CN106085880B - A kind of separation method and used medium of smut - Google Patents
A kind of separation method and used medium of smut Download PDFInfo
- Publication number
- CN106085880B CN106085880B CN201610541712.3A CN201610541712A CN106085880B CN 106085880 B CN106085880 B CN 106085880B CN 201610541712 A CN201610541712 A CN 201610541712A CN 106085880 B CN106085880 B CN 106085880B
- Authority
- CN
- China
- Prior art keywords
- smut
- bacterium
- culture
- separation method
- sample
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/02—Separating microorganisms from their culture media
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Virology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Tropical Medicine & Parasitology (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to a kind of separation method of smut and used mediums, separation method includes: that sample is applied ware culture, any nitrogen source is free of in used medium ingredient, contain by mass percentage: carbon source 0.4%-1%, calcium carbonate 0.2%-0.6%, magnesium sulfate 0.01-0.05%, potassium dihydrogen phosphate 0.01-0.03%, agar powder 1.2-2%, pH value 6.5-7.0；Also contain the antibiotic that bacterium can be inhibited without inhibiting fungi in the culture medium；Picking white single colonie, which carries out shaking bacterium, after culture is good cultivates to muddiness is visually seen, if microexamination, without other living contaminants, which is exactly isolated purpose bacterial strain.The present invention largely solves material limitation and this two large problems of a large amount of living contaminants, and to separation material without particular/special requirement, and greatly improve smut isolates and purifies working efficiency.
Description
Technical field
The present invention relates to a kind of strain separating technologies, and in particular to a kind of separation method and used medium of smut.
Background technique
Smut disease is the important disease of one kind of crops, such as dwarf bunt of wheat, rice rice kernel smut, height
Fine strain of millet smut and Ustilago maydis etc. can lead to crop Severe Reduction.On the other hand, the secondary metabolites of some smut
Such as mannose erythrose alcohol ester and ustilagic acid are important natural surfactant, are being studied exploitation in recent years, are answering
With having a extensive future.Development and utilization either to the research of smut disease or to its secondary metabolites, to all kinds of smut
To isolate and purify all be work the most basic in correlative study.That improves smut isolates and purifies working efficiency, can significantly contract
The research duration of short initial stage accelerates development of scientific research.
There are no the methods of special separation smut in publication both at home and abroad at present, and have in some research papers point
From the relevant report for obtaining smut.Probably it is divided into two major classes:
1) smut is obtained with the separation method of general fungi to the material of no smut illness:
This kind of separation method acquires the sample without smut illness generally from nature, through surface sterilization or does not sterilize,
It is trained juice is coated on the nitrogen sources such as PDA, YPD or YM common fungi abundant after sample water liquefaction (adding hydro-abrasions such as water etc.)
It supports in base；It cultivates in suitable temperature and is grown to yeast-like fungi bacterium colony, a large amount of doubtful bacterium colonies of picking shake bacterium culture, a step
Walk the bacterial strain of isolated purifying；Molecular Identification etc. is carried out to determine whether being smut to all isolated bacterial strains.Example
Such as, sheep Song Zhen etc. separates fungi with PDA after sampling in refrigerator, and a smut bacterial strain is obtained from 74 kinds of fungies
(sheep Song Zhen, Feng Guangda, Yao Qing wait the microbe species in houshold refrigerator to investigate [J] biology skill to Pseudozyma aphidis
Art notification, 2013,1 (2): 195-200), and separation process then generally requires picking bacterium colony more greater amount of than 74, finally just obtains
Obtain this smut bacterial strain.For another example tight Asia duckweed etc. carries out bed mud and pedotheque with YM culture medium to yeast-like fungi
Separation, there was only 1 plant in 201 plants of isolated yeast class bacterial strains, (Yan Yaping, Li Zhiying, Dong Minghua wait cloud for smut
The extra large barms group structure of Nanyang ancestor and extracellular enzyme test [J] microorganism journal, 2013,53 (11): 1205-1212)；Together
Sample, separation process needs than 201 greater number of bacterium colonies of bacterial strain of picking to be separated step by step, and identifies one by one.
The disadvantages of this method are: a, general fungi separation process purpose are poor, it can only be as much as possible from material
All suspected fungals are isolated, then identify which bacterial strain is smut one by one from numerous fungies；Entire separation process can not gather
Coke is in target smut.B, the method that judges doubtful bacterium colony artificial in this way based on a, it is possible to can omit, miss smut bacterium
It falls.C, such method specific aim is poor, main reason is that often use culture medium using fungi, as PDA, YM culture medium etc. (all
In addition antibiotic, most of bacterial growth can be inhibited), many number fungies can on these culture mediums normal growth, and
The bacterium colony of the smut and other yeast fungus that grow on these culture mediums is generally all much like, therefore from numerous fungus colonies
In further screening isolate smut, difficulty is still larger, heavy workload.D, the speed of growth of many yeast fungus generally compares
The speed of growth of smut is fast, in addition many moulds contained in raw material can in fungi culture medium fast-growth
(speed of growth of mould than yeast fungus it is long speed faster)；Therefore, it is generally overgrowed in culture medium plate various true
Bacterium bacterium colony, wherein the growing way of filamentous fungi (such as mould) and some yeast fungus is above smut, does not grow up to also in smut
It is covered by the bacterium colony of other bacterium when visible bacterium colony, is difficult to choose smut bacterial strain.E, it needs big to what is separated
It measures bacterial strain and carries out Molecular Identification, expend a large amount of manpower and financial resources.
From the point of view of document report, smut accounts for 0.5% or so in all fungies that such method obtains, and in separation process
The ratio of middle smut bacterium colony is even less.Therefore, think to screen smut from the material of no smut illness in aforementioned manners,
Efficiency is very low, and success rate is very low.
2) selection has the material screening separation smut of smut illness:
Such methods need to choose the material (sick block tissue or in which the black spore of maturation) for having smut illness, to material
It carries out disinfection after processing, then by sick block interior tissue or thinks that the liquid containing smut thallus or spore is placed in PDA or YEPS
Separation screening smut is carried out on the common culture medium of fungi Deng cultivating, and all isolated is doubted after isolating and purifying step by step
It is identified one by one like bacterial strain.For example, collecting conidia powder from smut plant tissue, smut is separated after sterilized
(Martinez C,Roux C,Jauneau A,et al.The biological cycle of Sporisorium
reilianum f.sp.zeae:an overview using microscopy[J].Mycologia,2002,94(3):505-
514；Zahiri A R,Babu M R,Saville B J.Differential gene expression during
teliospore germination in Ustilago maydis[J].Molecular genetics and genomics,
2005,273(5):394-403；Road is beautiful, Yao Yanfei, separation identification [J] Food Science of Wang Xin ustilaginaceae, and 2011
(17):243-245；Elegance, Shi Taiyuan, Zhang Hua wait head smut of sorghum bacterium Techniques of in Vitro Culture [J] food and fermentation work
Industry, 2009 (12): 97-99).In another example to wild rice stem stem, (wild rice stem stem is expanded as smut Ustilago esculenta
The result infected) after surface sterilization, it is sliced etc. with interior tissue as being cultivated in PDA, isolates smut (Cao Gan step by step
Super, Zhang Yafen, Cui Haifeng wait the Changjiang river research [J] the vegetables of wild rice smut separation method, 2015 (22): 195-197).
This method is than the above method 1) there is a stronger specific aim, however its disadvantage is also clearly: a, raw material sources limit
Property processed is larger, and the material that collect smut illness needs to wait the disease time of plant, by vegetative season and ground
Domain limitation；Common smut disease may be easier to be collected into illness material, and uncommon smut resource is then difficult to receive
Collect；The collection of illness material is relatively time consuming laborious.Although b, having surface sterilization to raw material, remain difficult to avoid in a large amount of
Raw fungal contamination, the material that can not be immediately treated after especially remote (strange land) sampling, what material internal was bacterial contamination can
Energy property greatly increases；Endophyte living contaminants degree is still very serious, and it is big to isolate and purify difficulty.C, sampling technique requires high, needs
The development shape that sample collector is familiar with corresponding plants smut pathogeneticing characteristic, can accurately hold inside plant tissues smut spore
State, if material internal smut spore is not yet mature or maturation amount is few, the probability that can grow smut bacterium colony becomes smaller, miscellaneous bacteria bacterium
Fall ratio then opposite increase.D, various yeast-like fungi bacterium colonies and smut bacterium colony are distinguished less in plate, the standard of picking colony
True rate is lower.Therefore, this method is sampled restricted big by material, and living contaminants are still a problem.E, it needs to separation
Larger amount of bacterial strain out carries out Molecular Identification, expends more manpower and financial resources.
To sum up, such separation method needs to obtain the apparent material of smut disease, also needed in separation process step by step
The larger amount of bacterium colony of picking is wanted, and the more bacterial strain of purifying is identified one by one.The acquisition difficulty of material is larger, other yeast
The pollution of class fungi is also more, and the whole efficiency of the method is still lower.
Summary of the invention
The object of the present invention is to provide a kind of separation methods of smut, have to smut and relatively targetedly screen function by force
Can, to material without limitation, bacterial contamination rate can be greatly reduced.
The technical solution of the present invention is as follows: a kind of separation method of smut, comprising:
Sample is applied into ware culture, used medium is solid HFJ culture medium, is free of any nitrogen source in medium component, presses
Mass percent contains: carbon source 0.4%-1%, calcium carbonate 0.2%-0.6%, magnesium sulfate 0.01-0.05%, potassium dihydrogen phosphate
0.01-0.03%, agar powder 1.2-2%, pH value 6.5-7.0；Also containing in the culture medium can inhibit bacterium without inhibiting fungi
Antibiotic；The carbon source is one or more of sucrose, glucose, arabinose, mannitol and sorbierite；
Picking white single colonie, which carries out shaking bacterium, after culture is good cultivates to muddiness is visually seen, if microexamination is without other miscellaneous bacterias
Pollution, then the bacterium is exactly isolated purpose bacterial strain.
Sample of the invention is expected any sample containing smut.
Specifically, being the white colony for selecting no aerial hyphae, no-reflection gloss in cultured plate.
In a specific embodiment, described that bacterium can be inhibited without inhibiting the antibiotic of fungi for streptomysin and cephalo
The mixture of mycin.
In a specific embodiment, the thickness of solid HFJ culture medium is not less than 4 millimeters in plate；If liquid-like
Product apply ware after directly applying ware or appropriate dilution, if solid sample is crushed after then adding sterile water, refinement sample water intaking liquid applies ware.
In a specific embodiment, it after sample applies ware, keeps breathing freely in plate, plate back-off is then placed in constant temperature
In incubator, 24~30 DEG C are cultivated 3~5 days.
In a specific embodiment, picking white single colonie be inoculated in added with can inhibit bacterium without inhibiting fungi
The liquid YEPSL culture medium of antibiotic.
In a specific embodiment, shaking bacterium culture is in the perseverance that temperature is 24~30 DEG C, revolving speed is 150~200rpm
It is cultivated in warm shaking table to visually seeing muddiness.
If what rear picking was got well in culture is not single colonie or has germ contamination, solid HFJ training is coated on after need to diluting again
In the culture dish for supporting base, it is separately cultured again.
Species estimation finally is carried out to purpose bacterial strain.
The present invention also provides a kind of for separating the culture medium of smut, any nitrogen source is free of in medium component, by matter
Amount percentage contains: carbon source 0.4%-1%, calcium carbonate 0.2%-0.6%, magnesium sulfate 0.01-0.05%, potassium dihydrogen phosphate 0.01-
0.03%, agar powder 1.2-2%, pH value 6.5-7.0；The carbon source is sucrose, glucose, arabinose, mannitol and sorb
One or more of alcohol.
Culture medium used in other separation methods reported at present nitrogen source (such as peptone, yeast all rich in
Extract etc.), thus other kinds of microorganism can on such culture medium fast-growth；And in HFJ culture medium of the present invention
Without any nitrogen source, many microorganisms can not just grow on HFJ culture medium, but smut energy normal growth.HFJ cultivates base stage
The screening efficiency for inhibiting other fungus growns, improving to smut of big degree.
The present invention can incite somebody to action subject material without limitation regardless of whether there is or not smut illnesss as long as containing smut in material
It is separated.
It can be seen that entire mask work from the separating step in technical solution of the present invention to be simple and efficient, to material without spy
Different processing requirement only needs simple process sample, living contaminants can be greatly reduced with a kind of culture medium, is disposably separated to black
Powder bacteria strain.If choosing bacterium for the first time and accidentally having living contaminants, is simply diluted to repeat and apply ware separation and can once complete
Separation.
For the working efficiency for improving separation smut, the present invention has smut in the first step is separately cultured apparent
Living contaminants can be greatly reduced in screening effect, and miscellaneous bacteria rate reduces 90% or more, avoid and need in separation fungi conventional method
The a large amount of bacterium colonies of picking and the cumbersome work for needing to identify all bacterial strains one by one, greatly improve the effect for isolating and purifying smut
Rate.
Compared with " material that selection has smut illness carries out screening separation smut " this technology in background technique,
Advantages of the present invention has: (1) sample can be separated without limitation, scientific research personnel from the expected all kinds of samples containing smut
Smut is obtained, the material of smut morbidity is withouted waiting for.(2) sample treatment is simple, only needs dispersion and fining sample；
Without disinfection, and avoid contact of the experimenter to harmful substances such as disinfectants.(3) it is separately cultured in solid HFJ of the present invention
On base, many mushrooms should not be grown, therefore the reduction living contaminants of energy high degree, bacterial contamination rate reduce 90% or more.(4)
Smut on solid HFJ isolation medium of the present invention is generally the white colony without aerial hyphae, no-reflection gloss, herewith shape
State judges to can greatly improve the accuracy of picking purpose bacterium colony.(5) it is based on above-mentioned advantage, the present invention can greatly improve black powder
The mask work efficiency of bacterium.
So the present invention largely solves material limitation and this two large problems of a large amount of living contaminants, to separation material
Material is without particular/special requirement, and greatly improve smut isolates and purifies working efficiency.The present invention has easy to operate, economic reality
With the characteristics of, can be widely from the isolated smut of a variety of materials.
Detailed description of the invention
Attached drawing 1 is separation effect comparison figure of four kinds of culture mediums to no smut illness fernleaf hedge bamboo material.
Specific embodiment
A kind of efficient separation method of smut of the invention, in a preferred embodiment, including it is following
The step of:
1. sample acquires
Sample can be the expected all kinds of samples containing smut, without there is smut illness without limitation.For example,
Have drawn from fernleaf hedge bamboo, reed, Lu Di, sorghum, wild rice stem (wild rice), corn etc..
A fluid sample: it is installed with sterile salable pipe spare.
B solid sample: the solid sample used in 24 hours is loaded stand-by with clean moisture preservation box or sack；Gu if
Body sample needs to transport over long distances or for a long time, is fitted into moisturizing box or sack after wrapping up in 4-10 layers with clean water imbibition paper bag
Transport.
Collected sample should do mask work as early as possible.
2. the preparation of smut isolation medium
It configures solid HFJ isolation medium (the entitled present invention is customized): being free of any nitrogen source in medium component,
By mass percentage, one or more of sucrose, glucose, arabinose, mannitol and sorbierite 0.4%-1%, carbonic acid
Calcium 0.2%-0.6%, magnesium sulfate MgSO4·7H2O 0.01-0.05%, potassium dihydrogen phosphate KH2PO40.01-0.03%, agar
Powder 1.2-2%, surplus are water, pH value 6.5-7.0.
It is autoclaved after the culture medium bottling sealing of configuration.The culture medium to have sterilized can immediately using or put
It sets stand-by.
Streptomysin and cephalosporin are added when this culture medium is in liquid condition, about 65 DEG C, is training both antibiotic
The final concentration supported in base is 80~120 mcg/mls；In the preceding plate of culture medium solidification, make culture medium thickness 4 in plate
~6 millimeters, solidification is stand-by after being cooled to room temperature.The thickness of culture medium is not preferably less than 4 millimeters in plate, otherwise in follow-up cultivation
Easy dehydration is killed.
The antibiotic contained in solid HFJ isolation medium is not limited to streptomysin and cephalosporin, as long as can inhibit thin
A kind of antibiotic or simultaneously Multiple Classes of Antibiotics can be used without inhibiting the antibiotic of fungi that can use in bacterium.
3. sample treatment and painting ware culture
If 3.1 sample fluid samples, then 50-200 microlitres can be directly taken to apply ware after applying ware or appropriate dilution.
If solid samples such as 3.2 sample soil, animal vegetable tissues, then broken after taking 1-5 grams of sample to add 1-3 milliliters of sterile waters
Broken, refinement sample, makes the smut contained in sample dissociate into aqueous as far as possible；Sample handling processes require utensil used
Be it is sterile, avoid other living contaminants outside sample as far as possible.
3.3 take sample treated 50-200 microlitres of aqueous be coated on above-mentioned HFJ and be separately cultured in ware, coat rear plate lid
Upper cover not seal, and keep breathing freely in plate.Then plate back-off is placed in constant incubator, 24~30 DEG C of cultures 3~
5 days (30 DEG C can cultivate for general 3 days, and 24 DEG C or so then need 4 to 5 days).
4. picking smut bacterium colony initial gross separation
Miscellaneous bacteria is very rare in cultured plate, and without aerial hyphae, no-reflection gloss white colony generally
It is smut bacterium colony；It is all white colony, but form is discrepant, it is possible to be different smut type.Direct picking this
It is 80~120 mcg/ml streptomysins and head that off-white color single colonie (ensure picking is single colonie), which is inoculated in added with concentration,
P0-357 (or other antibiotic for changing bacteria growth into) liquid YEPSL culture medium (0.8~1.2% yeast extract,
0.3~0.5% peptone and 0.3~0.5% sucrose) in.In the constant temperature that temperature is 24~30 DEG C, revolving speed is 150~200rpm
It is cultivated in shaking table to visually seeing muddiness.
It takes muddy 3~10 microlitres of bacterial culture fluid to instill in clean glass slide, observes under the microscope, if without other
Living contaminants, then the bacterium is exactly isolated purpose bacterial strain.
In the step, liquid YEPSL culture medium used can change common fungi liquid culture medium into, or use liquid
(agar is not added, other components and proportion are identical as step 2 in HFJ culture medium；It can be filtered when shaking bacterium with HFJ liquid culture using lid
The ventilative bottle of bacterium or pipe are cultivated, and incubation time suitably increases 1-3 days).Fluid nutrient medium all need to be 80 added with final concentration
~120 mcg/ml streptomysins and cephalosporin (or other antibiotic for changing bacteria growth into).
5. purifying again
If above-mentioned step 4 picking is not there are living contaminants in single colonie or micro- sem observation, need to purify again.
According to bacterium solution turbidity, 0.5~2 microlitre of bacterium solution is taken to be diluted in 1ml sterile water, takes 50~100 microlitres to be coated with after mixing again
It is separately cultured in ware in above-mentioned HFJ, is separately cultured again.Repeat step 4.Smut bacterium can be purified by generally arriving this
The mask work of strain, smut is completed to this.
6. bacterial strain is identified
It is which kind of category to further clarify separated smut, then needs to carry out Species estimation.Smut identification can be used
The universal method of fungal molecule identification, such as ITS, 18S and 28S DNA sequence dna etc..
Below by way of specific embodiment and comparative experiments, the present invention will be described in detail.
Embodiment one
The embodiment is to separate smut from the fernleaf hedge bamboo of no smut illness.
Several solid mediums are configured, final filtration obtains potato juice after respectively 1. PDA:200g peeled potatoes are to boil water
About 800ml, adds 20g glucose, 17g agar powder, and natural ph adds pure water to be settled to 1L.2. YEPSL: yeast extract 1%,
Peptone 0.4%, sucrose 0.4% and agar powder 1.7%, natural ph；In addition, agar powder is not added in YEPSL fluid nutrient medium.③
YPD: yeast extract 1%, peptone 2%, glucose 2% and agar powder 1.7%.4. HFJ isolation medium: sucrose 0.4%,
Calcium carbonate 0.5%, magnesium sulfate 0.02%, potassium dihydrogen phosphate 0.02%, agar powder 1.5% adjust pH value to 6.8.
Above-mentioned several culture medium bottling sealings, 115 DEG C, 0.20Mpa autoclave sterilization 18 minutes.Add the culture of agar powder
Streptomysin is added when being cooled to 60-65 DEG C for base and cephalosporin, the two final concentration are 100 mcg/mls.It is subsequently poured into sterile
Plate in culture medium thickness be about 5 millimeters, solidification is stand-by after being cooled to room temperature.YEPSL fluid nutrient medium is used for picking colony
Shake bacterium culture.
Disposable PE gloves are worn, with sterile scissors, are cut from the fernleaf hedge bamboo in institute, Hemp Inst., China Academy of Agricultural Sciences
The blade by base portion is taken, is fitted into clean disposable valve bag.Put in 4 DEG C of refrigerators it is stand-by, and in 12 hours for separating
Experiment.
Mortar toasts 2 hours through 110 DEG C, and after being cooled to room temperature, 2ml sterile water is added；Shred bamboo branch (including the leaf of bamboo and branch
Item) sample, claim 2g mixing sample, is put into mortar and smashs to pieces, stir evenly.1. -4. four kind 100 microlitres of aqueous are respectively drawn to be coated on
On culture medium plate, open-ended after plate lid is covered, back-off plate, which is placed in 28 DEG C of incubators, to be cultivated 3 days.
Cultivation results such as Fig. 1.96 yeast-like colonies are wherein picked them separately from PDA and YEPSL plate, are chosen from YPD
Whole bacterium colonies totally 15 are taken, the picking 10 white single colonies from HFJ；It is inoculated in every hole respectively and contains 200 microlitres of YEPSL liquid
In sterile 96 orifice plate of culture medium (being the streptomysin and cephalosporin of 100 mcg/mls added with concentration), 28 are put in after sealing
DEG C, cultivate 2 days in the shaking table of 180rpm revolving speed.
5 microlitres of bacterium solutions drop micro- sem observations on slide are taken after culture is good from 96 orifice plates, from thalli morphology judgement be
It is no to have living contaminants and doubtful smut number, as a result such as table 1.Doubtful smut is the warp concluded according to a variety of smut forms
Work is tested to judge.In this result, 1 of PDA and 2 doubtful smut bacterium colonies of YEPSL are mixing bacterium colony, need to repeat to divide
From purifying.
Table 1 is counted without the separating effect of smut illness fernleaf hedge bamboo material
ITS sequence identification: strain gene group DNA is extracted, with fungi ITS sequence primer I TS1 and ITS4 (ITS1:5'-
TCCG TAGG TGAA CCTG CGG-3 ', ITS 4:5'-TCCT CCGC TTAT TGAT ATGC-3 ') to these bacterial strain bases
Because group DNA carries out PCR amplification, is compared and analyzed with Blastn on NCBI after being directly sequenced with PCR product.The results show that HFJ points
Separating out 10 bacterial strains come is the Pseudozyma aphidis in Ustilaginaceae；And 2 that YEPSL is separated are doubtful black
1 is smut Pseudozyma aphidis in powder bacterium.
By Fig. 1 and 1 data of table as it can be seen that the present invention shows the efficiency for separating smut bacterial strain in the material of no smut illness
It writes and improves.(in Fig. 1: the most yeast class bacterium colonies grown in the fungi culture mediums such as PDA, YEPSL are that surface is smooth, reflective
Bacterium colony, part also have other colors；And the smut bacterium colony in HFJ culture medium of the present invention is the white bacterium of no-reflection gloss
It falls, has significant difference with the yeast class bacterium colony of other culture mediums, can with the naked eye distinguish easily.But since Fig. 1 is by being defined as black and white
Picture, thus notable difference can not be identified on this picture.)
Embodiment two
The embodiment is that (it is ustilago esculenta that wild rice stem stem expands to separation smut from the wild rice stem for having smut illness
The result that Ustilago esculenta infects).
The present embodiment place different from embodiment one is: only preparing the solid and liquid of HFJ solid medium and YEPLS
Culture medium.Compare the separating effect that both culture mediums expand wild rice stem material to stem.Wherein, solid HFJ is separately cultured basigamy
It is more slightly different than with embodiment one: glucose 1%, calcium carbonate 0.2%, magnesium sulfate 0.05%, potassium dihydrogen phosphate 0.03%, agar
Powder 2%, pH value 6.5.
15 bacterium colonies of each picking are identified from every kind of culture medium, as a result: the ferment obtained is separated from YEPSL culture medium
Female class bacterium colony is all saccharomycete；And it is isolated there are two types of smut from HFJ culture medium, it is Ustilago respectively
Esculenta and Pseudozyma aphidis.
The ITS sequence sequencing result of two of them smut is respectively as follows:
>ITS Ustilago esculenta
TTCTTGAGGTGTGGCTCGCACCTGTCTAACTAAATCGAGCTACCACATTTTAACACGGTTGCATCGGTT
GGCTGTCAAACAGTGCGCGCGGCGAATTCATTTTCGCCCGCGCTCTGCGAGACGGTCGACACTTTACCAAAAACACT
GTTGATACCATAGGATTTGAACGTAGATGAAACTCGACTGGTAATGCGGTCGTCTAAAATCTAAAAACAACTTTTGG
CAACGGATCTCTTGGTTCTCCCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAAGTGAATC
ATCGAATCTTTGAACGCACCTTGCGCTCCCGGCAGATCTAATCTGGGGAGCATGCCTGTTTGAGGGCCGCGAATTGT
TTCGAACGACAGCTTTCTTATTTAGTTGAGAGAGCTGGCGGATCGGTATTGAGGGTCTTGCCATTTTCCACGGTGGC
TCCCTCGAAATGCATTAGCGCATCCATTCGATAGGCAAGACGGACGAAAGCTCGTTATTTCGCCCACGTCTTTCCCT
GCCGGGTTTTGATAATATCAGGACTTCGGAGAGGAAAGGCGCTGGGTCGAGGAGCTGGACGCGACGTTTTGCTGGTT
GGAGTGCTTCTGAACCCCGCCCATGCCTCCTTCTCCGGAAGAGGAAGGGATTTAATTTCAATTCATCGGCCTCAGAT
TGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA
>ITS Pseudozyma aphidis
TTCTTGAGGTGTGGCTCGCACCTGTCTAACTAAATCGAGCTACCACATTTTAACACGGTTGCATCGGT
TGGCTGTCAAACAGTGCGCGCGGCGATTTATTTCGCCTCCCCGCGCATTGCCGAGACGGTCGACATTTACCAAAAA
CACTGTTGATACCATAGGATTTGAACGTAGATGAAACTCGACTGGTAATGCGGTCGTCTAAAATCTAAAAACAACT
TTTGGCAACGGATCTCTTGGTTCTCCCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAAG
TGAATCATCGAATCTTTGAACGCACCTTGCGCTCCCGGCAGATCTAATCTGGGGAGCATGCCTGTTTGAGGGCCGC
GAATTGTTTCGAACGACAGCTTTCTTATTTAGTTGAGAAAGCTGGCGGATCGGTATTGAGGGTCTTGCCATCTTCC
ACGGTGGCTCCCTCGAAATGCATTAGCGCATCCATTCGATAGGCAAGACGGACGAAAGCTCGTTATTTCGCCCACG
TCTTTCCCTGCCGGGTTTTGATAATATCAGGACTTCGGAGAGGAGAGGCGCAGGGTCGAGGAGCTGGACGCGACGT
TTTGCTGGTTGGAGTGCTTCTGAACCCCGCCCATGCCTCGCTTCTTTGGAAGAGAGGAAGGGATTTAATTTCAATT
CATCGGCCTCAGATTGGTAGGACTACCCGCTGAACTTAAGCATATCAaTAA
It can be seen that the efficiency that the present invention separates smut from the material for having smut illness also significantly improves.
Embodiment three
The embodiment is to separate smut from the storage paddy of no smut illness.
The present embodiment place different from embodiment two is: only preparing HFJ solid medium and YEPLS fluid nutrient medium.
Wherein, solid HFJ isolation medium proportion is slightly different with embodiment two: mannitol 1%, calcium carbonate 0.4%, magnesium sulfate
0.04%, potassium dihydrogen phosphate 0.05%, agar powder 2%, pH value 7.0.
It is separately cultured after the storage paddy of no smut illness is ground.
The white colony of 10 no-reflection gloss of last picking carries out culture identification, ITS sequence comparison result: 8 bacterium colonies
It is Ustilago esculenta (alignment similarity 100% in NCBI)；Pseudozyma in other 2 bacterium colonies and NCBI
Antarctica similarity is 100%.
> ITS Ustilago esculenta (paddy)
TTTTCTTGAGGTGTGGCTCGCACCTGTCTAACTAAATCGAGCTACCACATTTTAACACGGTTGCATCGG
TTGGCTGTCAAACAGTGCGCGCGGCGAATTCATTTTCGCCCGCGCTCTGCGAGACGGTCGACACTTTACCAAAAACA
CTGTTGATACCATAGGATTTGAACGTAGATGAAACTCGACTGGTAATGCGGTCGTCTAAAATCTAAAAACAACTTTT
GGCAACGGATCTCTTGGTTCTCCCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAAGTGAA
TCATCGAATCTTTGAACGCACCTTGCGCTCCCGGCAGATCTAATCTGGGGAGCATGCCTGTTTGAGGGCCGCGAATT
GTTTCGAACGACAGCTTTCTTATTTAGTTGAGAGAGCTGGCGGATCGGTATTGAGGGTCTTGCCATTTTCCACGGTG
GCTCCCTCGAAATGCATTAGCGCATCCATTCGATAGGCAAGACGGACGAAAGCTCGTTATTTCGCCCACGTCTTTCC
CTGCCGGGTTTTGATAATATCAGGACTTCGGAGAGGAAAGGCGCTGGGTCGAGGAGCTGGACGCGACGTTTTGCTGG
TTGGAGTGCTTCTGAACCCCGCCCATGCCTCCTTCTCCGGAAGAGGAAGGGATTTAATTTCAATTCATCGGCCTCAG
ATTGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA
>ITS Pseudozyma antarctica
TTTTCTTGAGGTGTGGCTCGCACCTGTCTAACTAAATCGAGCTACCACATTTTAACACGGTTGCATCGG
TTGGCTGTCAAACAGTGCGCGCGGCGAATTCATTTTCGCCCGCGCTCTGCGAGACGGTCGACACTTTACCAAAAACA
CTGTTGATACCATAGGATTTGAACGTAGATGAAACTCGACTGGTAATGCGGTCGTCTAAAATCTAAAAACAACTTTT
GGCAACGGATCTCTTGGTTCTCCCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAAGTGAA
TCATCGAATCTTTGAACGCACCTTGCGCTCCCGGCAGATCTAATCTGGGGAGCATGCCTGTTTGAGGGCCGCGAATT
GTTTCGAACGACAGCTTTCTTATTTAGTTGAGCGAGCTGGCGGATCGGTATTGAGGGTCTTGCCATTTTCCACGGTG
GCTCCCTCGAAATGCATTAGCGCATCCATTCGATAGGCAAGACGGACGAAAGCTCGTTATTTCGCCCACGTCTTTCC
CTGCCGGGTTTTGATAATATCAGGACTTCGGAGAGGAAAGGCGCTGGGTCGAGGAGCTGGACGCGACGTTTTGCTGG
TTGGAGTGCTTCTGAACCCCGCCCATGCCTCCTTCTCCGGAAGAGGAAGGGATTTAATTTCAATTCATCGGCCTCAG
ATTGGTAGGACTACCCGCTGAACTTAAGCATATCAATA
Example IV
The embodiment is to separate smut from the reed stems and leaves of no smut illness.
The present embodiment place different from embodiment three is: separation object is different.Acquire reed stems and leaves, a little sample of clip
Separating experiment is carried out after grinding.
The white colony of 8 no-reflection gloss of last picking carries out culture identification, and ITS sequence comparison result: 8 bacterium colonies are equal
It is Pseudozyma hubeiensis (alignment similarity 100% in NCBI)
>ITS Pseudozyma hubeiensis
TTTTCTGAGGTGTGGCTCGCACCTGTCCAACTAAACTTGAGCTACCTTTTTTATACACGGTTGCATCGG
TCGGCCTGTCCAACAGTGCGGGAATGTATTTTCCGGCGCTGAGCAGACGAGTCGGCACTTTACACAAACACTTTTGA
TAATCTAGGATTTGAATGAAAGTTCATTTTTATGATGGATCCGACTGGTAATGCGGTCGTCTAAATCTAAAAAACAA
CTTTTGGCAACGGATCTCTTGGTTCTCCCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAA
GTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCCGGCAGATCTAATCTGGGGAGCATGCCTGTTTGAGGGCCGC
GAATTGTTTCGAACGACAGCTTTTTTCAGTAAGAGCTGGCGGATCGGTATTGAGGGTCTTTTTGCCATTTACCGTGG
CTCCCTCGAAATGCATTAGCGCATCCATTTGATAGGCGAAAGACGGACGAAAGCTTGATTTTTCGCCCTCTCTTCCC
TGCCGGGTTTTGATAATATCAGGACTTCGGAGGCGGAGAAAGGGTTAGAGCTGGACGCAACGACTTTTGCTGGTTGG
AGTGCTTCTGAACCCCGCCCTTTCTGTCAGAGAAAGGGATCTAATTTCAATTCATCGGCCTCAGATTGGTAGGACTA
CCCGCTGAACTTAAGCATATCA
Can be seen that the present invention from above-mentioned 4 embodiments can fast and efficiently divide from the various materials for having smut
Smut is separated out, the mask work efficiency of smut is greatly improved.
Claims (9)
1. a kind of separation method of smut, characterized by comprising:
Sample is applied into ware culture, used medium is solid HFJ culture medium, any nitrogen source is free of in medium component, by quality
Percentage contains: carbon source 0.4%-1%, calcium carbonate 0.2%-0.6%, magnesium sulfate 0.01-0.05%, potassium dihydrogen phosphate 0.01-0.03%, fine jade
Cosmetics 1.2-2%, pH value 6.5-7.0；Also contain the antibiotic that bacterium can be inhibited without inhibiting fungi in the culture medium；The carbon
Source is one or more of sucrose, glucose, arabinose, mannitol and sorbierite；
Picking white single colonie, which carries out shaking bacterium, after culture is good cultivates to muddiness is visually seen, if microexamination is without the dirt of other miscellaneous bacterias
Dye, then the bacterium is exactly isolated purpose bacterial strain.
2. the separation method of smut according to claim 1, it is characterised in that sample is expected appointing containing smut
What sample；It is described that bacterium can be inhibited without inhibiting the antibiotic of fungi for the mixture of streptomysin and cephalosporin.
3. the separation method of smut according to claim 1, it is characterised in that the thickness of solid HFJ culture medium in plate
Not less than 4 millimeters；If fluid sample applies ware after directly applying ware or appropriate dilution, if solid sample is broken after then adding sterile water
Broken, refinement sample water intaking liquid applies ware.
4. the separation method of smut described according to claim 1 ~ one of 3, it is characterised in that after sample applies ware, keep plate
It is interior ventilative, then plate back-off is placed in constant incubator, 24~30 DEG C are cultivated 3~5 days.
5. the separation method of smut according to claim 1, it is characterised in that it is raw to select no gas in cultured plate
Mycelia, no-reflection gloss white colony.
6. the separation method of smut described in one of according to claim 1 ~ 3 and 5, it is characterised in that picking white single colonie connects
Kind is in added with the liquid YEPSL culture medium that can inhibit antibiotic of the bacterium without inhibiting fungi.
7. the separation method of smut according to claim 6, it is characterised in that shake bacterium culture be temperature be 24~30
DEG C, cultivate to visually seeing muddiness in the constant-temperature table that revolving speed is 150~200rpm.
8. according to claim 1 ~ 3, separation method of smut described in one of 5 and 7, it is characterised in that if picking after culture is good
Be not single colonie or have germ contamination, be coated on after need to diluting in the culture dish of solid HFJ culture medium, carry out again again
It is separately cultured.
9. the separation method of smut according to claim 1, it is characterised in that purpose bacterial strain carries out Species estimation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610541712.3A CN106085880B (en) | 2016-07-11 | 2016-07-11 | A kind of separation method and used medium of smut |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610541712.3A CN106085880B (en) | 2016-07-11 | 2016-07-11 | A kind of separation method and used medium of smut |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106085880A CN106085880A (en) | 2016-11-09 |
| CN106085880B true CN106085880B (en) | 2019-08-30 |
Family
ID=57219615
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610541712.3A Active CN106085880B (en) | 2016-07-11 | 2016-07-11 | A kind of separation method and used medium of smut |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106085880B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109554498B (en) * | 2018-12-21 | 2021-09-10 | 中国计量大学 | Molecular marker for identifying early-late maturing characteristics of single-cropping water bamboo and application and acquisition method thereof |
| CN113881574A (en) * | 2021-10-22 | 2022-01-04 | 贵州黔西南喀斯特区域发展研究院(黔西南州农业林业科学研究院) | Coix lacryma-jobi smut bacteria separation and purification culture method |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB686486A (en) * | 1949-11-24 | 1953-01-28 | Honorary Advisory Council Sci | Antibiotics produced by fungi of the genus ustilago |
| CN105400890A (en) * | 2015-12-22 | 2016-03-16 | 贵州省亚热带作物研究所 | Method for detecting coix ustilago scitaminea |
| CN105543109A (en) * | 2016-01-28 | 2016-05-04 | 中国计量学院 | Culture medium capable of maintaining in-vitro growth of hyphae of ustilago esculenta |
| WO2016103140A1 (en) * | 2014-12-23 | 2016-06-30 | B.R.A.I.N. Aktiengesellschaft Biotechnology Research And Information Network Ag | Process for the production of malate |
-
2016
- 2016-07-11 CN CN201610541712.3A patent/CN106085880B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB686486A (en) * | 1949-11-24 | 1953-01-28 | Honorary Advisory Council Sci | Antibiotics produced by fungi of the genus ustilago |
| WO2016103140A1 (en) * | 2014-12-23 | 2016-06-30 | B.R.A.I.N. Aktiengesellschaft Biotechnology Research And Information Network Ag | Process for the production of malate |
| CN105400890A (en) * | 2015-12-22 | 2016-03-16 | 贵州省亚热带作物研究所 | Method for detecting coix ustilago scitaminea |
| CN105543109A (en) * | 2016-01-28 | 2016-05-04 | 中国计量学院 | Culture medium capable of maintaining in-vitro growth of hyphae of ustilago esculenta |
Non-Patent Citations (1)
| Title |
|---|
| 低营养细菌分泌胞外黏性物质适宜营养条件的探索;潘惠霞 等;《干旱区研究》;20100115;第27卷(第1期);第109-113页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106085880A (en) | 2016-11-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103627662B (en) | A kind of Bradyrhizobium sp Arachis and uses thereof | |
| CN107974427B (en) | Marine streptomyces with bacteriostatic activity | |
| CN102154194B (en) | Preparation method for high-yield chlamydospore liquid fermentation from trichoderma on pilot plant test scale | |
| CN111040976B (en) | Bacillus amyloliquefaciens and application thereof | |
| CN104988082B (en) | The inferior Dbaly yeast bacterial strain of one plant of Chinese and its application | |
| CN106434409A (en) | Streptomyces hydrogenans OsiLf-2 capable of effectively antagonizing magnaporthe oryzae in vitro | |
| CN103160442A (en) | Paecilomyceslilacinus strain having strong pathogenicity for diaphorina citri | |
| CN113801808B (en) | Streptomyces albocongensis and application thereof | |
| CN112812971B (en) | Agrocybe aegerita symbiotic fungus M2-1, and microbial inoculum and fermentation broth extract thereof | |
| CN108504594A (en) | One plant of quasi- application without mycolic acids bacterium and its in preparing anti-notoginseng root rot agent | |
| CN103243030B (en) | Lecanicilliumpsalliotae strain used for preventing and treating diaphorina citri | |
| CN103131656A (en) | Streptomyces YT027 and application thereof | |
| CN113061551B (en) | Application of biocontrol streptomyces in preventing and treating plant disease pathogenic bacteria | |
| CN102835288A (en) | Method for establishing disease garden to identify soil-borne diseases | |
| CN108913622B (en) | Bacillus megaterium BM22 and preparation and application of spore powder thereof | |
| CN106085880B (en) | A kind of separation method and used medium of smut | |
| CN110343621A (en) | A kind of Trichoderma asperellum strain and its application | |
| CN109735475A (en) | One plant of acidproof bacillus amyloliquefaciens for producing 3-hydroxy-2-butanone and its application | |
| CN109182151A (en) | The separating screening method of gingko endogenous fungus | |
| CN109182216B (en) | Marine streptomyces SCFJ-05 with inhibition effect on succulent plant stem rot | |
| CN105462854B (en) | Application of the sophora tonkinensis Gapnep endogenetic fungus SDTE-P in prevention and treatment Radix Notoginseng anthracnose | |
| CN104087526B (en) | A kind of bacillus licheniformis is utilized to control the method for earthy in white wine | |
| CN114032182B (en) | Fungus with functions of antagonizing pathogenic bacteria of garlic root rot and promoting growth | |
| CN106479900B (en) | High yield monascus purpureus penicillium oxalicum Po-25 bacterial strain and application thereof | |
| CN110373344A (en) | Carp streptomycete and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |