CN109468239A - It is a kind of produce tannase candidiasis screening and its activity determination method - Google Patents
It is a kind of produce tannase candidiasis screening and its activity determination method Download PDFInfo
- Publication number
- CN109468239A CN109468239A CN201811550696.XA CN201811550696A CN109468239A CN 109468239 A CN109468239 A CN 109468239A CN 201811550696 A CN201811550696 A CN 201811550696A CN 109468239 A CN109468239 A CN 109468239A
- Authority
- CN
- China
- Prior art keywords
- tannase
- bacterial strain
- producing
- enzymatic activity
- candidiasis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/16—Yeasts; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/02—Separating microorganisms from their culture media
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/16—Yeasts; Culture media therefor
- C12N1/165—Yeast isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
- C12Q1/44—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase involving esterase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
- C12R2001/72—Candida
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Mycology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Biomedical Technology (AREA)
- Virology (AREA)
- Botany (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to bacterial strain screening identification technology field, a kind of screening for producing tannase candidiasis and its activity determination method are disclosed, including soil sample processing, the isolating and purifying of bacterial strain, shake flask fermentation and its enzymatic activity is surveyed etc., determines purpose bacterial strain；Strain secondary screening is carried out by punch method and measurement enzyme hydrolysis circle method again.The present invention isolates and purifies the bacterial strain GL-4 for obtaining the more stable production tannase of 1 plant of enzymatic activity by series of steps such as shake flask fermentation, enzyme assays from soil；Through molecular biology identification GL-4 Pseudomonas in candidiasis, which is 244.530U/mL.Result of the invention provides experimental basis to produce the separation screening of tannase microorganism, also lays the foundation for the production of microbial source tannase.By orthogonal test, its enzymatic activity reaches 395.948U/mL after optimization, improves 61.9% before relatively optimizing.
Description
Technical field
The invention belongs to bacterial strain screening identification technology field more particularly to it is a kind of produce tannase candidiasis screening and
Its activity determination method.
Background technique
Currently, the prior art commonly used in the trade is such that
1, tannic acid is a kind of polyphenols, except algae, lichens and moss tannin acid content are low, tealeaves, sorghum, persimmon
The plants such as son, Oak Tree, Quercus liaotungensis, grape pip and Grape Skin are higher in the content of immature phase tannic acid.Tannic acid has uniqueness
Astringent taste, insoluble compound can be formed with protein, pectin, alkaloid etc..
According to the difference of tannic acid chemical structure and characteristic, Hydrolysable Tannins acid can be divided into and condensed tannin acid two is big
Class.Contain ester bond in Hydrolysable Tannins acid molecule, hydrolyzable at gallic acid or inverse does not have under the action of tannase, diluted alkaline or diluted acid
Gallate-based and glucose.And condensed tannin acid is flavane 01 derivatives, the aromatic rings in molecule is keyed by C-C, because not
Structure with ester, so being not easy by tannin enzyme hydrolysis.
Structural formula: the molecular structure of Hydrolysable Tannins acid, gallic acid and benzoaric acid
2, the application of tannase
(1) application of field of tea
Polyphenol substance in tea easily forms complex compound with caffeine, protein etc., causes solution muddy, occurs " after cold
It is muddy " phenomenon.In the production process of liquid tea and instant tea, needing to become it using physics, chemistry or enzymatic treatment method can
Molten object.Tannase is widely used in tea, it can cut off the ester bond between tea polyphenols and gallic acid, makes the ester type of bitter taste
Catechin hydrolysis generates free gallic acid, forms the lesser water-soluble short-chain substance of molecular weight, to reduce the mixed of tea
Turbidity.Coca-Cola reduces " cream down " phenomenon occurred in tea beverage using tannase, achieves preferable effect, muddy
Turbidity is down to 8% by 80%.
(2) application of field of juice drink
Emerging juice of my pomegranate, rasp berry juice etc., their antioxidant activity is preferable, but tannin acid content is higher in these fruit,
Taste of juice after making processing is bitter, and there are deposited phenomenons.Since conventional fruit juice debitterizing technology can not be effectively removed bitterness
Taste, so that enzymatic is taken away the puckery taste becomes first choice.
(3) application in feed industry field
Contain tannic acid in plant feed, under normal circumstances, the tannic acid in plant is unfavorable for the nutrient health of animal,
Because the produced digestion zymoprotein of domestic animal itself and vegetable protein all can because tannic acid there are due to form precipitating, influence it normally
It absorbs.In order to reduce the negative effect of tannic acid, domestic animal is improved to the utilization rate and absorptivity of vegetable protein, reduces animal husbandry
Production cost usually carries out respective handling with tannase during feed processing.
In conclusion problem of the existing technology is:
Tannase low output in the prior art, the market price are expensive.Tannin Acyl- hydrolase (E.C.3.1.1.20), usually
Referred to as tannase is accidentally at one from finding in the test of synthesizing gallic acid in tannin aqueous acid.Tannase will
Tannic acid complete hydrolysis be gallic acid and glucose, the intermediate product of conversion be 2,3,4,6- tetra- galloyl glucoses and
Two kinds of single galloyl glucoses.Tannase has presence in plant, animal and microorganism, but it mainly utilizes microorganism
Come what is produced, such as bacterium, yeast and fungi.Due to separate generate the enzyme bacterium amount it is less, yield is also relatively low, surely
It is qualitative poor, it is easy contaminated, the problems such as extraction process is complex, and the document report for producing tannase saccharomycete is less,
Only KenjiAoki purified tannase in 1976 from the culture solution of candidiasis, rarely had registration so far.Tannase
Using relatively broad, research has been deep into food processing, feed processing and Cosmetic Manufacture technical process with application.
However, the bacterial strain enzymatic activity that existing some produces tannase is low, and tannase is mixed in one with substrate, product in entire reaction system
It rises, it is difficult to it recycles, and insufficient to the understanding of the factors such as its zymologic property, best fermentation expression and industrial mass production,
Tannase is lacking in practical application at present.
Solve the difficulty and meaning of above-mentioned technical problem:
Tannase is a kind of important industrial enzymes, and the tannin in degradable tea beverage, feed is widely used in food
Processing industry, Feed Manufacturing industry, leather industry and pharmaceuticals industry etc., are determined as safety product by U.S. FDA.But by
In current tannase fecund in bacterium and fungi, low output is expensive.Therefore, yield height is opened up, the high tannase of enzymatic activity is outstanding
To need.The present invention from Xishuangbanna tea place, 15 generation chateau of Zhang Yu Mo Saier the soil such as vineyard in separation screening produce it is single
The bacterial strain of peaceful enzyme simultaneously further increases tannin production of enzyme, mentions for the screening of tannase producing strains and the production of microbial source tannase
Experimental basis is supplied.
Summary of the invention
In view of the problems of the existing technology, the present invention provides a kind of screening for producing tannase candidiasis and its enzymes
Activity determination method.
The invention is realized in this way a kind of screening technique of tannase producing strains, specifically includes the following steps:
Step 1: soil sample processing weighs 5.0g soil sample, in the 250mL triangular flask equipped with 45mL enriched medium, puts
Enter several sterile small beades, 30 DEG C in shaking table, 180r/min oscillation 24 h of enrichment culture；
Step 2: bacterial strain isolates and purifies, and selects the more stable bacterial strain of enzymatic activity, is forwarded to slant medium culture 3d,
It is spare to be stored in 4 DEG C of refrigerators；
Step 3: bacterial strain shake flask fermentation simultaneously surveys its enzymatic activity, and single colonie is inoculated into enrichment culture liquid after purifying
It cultivates 18h, 30 DEG C, 180r/min shaking flask culture 72h and measure its enzymatic activity, determines purpose bacterial strain；
Step 4: bacterial strain secondary screening is carried out using punch method, crude enzyme liquid is prepared, using punch, is beaten on differential medium
3d is cultivated in 20 μ L crude enzyme liquid adding holes in hole, sees the diameter of its degradation circle, carries out the Preliminary Identification of yield of enzyme.
Further, in step 1, soil sample be taken from Xishuangbanna tea place, Zhang Yu Mo Saier chateau vineyard soil；
Further, in step 2, bacterial strain is isolated and purified, specifically includes the following steps:
(1) 1.0mL pregnant solution is drawn, after 10 times of gradient dilutions to debita spissitudo, is coated on plate differential medium, in
30 DEG C of constant temperature incubation 3d in incubator；
(2) in purifying of crossing on differential medium, 30 DEG C of constant temperature incubation 3d, Lian Chuan 5 are commissioned to train feeding the single bacterium colony of picking；
(3) height that tannase content is known by the shade and diameter of discoloration circle, selects enzymatic activity relatively
High and more stable bacterial strain is forwarded to slant medium culture 3d, and it is spare to be stored in 4 DEG C of refrigerators.
Further, tannic acid and bromophenol blue indicator are contained in differential medium, if bacterial strain produces tannase and will hydrolyze
Tannic acid in culture medium generates gallic acid, and the bromophenol blue indicator in culture medium is made to become yellow from bluish violet, thus
Periphery of bacterial colonies forms apparent discoloration circle, retains the bacterial strain for generating transparent circle.
Further, in step 3, single colonie is inoculated into enrichment culture liquid and cultivates 18h, is linked by 10% inoculum concentration
In liquid fermentation medium.
Further, in step 4, the preparation of crude enzyme liquid chooses single strain GL-4 and carries out fermented and cultured, after fermented and cultured 3d,
Take 2.0mL fermentation liquid in centrifuge tube, 4000r/min is centrifuged 10min, takes supernatant, as crude enzyme liquid.
Further, in step 4, punch diameter is 7mm.
Another object of the present invention is to provide a kind of activity determination methods of tannase producing strains, specifically include following
Step:
(1) to the molecular biology identification for producing tannase bacterial strain GL-4 progress bacterial strain；
(2) to the Morphological Identification for producing tannase bacterial strain GL-4 progress bacterial strain:
1) bacterial strain GL-4 single colonie is taken to break up in sterile water, after diluting suitable multiple, sterile working is coated on tannin mirror
On other culture medium flat plate, after 30 DEG C of constant temperature incubation 3d, colony morphology characteristic is observed；
2) it observes strain culturing initial stage respectively under an optical microscope and cultivates the cellular morphology after 3d: in sterile working item
Under part, the new fresh thalli of picking minute quantity dips a small amount of sterile water and is diluted rear microscopy in clean glass slide.
In conclusion advantages of the present invention and good effect are as follows:
(1) present invention surveys the methods of enzymatic activity and transparent circle secondary screening by shake flask fermentation, isolates and purifies to obtain from soil
Enzymatic activity higher and more stable bacterial strain GL-4.
(2) through molecular biology identification, GL-4 Pseudomonas is the present invention in candidiasis, the strain enzyme-producing enzymatic activity
244.530U/m L。
(3) result of the invention for produce tannase saccharomycete isolate and purify and breeding provides experimental basis.
After morphology and molecular biology identification, determine that the higher candidiasis GL-4 of 1 plant of enzymatic activity is ground
Study carefully.The enzymatic activity is 244.530U/mL.By orthogonal test, its enzymatic activity reaches 395.948U/mL after optimization, before relatively optimizing
Improve 61.9%.
In the research process of tannase, the active measuring method of tannase is always without unified, and different documents are to enzyme
The general introduction of activity value is also different, is difficult to be compared to each other so as to cause measurement result.In tannase research report, select different
Substrate and different determination conditions, construct activity determination method with their own characteristics.Measuring method can substantially be divided into: can
See spectrophotometry, titration, view pronunciation, high performance liquid chromatography (HPLC), gas chromatography (GC).The measurement of distinct methods
Principle and superiority and inferiority are as shown in the table.
Tannase activity determination method and feature
And the method that enzymatic activity height is judged by transparent circle diameter mentioned in the present invention, step are simple, it can
Quickly to determine the height of surveyed enzymatic activity.
Detailed description of the invention
Fig. 1 is the screening technique flow chart of tannase producing strains provided in an embodiment of the present invention.
Fig. 2 is that gallic acid absorption peak diagram provided in an embodiment of the present invention is intended to.
Fig. 3 is gallic acid canonical plotting provided in an embodiment of the present invention.
Fig. 4 is the degradation circle schematic diagram that crude enzyme liquid provided in an embodiment of the present invention generates.
Fig. 5 is saccharomycete Morphological Identification schematic diagram provided in an embodiment of the present invention.
Fig. 6 is that tannic acid provided in an embodiment of the present invention absorbs peak figure.
Fig. 7 is tannic acid canonical plotting provided in an embodiment of the present invention.
Fig. 8 is influence schematic diagram of the temperature provided in an embodiment of the present invention to enzymatic activity.
Fig. 9 is influence schematic diagram of the pH provided in an embodiment of the present invention to enzymatic activity.
Figure 10 is influence schematic diagram of the metal ion provided in an embodiment of the present invention to enzymatic activity.
Specific embodiment
In order to make the objectives, technical solutions, and advantages of the present invention clearer, with reference to embodiments, to the present invention
It is further elaborated.It should be appreciated that the specific embodiments described herein are merely illustrative of the present invention, it is not used to
Limit the present invention.
Application principle of the invention is described in detail with reference to the accompanying drawing.
As shown in Figure 1, the screening technique of tannase producing strains provided in an embodiment of the present invention, specifically includes the following steps:
S101: soil sample processing weighs 5.0g soil sample, in the 250mL triangular flask equipped with 45mL enriched medium, is put into several
Small bead, 30 DEG C in shaking table, 180r/min oscillation enrichment culture for 24 hours；
S102: bacterial strain isolates and purifies, and selects the bacterial strain for producing tannase, is forwarded to slant medium culture 3d, is stored in 4
DEG C refrigerator is spare；
S103: bacterial strain shake flask fermentation simultaneously surveys its enzymatic activity, and single colonie is inoculated into enrichment culture liquid after purifying and is trained
It supports 18h, 30 DEG C, 180r/min shaking flask culture 72h and measure its enzymatic activity, determines purpose bacterial strain；
S104: carrying out bacterial strain secondary screening using punch method, prepare crude enzyme liquid, using punch, punch on differential medium,
By in 20 μ L crude enzyme liquid adding holes, 3d is cultivated, the diameter of its degradation circle is seen, carries out the Preliminary Identification of yield of enzyme.
In step S101, soil sample provided in an embodiment of the present invention is taken from Xishuangbanna tea place, Zhang Yu Mo Saier chateau
The soil in vineyard；
In step S102, bacterial strain provided in an embodiment of the present invention is isolated and purified, specifically includes the following steps:
(1) 1.0mL pregnant solution is drawn, after 10 times of gradient dilutions to debita spissitudo, is coated on plate differential medium, in
30 DEG C of constant temperature incubation 3d in incubator；
(2) in purifying of crossing on differential medium, 30 DEG C of constant temperature incubation 3d, Lian Chuan 5 are commissioned to train feeding the single bacterium colony of picking；
(3) height that gallic acid content is known by the shade and diameter of discoloration circle, it is opposite to select enzymatic activity
Higher and more stable bacterial strain is forwarded to slant medium culture 3d, and it is spare to be stored in 4 DEG C of refrigerators.
Contain tannic acid and bromophenol blue indicator in differential medium provided in an embodiment of the present invention, if bacterial strain produces tannin
Enzyme will the tannic acid in hydrolyzing culture medium generate gallic acid, so that the bromophenol blue indicator in culture medium is become yellow from bluish violet
Color retains the bacterial strain for generating transparent circle to form apparent discoloration circle in periphery of bacterial colonies.
In step S103, single colonie provided in an embodiment of the present invention is inoculated into enrichment culture liquid and cultivates 18h, by 10%
Inoculum concentration is linked into liquid fermentation medium.
In step S104, it is relatively high and more stable to choose enzymatic activity for the preparation of crude enzyme liquid provided in an embodiment of the present invention
Single strain GL-4 carry out fermented and cultured, after fermented and cultured 3d, take 2.0mL fermentation liquid in centrifuge tube, 4000r/min, centrifugation
10min takes supernatant, as crude enzyme liquid.
In step S104, punch diameter provided in an embodiment of the present invention is 7mm.
The activity determination method of tannase producing strains provided in an embodiment of the present invention, specifically includes the following steps:
(1) to the molecular biology identification for producing tannase bacterial strain GL-4 progress bacterial strain；GL -4 is rounded, the sticky light in surface
It is sliding, it moistens, opaque, easy picking, the color of edge and central part is all very uniform；Initial stage of culture, the thallus under microscope
It is oval, it is unicellular individual；After cultivating 3d, thallus is larger, with lesser daughter cell on maxicell；The training of GL-4 thallus
The condition of supporting are as follows: 30 DEG C of temperature, the produced tannase optimal reactive temperature of revolving speed 180r/min, GL-4 is 40 DEG C, optimal pH 5, K+、Na+、Mg2+There are certain activation, but Mg to enzymatic activity2+Influence to enzymatic activity is maximum.The produced tannase of GL-4 is extensive
Applied to fields such as tea beverage, juice drink, feed industries.Through molecular biology identification, GL -4 is Candida,
Its DNA sequence dna is shown in annex.The DNA sequence dna that tannase generates saccharomycete GL -4 is SEQ ID NO:1.
(2) to the Morphological Identification for producing tannase bacterial strain GL-4 progress bacterial strain:
1) GL-4 single colonie is taken to break up in sterile water, after diluting suitable multiple, sterile working is coated on tannin and identifies training
It supports on base plate, after 30 DEG C of constant temperature incubation 3d, observes colony morphology characteristic；
2) it observes strain culturing initial stage respectively under an optical microscope and cultivates the cellular morphology after 3d: in sterile working item
Under part, the new fresh thalli of picking minute quantity dips a small amount of sterile water and is diluted rear microscopy in clean glass slide.
Application principle of the invention is further elaborated below with reference to specific experiment；
Experiment 1；
1, the pre-treatment tested
1) soil sample source, from Xishuangbanna tea place, 15 generation chateau of Zhang Yu Mo Saier the soil such as vineyard in bolter
Choosing.
2) preparation of reagent
(1) 5 citric acid-sodium citrate buffer solution of 0.1mol/L pH: 0.1mol/L citric acid solution 82mL (21.01g
After citric acid adds distilled water to dissolve, the constant volume in 1000mL volumetric flask) and 0.1mol/L sodium citrate solution 118mL (29.41g
After sodium citrate adds distilled water to dissolve, the constant volume in 1000mL volumetric flask), up to the lemon of 0.1mol/L pH 5.0 after mixing
Acid buffer is saved backup in 4 DEG C of refrigerators.
(2) 0.05mol/L methanol-rhodanine solution: weighing 0.667g rhodanine and dissolved with methanol, and is settled to 25mL appearance
In measuring bottle.
(3) 0.01mol/L propylgallate (PG) solution: accurately weighing 0.212g propylgallate, with pH 5.0
Citrate buffer solution dissolution, constant volume uses hydrotropy in preceding 50 DEG C of thermostat water baths in 100mL volumetric flask.
(4) 0.5mol/L KOH solution: weighing 2.8g KOH solid, dissolved with distilled water, and constant volume is in 100 mL volumetric flasks.
(5) 1mg/mL gallic acid standard solution: weighing gallic acid standard items 0.100g, with the citric acid of pH 5.0
Buffer solution, constant volume are configured to the titer of concentration 1mg/mL in 100mL volumetric flask.
3) culture medium
(1) seed culture medium (g/L)
Yeast extract 5g, peptone 10g, glucose 10g, NaCl 5g, beef extract 5g, tannic acid (inducer) 10g, 25mL/
250mL conical flask, 121 DEG C of sterilizing 20min.For being enriched with bacterial strain.
(2) plate differential medium (g/L)
A: glucose 20g, peptone 20g, yeast extract 10g, magnesium sulfate 1g, agar 20g；
B: tannic acid 10g, bromophenol blue 0.04g.
115 DEG C of sterilizings 20min, a and b will separate sterilizing, inverted plate after mixing the two when being cooled to 50 DEG C.For dividing
From the bacterial strain that screening produces tannase.
(3) slant medium (g/L)
Potato 200g, by peeling potatoes, stripping and slicing is boiled after 30min with filtered through gauze, and 20 g of sucrose and agar are added
20g, 121 DEG C of sterilizing 20min.For producing the preservation of tannase bacterial strain.
(4) liquid fermentation medium (g/L)
Peptone 20g, yeast extract 10g, sucrose 10g, glucose 20g, magnesium sulfate 1g, dipotassium hydrogen phosphate 1g, tannic acid
20g, 121 DEG C of sterilizing 20min, tannic acid will separate sterilizing with other compositions.
4) the active measuring method of tannase
Under the conditions of 40 DEG C, 1min decomposes enzyme amount needed for substrate PG generates 1 μm of ol gallic acid and is defined as an enzyme activity
Property unit.
(1) determination step
The step of the measurement tannase activity of table 1
All reagents are added, 40 DEG C of water-bath 5min measure its light absorption value respectively.
Δ A=(Atest-Ablank)-(Acontrol-Ablank) (1)
In formula: △ A is trap difference；
AtestFor the light absorption value of testing tube；
AblankFor the light absorption value of blank tube；
AcontrolFor the light absorption value of control tube.
E=(Δ A × S+I)=n × 1000/M × t × V (2)
In formula: E is tannin enzymatic activity (U/mL)；
△ A is trap difference；
S is the slope of standard curve；
I is the intercept of standard curve；
M be gallic acid molecular weight, 188.14；
N is the extension rate of tannin enzyme solution；
T is reaction time (min)；
V is the enzyme solution volume (mL) of reaction.
(2) determination of gallic acid maximum absorption band wavelength
It takes the gallic acid solution 0.5mL that concentration is 1mg/mL that 0.6mL methanol rhodanine solution is added, is put into 40 DEG C of water-baths
5min is kept the temperature in pot, continuously adds the KOH solution of 1.0mL, water-bath 5min.Its peak value is surveyed between visible light 400nm~760nm.
(3) production of gallic acid standard curve
Visible spectrophotometer measured under 520nm wavelength concentration be respectively 0.1,0.2,0.3,0.4,0.5,
The light absorption value of 0.6mg/mL gallic acid standard solution draws gallic acid standard curve.
2, separation screening and the identification of tannase bacterial strain are produced
1) separation screening of tannase bacterial strain is produced
(1) soil sample is handled
5.0g soil sample is weighed, in the 250mL triangular flask equipped with 45mL enriched medium, is put into several small bead,
30 DEG C in shaking table, 180r/min oscillation enrichment culture for 24 hours.
(2) bacterial strain isolates and purifies
1.0mL pregnant solution is drawn, after 10 times of gradient dilutions to debita spissitudo, is coated on plate differential medium, Yu Pei
Support 30 DEG C of constant temperature incubation 3d in case.Contain tannic acid and bromophenol blue indicator in differential medium, if bacterial strain produces tannase
Tannic acid in meeting hydrolyzing culture medium generates gallic acid, and the bromophenol blue indicator in culture medium is made to become yellow from bluish violet,
To form apparent discoloration circle in periphery of bacterial colonies, retain the bacterial strain for generating transparent circle.
Picking produces the single bacterium colony of tannase in purifying of crossing on differential medium, and 30 DEG C of constant temperature incubation 3d, Lian Chuan 5 are commissioned to train
It supports.The height of gallic acid content known to the shade and diameter of discoloration circle.Therefore it is more stable to select enzymatic activity
Bacterial strain is forwarded to slant medium culture 3d, and it is spare to be stored in 4 DEG C of refrigerators.
(3) bacterial strain shake flask fermentation and its enzymatic activity is surveyed
Single colonie is inoculated into enrichment culture liquid after purifying and cultivates 18h, is linked into liquid by 10% inoculum concentration
In fermentation medium, 30 DEG C, 180r/min shaking flask culture 72h and measure its enzymatic activity.
(4) secondary screening (punch method) of bacterial strain
The preparation of crude enzyme liquid: choosing the more stable single strain GL-4 of enzymatic activity and carry out fermented and cultured, after fermented and cultured 3d,
Take 2.0mL fermentation liquid in centrifuge tube, 4000r/min is centrifuged 10min, takes supernatant, as crude enzyme liquid.
It with the punch of diameter 7mm, is punched on differential medium, by 20 μ L crude enzyme liquid adding holes, cultivates 3d, see it
The diameter of degradation circle, carries out the Preliminary Identification of yield of enzyme.
2) identification of bacterial strain
(1) molecular biology identification of bacterial strain
Tannase bacterial strain GL-4 will be produced and be directly fed to company's identification.
(2) Morphological Identification of bacterial strain
Production GL-4 single colonie is taken to break up in sterile water, after diluting suitable multiple, sterile working is coated on tannin and identifies training
It supports on base plate, after 30 DEG C of constant temperature incubation 3d, observes colony morphology characteristic.
It observes strain culturing initial stage respectively under an optical microscope and cultivates the cellular morphology after 3d: in aseptic technique
Under, the new fresh thalli of picking minute quantity dips a small amount of sterile water and is diluted rear microscopy in clean glass slide.
3, result
(1) determination of gallic acid maximum absorption band wavelength
As shown in Fig. 2, gallic acid absorbs peak figure, it is seen that light area carries out wave band scanning to gallic acid, and gallic acid exists
Occurs maximum absorption band at 520nm.
(2) drafting of gallic acid standard curve,
As shown in figure 3, gallic acid canonical plotting, light absorption value of the gallic acid standard solution at 520nm is linear
Correlation, regression equation Y=3.239X-0.0613, coefficient R2=0.9995.The dense of gallic acid is obtained by light absorption value
Degree.
(3) after tannase producing strains shake flask fermentation enzymatic activity measurement result
Single colonie after purification is inoculated into enrichment culture liquid and cultivates 18h, is linked into liquid hair by 10% inoculum concentration
In ferment culture medium, its enzymatic activity, enzymatic activity 244.530U/mL are measured after fermented and cultured 3d.
(4) bacterial strain secondary screening (punch method)
20 μ L crude enzyme liquids are added in each hole, for 24 hours after, have the generation of Yellow degradation circle, illustrate that the bacterium produces tannase.By a,
The size of b loop diameter, it is known that the height of yield of enzyme.
As shown in figure 4, the degradation circle schematic diagram that crude enzyme liquid provided in an embodiment of the present invention generates.
As shown in figure 4, tannase producing strains GL-4 degradation loop diameter is 1.5cm or so.
(5) molecular biology identification
Through molecular biology identification, GL-4 bacterium and the similarity of Candidablankii/Candida sp.SMN04 bacterium are
100%, a category can be classified as according to the kind of sequence homology >=97% of 16SrDNA, then bacterial strain GL-4 can be classified as Candida
Pseudomonas.The bacterial strain belongs to mycota, Ascomycota, yeast guiding principle, Saccharomycetes, Cryptococcaceae.
(6) Morphological Identification of bacterial strain
As shown in figure 5, saccharomycete Morphological Identification schematic diagram provided in an embodiment of the present invention.
In figure: A: the tannase producing strains colonial morphology of GL -4；4 saccharomycete Initial stage of culture (40 ×) of B:GL-；C:GL -4
Saccharomycete culture 3d (40 ×)；4 yeast chromosomal of D:GL-(40 ×).
As shown in the A in Fig. 5, saccharomycete GL-4 is rounded, and surface is sticky smooth, moistens, opaque, is easy picking.Side
The color of edge and central part is all very uniform:
As shown in B, C, D in Fig. 5, Initial stage of culture, the thallus under microscope is oval, is unicellular individual.Training
After supporting 3d, thallus is larger, with lesser gemma on maxicell.The bacterium is bluish violet after dyeing.
4, result:
(1) the methods of enzymatic activity and transparent circle secondary screening are surveyed by shake flask fermentation, isolates and purifies to have obtained 1 plant of production from soil
The bacterial strain GL-4 of tannase.
(2) through molecular biology identification GL-4 Pseudomonas in candidiasis, make so choosing and producing tannase saccharomycete GL-4
Subsequent experimental, and the strain enzyme-producing enzymatic activity is 244.530U/m L.
(3) result of the invention for produce tannase saccharomycete isolate and purify and breeding provides experimental basis.
Experiment 2；The measurement and result of thick enzyme zymologic property
(1) measuring method of thick enzyme zymologic property:
1, influence of the temperature to enzymatic activity
As the temperature rises, enzymatic reaction is accelerated, and enzymatic activity improves.After reaching optimum temperature, temperature continues to rise, enzyme
Albumen starts to be denaturalized, and enzymatic activity weakens.So it is most important to find suitable temperature.
1.0mL crude enzyme liquid, which is added to 5.0mL concentration, is in 10mg/mL tannic acid solution, respectively 30,40,50,60,
70,30min is reacted at 80 DEG C, survey its tannin acid content.
2, influence of the pH to enzymatic activity
The citrate buffer solution that pH is 1,3,5,7,9,11,13 is prepared respectively, and with the buffer concentration of different pH
For 10mg/m L tannic acid solution.1.0mL crude enzyme liquid is added in 5.0mL tannic acid solution, under above-mentioned optimum temperature,
30min is reacted, its tannin acid content is finally surveyed.
3, influence of the species of metal ion to enzymatic activity
Configuration concentration is NaCl, MgSO of 1.5g/L4、AgCl、CuCl2、KCl、CaCl2Solution, and with it is different types of from
Sub- solution compound concentration is 10mg/m L tannic acid solution.1.0mL crude enzyme liquid is added in 5.0mL tannic acid solution, upper
It states under optimum condition, reacts 30min, finally survey its tannin acid content.
(2) result
1, the determination of tannic acid absorption peak wavelength
As shown in fig. 6, maximum absorption band occurs at 640nm in tannic acid, have with document report maximum absorption band 760nm
Difference.
2, the production of tannic acid standard curve
As shown in fig. 7, light absorption value of the tannic acid standard solution at 640nm is linearly related, regression equation y=
0.0136x+0.1425, coefficient R2=0.9977.The concentration of tannic acid is obtained by light absorption value.
3, influence of the temperature to enzymatic activity
As shown in figure 8, the enzymatic activity of crude enzyme liquid also increases with it with the raising of reaction temperature, until 40 DEG C of whens, reach most
Big value continues to increase temperature, then enzymatic activity declines.Therefore, tannase optimal reactive temperature is 40 DEG C, too high or too low enzyme activity
Property can all be affected.
4, influence of the pH to enzymatic activity
As shown in figure 9, enzymatic activity is higher when pH is 3.0~5.0, and as pH 5.0, enzymatic activity highest.
5, influence of the metal ion to enzymatic activity
As shown in Figure 10, Mg2+Influence to enzymatic activity is maximum, K+、Na+Effect take second place.Other metal ions are to enzyme activity
Property influence it is little.
(3) result
The present invention studies its influence to enzymatic activity in terms of temperature, pH, metal ion respectively, obtains the thick enzyme of tannase
Property: optimal reactive temperature is 40 DEG C, optimal pH 5.0；Mg2+、K+、Na+There are activation, but Mg to enzymatic activity2+To enzymatic activity
Influence it is maximum, Ag+、Cu2+、Ca2+Enzymatic activity is influenced little.According to zymologic property it is found that the bacterium can be in acidic environment
Growth, and generate more tannase.
The foregoing is merely illustrative of the preferred embodiments of the present invention, is not intended to limit the invention, all in essence of the invention
Made any modifications, equivalent replacements, and improvements etc., should all be included in the protection scope of the present invention within mind and principle.
Gene order table
<110>Northern National University
<120>a kind of screening for producing tannase candidiasis and its activity determination method
<160> 1
<210> 1
<211> 1361
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
GTCCACGTTCAATTAAGTAACAAGGACTTCTTACATATTCAAAGTTTGAGAATAGGT
CAAGATCGTTTCAATCCCAATACCTCTAATCATTCGCTTTACCTCATAAAACTGATACGAG
CTTCTGCTATCCTGAGGGAAACTTCGGCAGGAACCAGCTACTAGATGGTTCGATTAGTCT
TTCGCCCCTATACCCAAATTTGACGATCGATTTGAACGTCAGAACCGCTACGAGCCTCCA
CCAGAGTTTCCTCTGGCTTCACCCTATTCAGGCATAGTTCACCATCTTTCGGGTCCCAAC
AGCTATGCTCTACTCAAATCCATCAGAAGACGTCAGGATCGGTTGATTGTGCACCCGTGA
GGGCCCCAATCTATTCGCTTTCACTTCGCGTACGGGTTTTACACCCAAACACTCGCATAG
ACGTTAGACTCCTTGGTCCGTGTTTCAAGACGGGTGGAATAGGACTATTACGCCAGGAT
CCTAGCACGAAGCGCGGTCCTCTGTCCAGAATGCCAGTATTCAACCAAAGCTATAACAC
TCCGAAGAGCCACATTCTTTGGGTTTTATCCTGGCCTCCAAACAGATCCTGGCCTAGAAA
ACTGCTAGTGCACAGCCCCGAAAGACTGCTGATAACAGAAATCCAAGTCTAGTCCAATT
CCCTTCCCTTTCAACAATTTCACGTACTTTTTCACTCTCTTTTCAAAGTTCTTTTCATCTTT
CCTTCACAGTACTTGTTCGCTATCGGTCTCTCGCCAATATTTAGCTTTAGATGGAATTTAC
CACCCACTTAGAGCTGCATTCCCAAACAACTCGACTCTTCGAAGGTAAACCACATGAGA
AAGCTACCAATACCACACGGGGCTCTCACCCTCTATGGCGTCCTGTTCCAAGGAACTGA
GGTAAAGGACTAACTCGGAATACCATCTTCAAATTACAATGCGCCTTGTTAGGAGCTTTC
AAATTTGAGCTTTGGCTGCTTCACTCGCCGTTACTAGAGCCATCCCTGTTGGTTTCTTTTC
CTCCGCTTATTGATATGCTTAAGTTCAGCGGGTAATCCTGTCTGATTTGAGGTCAAATTTT
GGAGCGGTTGTTACGCCTGTCTCGAACGAGTGGTTAGACCTAAAACGTTTGAAAGACTT
GCGATTCCTTTTCAACCGATGCCAATACAGGCATCGGTCAACACACAAAACCAAAGGTT
TTATGAGAGGAAATGACGCTCAAACAGACATGCCTTGTGGAATACCACAAGGCGCAATG
TGCGTTCAAAAATTCGATGATTCACAATTCTGCAATTCACATTACGTATCGCATTTCGCTG
CGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTT
Claims (10)
1. a kind of screening technique for producing tannase candidiasis, which is characterized in that the sieve for producing tannase candidiasis
Choosing method the following steps are included:
Step 1: soil sample processing weighs 5.0g soil sample, is placed in the 250mL triangular flask equipped with 45mL enriched medium, is put into several
Small bead, 30 DEG C in shaking table, 180r/min oscillation enrichment culture for 24 hours；
Step 2: bacterial strain isolates and purifies, and selects the more stable bacterial strain of enzymatic activity, is forwarded to slant medium culture 3d, saves
It is spare in 4 DEG C of refrigerators；
Step 3: bacterial strain shake flask fermentation simultaneously surveys its enzymatic activity, and single colonie is inoculated into enrichment culture liquid after purifying and is cultivated
18h, determines purpose bacterial strain by 30 DEG C, 180r/min shaking flask culture 72h and measure its enzymatic activity；
Step 4: carrying out bacterial strain secondary screening using punch method, prepare crude enzyme liquid, and using punch, aperture 7mm is cultivated identifying
It is punched on base, by 20 μ L crude enzyme liquid adding holes, cultivates 3d, seen the diameter of its degradation circle, carry out the preliminary mirror of yield of enzyme
It is fixed.
2. producing the screening technique of the screening technique of tannase candidiasis as described in claim 1, which is characterized in that described
In step 1, soil sample be taken from Xishuangbanna tea place, Zhang Yu Mo Saier chateau vineyard soil.
3. producing the screening technique of tannase candidiasis as described in claim 1, which is characterized in that in the step 2,
Bacterial strain isolate and purify specifically includes the following steps:
(1) 1.0mL pregnant solution is drawn, after 10 times of gradient dilutions to debita spissitudo, is coated on plate differential medium, in culture
30 DEG C of constant temperature incubation 3d in case；
(2) in purifying of crossing on differential medium, 30 DEG C of constant temperature incubation 3d, Lian Chuan 5 are commissioned to train feeding the single bacterium colony of picking；
(3) height that tannase content is known by the shade and diameter of discoloration circle, selects the more stable bacterium of enzymatic activity
Strain, is forwarded to slant medium culture 3d, it is spare to be stored in 4 DEG C of refrigerators.
4. producing the screening technique of tannase candidiasis as described in claim 1, which is characterized in that the differential medium
In contain tannic acid and bromophenol blue indicator, if bacterial strain produce tannase will the tannic acid in hydrolyzing culture medium generate galla turcica
Acid makes the bromophenol blue indicator in culture medium become yellow from bluish violet, forms apparent discoloration circle in periphery of bacterial colonies, retains and produce
Change the bacterial strain of chromosphere.
5. producing the screening technique of tannase candidiasis as described in claim 1, which is characterized in that in the step 3,
Single colonie is inoculated into enrichment culture liquid and cultivates 18h, is linked into liquid fermentation medium by 10% inoculum concentration.
6. producing the screening technique of tannase candidiasis as described in claim 1, which is characterized in that in the step 4,
The preparation of crude enzyme liquid chooses the relatively high and more stable single strain GL-4 of enzymatic activity and carries out fermented and cultured, after fermented and cultured 3d,
Take 2.0mL fermentation liquid in centrifuge tube, 4000r/min is centrifuged 10min, takes supernatant, as crude enzyme liquid.
7. producing the screening technique of tannase candidiasis as described in claim 1, which is characterized in that in the step 4,
Punch diameter is 7mm.
8. a kind of tannase that the screening technique for producing tannase candidiasis as described in claim 1~7 any one obtains
Producing strains, which is characterized in that tannase producing strains GL -4 are rounded, and surface is sticky smooth, moisten, opaque, are easy to choose
It takes, the color of edge and central part is all very uniform；Initial stage of culture, the thallus under microscope is oval, is unicellular
Body；After cultivating 3d, thallus is larger, with lesser daughter cell on maxicell；GL-4 thallus condition of culture are as follows: 30 DEG C of temperature, turn
The produced tannase optimal reactive temperature of fast 180r/min, GL-4 is 40 DEG C, optimal pH 5, K+、Na+、Mg2+Have one to enzymatic activity
Fixed activation, Mg2+Influence to enzymatic activity is maximum.
9. a kind of beverage comprising tannase producing strains described in claim 8.
10. a kind of activity determination method for producing tannase candidiasis as claimed in claim 8, which is characterized in that described
Produce tannase producing strains activity determination method the following steps are included:
(1) to the molecular biology identification for producing tannase bacterial strain GL-4 progress bacterial strain；
(2) to the Morphological Identification for producing tannase bacterial strain GL-4 progress bacterial strain:
1) GL-4 single colonie is taken to break up in sterile water, after diluting suitable multiple, sterile working is coated on tannase and identifies culture
On base plate, after 30 DEG C of constant temperature incubation 3d, colony morphology characteristic is observed；
2) it observes strain culturing initial stage respectively under an optical microscope and cultivates the cellular morphology after 3d: in aseptic technique
Under, the new fresh thalli of picking minute quantity dips a small amount of sterile water and is diluted rear microscopy in clean glass slide.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811550696.XA CN109468239A (en) | 2018-12-18 | 2018-12-18 | It is a kind of produce tannase candidiasis screening and its activity determination method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811550696.XA CN109468239A (en) | 2018-12-18 | 2018-12-18 | It is a kind of produce tannase candidiasis screening and its activity determination method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109468239A true CN109468239A (en) | 2019-03-15 |
Family
ID=65675000
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811550696.XA Pending CN109468239A (en) | 2018-12-18 | 2018-12-18 | It is a kind of produce tannase candidiasis screening and its activity determination method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109468239A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111321086A (en) * | 2020-04-01 | 2020-06-23 | 玉林市容县奇昌种猪养殖有限公司 | Screening method of tannase-producing candida |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1155385A (en) * | 1995-12-07 | 1997-07-30 | 雀巢制品公司 | Tea extract preparation |
| EP1335025A1 (en) * | 2000-10-26 | 2003-08-13 | Eisai Co., Ltd | Diagnostics and examination method for cancer of the colon using tannase as indication |
| WO2009021853A1 (en) * | 2007-08-10 | 2009-02-19 | Leibniz-Institut für Pflanzengenetik und Kulturpflanzenforschung | Eukaryotic promoters for gene expression |
| CN101735957A (en) * | 2010-01-08 | 2010-06-16 | 吉林农业大学 | Screening method and application of bacteria for degrading tartaric acid in wild grape wine |
| CN104543680A (en) * | 2015-01-23 | 2015-04-29 | 绍兴上虞宏晟技术转让服务有限公司 | Health food for resisting fatigue and improving gastrointestinal functions and preparation method of health food |
-
2018
- 2018-12-18 CN CN201811550696.XA patent/CN109468239A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1155385A (en) * | 1995-12-07 | 1997-07-30 | 雀巢制品公司 | Tea extract preparation |
| EP1335025A1 (en) * | 2000-10-26 | 2003-08-13 | Eisai Co., Ltd | Diagnostics and examination method for cancer of the colon using tannase as indication |
| WO2009021853A1 (en) * | 2007-08-10 | 2009-02-19 | Leibniz-Institut für Pflanzengenetik und Kulturpflanzenforschung | Eukaryotic promoters for gene expression |
| CN101735957A (en) * | 2010-01-08 | 2010-06-16 | 吉林农业大学 | Screening method and application of bacteria for degrading tartaric acid in wild grape wine |
| CN104543680A (en) * | 2015-01-23 | 2015-04-29 | 绍兴上虞宏晟技术转让服务有限公司 | Health food for resisting fatigue and improving gastrointestinal functions and preparation method of health food |
Non-Patent Citations (3)
| Title |
|---|
| APINUN KANPIENGJAI ET AL.: "Distribution of tannin-"tolerant yeasts isolated from Miang, a traditional fermented tea leaf (Camellia sinensis var. assamica) in northern Thailand", 《INTERNATIONAL JOURNAL OF FOOD MICROBIOLOGY 》 * |
| 李远华: "《茶叶生物技术》", 30 June 2017, 中国轻工业出版社 * |
| 黄文: "橡椀单宁生物降解及其机理研究", 《中国优秀博硕士学位论文全文数据库（博士） 工程科技Ⅰ辑》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111321086A (en) * | 2020-04-01 | 2020-06-23 | 玉林市容县奇昌种猪养殖有限公司 | Screening method of tannase-producing candida |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106978350B (en) | Aspergillus niger and application thereof in preparation of puerarin compounds | |
| CN107699499B (en) | One Aspergillus oryzae ZA127 and its application | |
| Chowdhury et al. | Production and characterization of pectinase enzyme from Rhizopus oryzae | |
| CN104630076B (en) | High yield amylase monascus parpureus Went（Monascus purpureus）The bacterial strains of Mp 42 and its application | |
| CN105368736A (en) | Bacillus aceticus and application of bacillus aceticus in coffee cherry peel and pulp fermentation vinegar | |
| CN117448182B (en) | Aroma-producing yeast and culture method and application thereof | |
| CN108865910B (en) | Saccharomyces cerevisiae, screening method thereof and application of saccharomyces cerevisiae in blueberry red wine fermentation | |
| US6340586B1 (en) | Strain of the microorganism penicillium oxalicum var. armeniaca and its application | |
| CN109906877A (en) | One kind sticking up squama mushroom novel bacterial and its domesticating cultivation method and application | |
| CN109504613A (en) | A kind of cultural method and its culture medium of Morchella esculenta (L.) Pers mycelium | |
| CN109468239A (en) | It is a kind of produce tannase candidiasis screening and its activity determination method | |
| CN106167781B (en) | A kind of Acetobacter pasteurianus that temperature capacity is excellent and purposes | |
| CN112852780A (en) | Monascus flavus and application thereof in preparing tannase and degrading tannin | |
| CN102021212A (en) | Preparation method of ganoderma polysaccharide | |
| CN106479900B (en) | High yield monascus purpureus penicillium oxalicum Po-25 bacterial strain and application thereof | |
| CN106520576B (en) | A kind of sclerotium mould and its application | |
| Tambuwal et al. | Morphological and biochemical characterization of isolated Aspergillus niger, Saccharomyces cerevisiae and Zymomonas mobilis from local indigenous sources | |
| CN106085880B (en) | A kind of separation method and used medium of smut | |
| CN102199545B (en) | Lachnum singerianum, and method for preparing intracellular melanin through liquid fermentation of lachnum singerianum | |
| CN101265459B (en) | Bacillus cereus CPU0029 strain and method for preparing Caulis Dendrobii alkaloid by using the same | |
| KR100398677B1 (en) | Cultivation Method of mushroom mycelium using citrus juice and mushroom mycelium thereof | |
| WO2020067381A1 (en) | Novel yeast derived from camellia growing in specific region | |
| CN105602856B (en) | Aspergillus niger (Aspergillus niger) An-19 bacterial strain and its purposes and fermentation process of the production for Lovastatin | |
| CN111321086A (en) | Screening method of tannase-producing candida | |
| CN104531570B (en) | Acinetobacter baumannii for producing laccase, method for producing laccase and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190315 |