 | A kind of RPA method of watermelon blood flesh disease diagnosis and cause of disease analyte detection |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109468417A true CN109468417A (en) | 2019-03-15 |
Family
ID=65678507
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910026699.1A Pending CN109468417A (en) | 2019-01-11 | 2019-01-11 | A kind of RPA method of watermelon blood flesh disease diagnosis and cause of disease analyte detection |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109468417A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112266979A (en) * | 2020-10-30 | 2021-01-26 | 安徽省农业科学院作物研究所 | RPA detection primer based on watermelon mosaic virus conserved region, detection method and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103146847A (en) * | 2013-03-22 | 2013-06-12 | 南京农业大学 | RT-LAMP (loop-mediated isothermal amplification) rapid detection kit for cucumber green mottle mosaic virus (CGMMV) and detection method |
| CN107254552A (en) * | 2017-06-26 | 2017-10-17 | 北京市农林科学院 | A kind of method that tomato yellow leaf curl virus is detected based on RPA |
| CN108456746A (en) * | 2018-04-03 | 2018-08-28 | 中国检验检疫科学研究院 | A method of cucumber green mottle mosaic virus is detected based on one-step method RPA technologies |
-
2019
- 2019-01-11 CN CN201910026699.1A patent/CN109468417A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103146847A (en) * | 2013-03-22 | 2013-06-12 | 南京农业大学 | RT-LAMP (loop-mediated isothermal amplification) rapid detection kit for cucumber green mottle mosaic virus (CGMMV) and detection method |
| CN107254552A (en) * | 2017-06-26 | 2017-10-17 | 北京市农林科学院 | A kind of method that tomato yellow leaf curl virus is detected based on RPA |
| CN108456746A (en) * | 2018-04-03 | 2018-08-28 | 中国检验检疫科学研究院 | A method of cucumber green mottle mosaic virus is detected based on one-step method RPA technologies |
Non-Patent Citations (1)
| Title |
|---|
| 焦裕冰、蒋均匀、夏子豪等: "基于重组酶聚合酶扩增技术检测黄瓜绿斑驳花叶病毒方法的建立", 《中国植物病理学会2018年学术年会论文集》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112266979A (en) * | 2020-10-30 | 2021-01-26 | 安徽省农业科学院作物研究所 | RPA detection primer based on watermelon mosaic virus conserved region, detection method and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106702029B (en) | Multiplex RT-PCR method for synchronously detecting 5 watermelon viruses and application thereof | |
| CN102643925A (en) | Loop-mediated isothermal amplification (LAMP) primer composition for detecting phytophthora rot and application thereof | |
| CN102703608A (en) | Reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay kit and detection method for grass carp reoviruses | |
| CN111518877B (en) | One-tube method nest type real-time quantitative PCR detection kit for detecting echinococcus multilocularis and echinococcus granulosus by parting trace samples | |
| Retief et al. | A protocol for molecular detection of Phaeomoniella chlamydospora in grapevine wood: research in action | |
| CN109468417A (en) | A kind of RPA method of watermelon blood flesh disease diagnosis and cause of disease analyte detection | |
| CN106755597A (en) | A kind of 4 kinds of multiple PCR methods of capsicum virus of synchronous detection | |
| CN110923358A (en) | RPA detection primer of sweet potato leaf curl virus, detection method and application | |
| CN106434994A (en) | Rapid detecting mycoplasma ovipneumoniae method | |
| CN103060476A (en) | MP (movement protein)-gene-based real-time fluorescence polymerase chain reaction (PCR) detection method for cucumber green mottle mosaic virus (CGMMV), and probe and primer combination | |
| CN103805610B (en) | Rhopalosiphum padi EF1-α reference gene partial sequence, cloning process and application thereof | |
| CN110951917B (en) | RNA-RP RT-PCR method for rapidly detecting melon viruses | |
| CN112410468A (en) | Special primer, kit and detection method for detecting strawberry mottle virus | |
| CN112322768A (en) | Method for diagnosing hippophae rhamnoides branch wilt and rapidly detecting RPA (resilient root antigen) of pathogenic bacteria | |
| CN103820462B (en) | Rhopalosiphum padi ACT1 reference gene partial sequence, cloning method and application | |
| CN116479185A (en) | Method for detecting lily asymptomatic virus by RT-qPCR | |
| CN105018612A (en) | Quantitative detection method of garlic virus | |
| RU2607025C1 (en) | Synthetic oligonucleotide primers and method for detecting rna atypical pestivirus of cattle | |
| Awan et al. | Molecular detection of potato leaf roll polerovirus through reverse transcription polymerase chain reaction in dormant potato tubers | |
| CN107893129A (en) | The method for detecting apple green wrinkle fruit disease poison | |
| CN112094854B (en) | Specific primer, probe and kit for detecting pelodiscus sinensis flavivirus | |
| Khoo et al. | First report of Epicoccum sorghinum causing leaf spot on Platostoma palustre in Malaysia | |
| CN108315493A (en) | A kind of LAMP primer group and detection method for detecting barley yellow mosaic virus | |
| CN111154909B (en) | Specific primer, kit and molecular detection method for Escholtzia fungus | |
| CN105506174A (en) | Detection method for sugarcane mosaic virus in corn |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |