CN109452265A - It reduces Cellular stress injury and improves the Y of cryopreservation effect2SK2Dehydrins - Google Patents
It reduces Cellular stress injury and improves the Y of cryopreservation effect2SK2Dehydrins Download PDFInfo
- Publication number
- CN109452265A CN109452265A CN201811347978.XA CN201811347978A CN109452265A CN 109452265 A CN109452265 A CN 109452265A CN 201811347978 A CN201811347978 A CN 201811347978A CN 109452265 A CN109452265 A CN 109452265A
- Authority
- CN
- China
- Prior art keywords
- apy
- solution
- cryopreservation
- seedling
- dehydrin protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N3/00—Preservation of plants or parts thereof, e.g. inhibiting evaporation, improvement of the appearance of leaves or protection against physical influences such as UV radiation using chemical compositions; Grafting wax
Abstract
The invention discloses a kind of reduction Cellular stress injury and the Y of improvement cryopreservation effect2SK2Dehydrins；The ability that there is this albumen Scavenger of ROS to reduce Cellular stress injury, can be effectively improved recovery percentage after the jelly of cell, hence it is evident that promote cryopreservation efficiency.Specific method is the method enriching and purifying Afriocan agapanthus Y using prokaryotic expression2SK2Type dehydrin protein (ApY2SK2), reacting using Fenton proves ApY2SK2To the regulating and controlling effect of ROS metabolism, ApY is verified using plant cryopreservation evaluation model2SK2To the improvement of plant cell cryopreservation.It specifically includes: adding 2 μm of ol/L ApY in ultralow-temperature glass solution2SK2Albumen makes survival rate after vegetable jelly improve 1 times or more.Activity and preservation efficiency optimization are significant after method disclosed in the present invention freezes Scavenger of ROS, the injury of reduction Cellular stress, promotion cell cryopreservation.
Description
Technical field
The present invention relates to the preservation fields of vegetable material, and in particular to one kind can reduce plant cell stress damage, excellent
Change the Y of preservation of plant vitrification ultra-low temperature effect2SK2Type dehydrin protein.
Background technique
Cryopreservation is the biotechnology that biomaterial is stored in -80 DEG C or less low temperature.It is saved the cell of material
Division, growth metabolism activity almost stop, and are in metastable biological condition, can be by long-term preservation, and can be most
Its genetic stability of the big preservation of degree, is the technology of the currently the only medium-term and long-term preservation germ plasm resource for not needing continuous subculture.
Cryopreservation by vitrification is to be placed in cell or tissue to be made of a certain proportion of permeability and impermeability protective agent
In vitrification solution, material and its vitrification solution is made to be solidified into amorphous glassy state under sufficiently fast rate of temperature fall,
And it is saved at low temperature with this glassy state.Vitrification is at low cost because simple and quick, is suitable for that save type extensive, protects
Material genetic stability is deposited, the advantages that preservation effect is good, is the excellent process for saving for a long time in germ plasm resource.But ultralow
During temperature saves, plant tissue or cell can also face serious permeating and dewatering, ROS oxidative stress, Ion toxicity, fatal ice
The injury of the various abiotic stress such as crystalline substance, will lead to the death of plant cell.Therefore, cryopreservation body is optimized by outer source protection substance
System, is that vegetable material is protected to improve the effective way for saving efficiency, has most important theories to Plantlet in vitro long-term in isolated cells
Meaning and application value.Arabidopsis thaliana Seedlings are the important materials of plant cryopreservation basic research.By count its jelly after it is extensive
Multiple growth rate can be imitated with the protective effect of Fast Evaluation additives confrontation vegetable material and the optimization of cryopreservation system
Fruit.
Dehydrins (Dehydrin) belong to cell stage development advanced stage abundance protein second family (group II of Late
Embryogenesis Abundant proteins, LEAII), have the characteristics that high-hydrophilic, randomness and inoxidizability.It is logical
The often largely enrichment accumulation in the embryo in Embryos Development of Plant advanced stage, correlative study discovery dehydrin protein, which has, prevents albumen from becoming
Property, stablize plasma structure, in conjunction with excess ions, alleviate the functions such as stress damage, be a kind of close with plant cell serious dehydration
Relevant protection albuminoid.The special defencive function of dehydrin protein has important application potential, but there is no in phase at present
Technical field is closed to develop and apply.
Summary of the invention
In view of techniques described above background, the purpose of the present invention is to provide a kind of injury of reduction Cellular stress and improve super
The Y of cryo-conservation effect2SK2Dehydrins；The present invention is obtaining Afriocan agapanthus dehydrin protein ApY2SK2On the basis of encoding gene,
Have the characteristics that the method for thermal stability and bioengineering using the albumen, one kind is provided and efficiently induces and purifies ApY2SK2Dehydration
The method of fibroin, and albumen after purification is applied to cryopreservation system field, ApY in such a way that external source is added2SK2
Dehydrins have safety and broad spectrum activity effect for optimization plant cryopreservation technology, while demonstrating ApY2SK2It can be effective
Scavenger of ROS (reactive oxygen species, ROS) reduces the oxidative stress during saving caused by plant
Injury.The present invention is specifically to provide a kind of albumen with antioxidation, optimizes existing cryopreservation technical system, is promoted
The cryopreservation effect of vegetable material, can be applied to the preservation steady in a long-term of plant germplasm resource.
To achieve the goals above, the present invention is achieved by the following technical solutions:
In a first aspect, the present invention relates to a kind of Afriocan agapanthus dehydrin protein ApY2SK2In plant cell anti-oxidation protection
Purposes.
The Afriocan agapanthus dehydrin protein ApY2SK2For the dehydrin protein of purification.
Preferably, the dehydrin protein ApY2SK2For inhibiting the generation of hydroxy radical.In plant cell, H2O2Energy
It is enough reacted by Fenton and generates hydroxy radical (OH), the ApY is added in Fenton reaction system in vitro2SK2Albumen, it is right
The generation of hydroxy radical has significant inhibitory effect.
Hydroxy radical (OH) is the important composition ingredient of ROS, detects ApY2SK2The removing of hydroxy radical (OH) is made
With can confirm ApY2SK2The protective effect that cellular oxidation in Cryopreservation is coerced.
Second aspect, the present invention relates to a kind of Afriocan agapanthus dehydrin protein ApY2SK2It is used as in cryopreservation system thin
Purposes in born of the same parents' tissue oxidizing stress protectant.
Preferably, the dehydrin protein ApY2SK2For inhibiting the generation of hydroxy radical.
The third aspect, the present invention relates to a kind of vitrification ultra-low temperatures to save solution, and the solution is to contain 20-40%w/v
Glycerine, 10-20%w/v ethylene glycol, 10-20%w/v dimethyl sulfoxide, 0.2-0.6mol/L sucrose and 0-2 μm of ol/L hundred
Sub- lotus dehydrin protein ApY2SK2MS culture solution.It is further preferred that the solution is to contain 30%w/v glycerine, 15%w/v second two
Alcohol, 15%w/v dimethyl sulfoxide, 0.4mol/L sucrose and 0.5-2 μm of ol/L Afriocan agapanthus dehydrin protein ApY2SK2MS training
Nutrient solution.As Afriocan agapanthus dehydrin protein ApY in solution2SK2When reaching 0.5-2 μm of ol/L, function and effect are obvious.
Preferably, Afriocan agapanthus dehydrin protein ApY in the solution2SK2It is to be obtained by the inclusion of the method for following steps
:
Transetta (DE3) prokaryotic expression Escherichia coli bacteria liquid after taking inducing expression, boiling lysis, to prokaryotic expression
Afriocan agapanthus dehydrin protein ApY2SK2Carry out purification enrichment.
Due to the randomness and thermal stability of the dehydrin protein structure, the present invention makes system by the way of directly boiling
In other albuminous degenerations, the dehydrin protein of recombination is extracted and is purified.The dehydrin protein has good thermostabilization
Property, the characteristics of stability of its function and structure is still able to maintain under boiling water bath, to protokaryon by the way of boiling lysis
The dehydrin protein ApY of expression2SK2Carry out fast purifying enrichment.Bacterium solution is cracked with ultrasound, crosses the extraction side of ni-sepharose purification albumen
Formula is compared, more efficient quick, simple and easy to do.
Specifically: Transetta (DE3) prokaryotic expression Escherichia coli bacteria liquid after taking inducing expression, thalline were collected by centrifugation,
Sterile water wash twice, settling flux thallus；
Escherichia coli after suspension are subjected to water-bath and boil processing, remove non-thermostable albumen while cracking thallus；
After E. coli SampLes after boiling lysis are cooled to room temperature, supernatant, the ancient philosophers as after purification is collected by centrifugation
Lotus dehydrin protein ApY2SK2。
Preferably, the condition of the boiling lysis are as follows: 30min is boiled in 100 DEG C of hot bath, every 5-10min is to egg
White sample carries out concussion processing.
Preferably, Transetta (DE3) prokaryotic expression Escherichia coli after the inducing expression are by the inclusion of following step
What rapid method was prepared:
A1, clone's target gene overall length: using Afriocan agapanthus cDNA as template, the method cloned by RACE full length gene is obtained
The coding ApY for being 561bp to overall length2SK2The ApY of albumen2SK2Gene ORF region sequence；
A2, building prokaryotic expression carrier: to the ApY after pET21a plasmid and introducing restriction enzyme site2SK2Gene carries out double enzymes
It cuts, connects endonuclease bamhi；The expression vector of building is transferred to Escherichia coli, after PCR detection and sequencing confirmation vector construction success,
Extract plasmid pET21a-ApY2SK2；
The prokaryotic expression of A3, dehydrin protein: successful pET21a-ApY will be constructed2SK2Plasmid is transferred to Transetta
(DE3) in prokaryotic expression Escherichia coli, inducing expression ApY2SK2Albumen.
Preferably, Bacillus coli expression albumin A pY2SK2Optimum inductive condition are as follows: ApY will be contained2SK2Recombinant plasmid
Transetta strain is inoculated in LB liquid medium, and at 37 DEG C, Escherichia coli are cultivated into growth logarithm under conditions of 200rpm
Phase, at this time bacterium solution OD600=0.5-1.0；Add IPTG to final concentration of 1.0-1.5mM, the inducing expression 4 under the conditions of 30-37 DEG C
~8h.It is further preferred that bacterium solution OD600=0.5-0.7；IPTG to final concentration of 1.0-1.5mM is added, induces table under the conditions of 35 DEG C
Up to 5~6h.
Fourth aspect, the present invention relates to it is a kind of using the vitrification ultra-low temperature save system to plant germplasm resource into
The method of row cryopreservation, described method includes following steps:
S1, it carries out disinfection, cultivate to vegetable seeds, taking and sprout 36h-72h seedling；
S2, by the seedling in loading liquid immersion treatment 15-30min；The loading liquid be containing 2mol/L glycerine,
The MS culture solution of 0.4mol/L sucrose；
S3, by step S2, treated that seedling moves to that the vitrification ultra-low temperature saves solution, impregnates under the conditions of 0-4 DEG C
Dehydration 40-60min；
S4, step S3 is taken out treated seedling is immediately placed in liquid nitrogen preservation 1h or more.
Preferably, the vegetable seeds is arabidopsis.Using cryopreservation by vitrification system of the invention to quasi- south
Mustard 60h seedling is saved, and preservation effect is remarkably improved.
Arabidopsis thaliana Seedlings culture: arabidopsis (Col-0) seed is used into 70% ethyl alcohol, 2% hypochlorite disinfectant is seeded in
MS solid medium is transferred to illumination box, photoperiod 8-16h after 4 DEG C of vernalization treatment 48h, and intensity of illumination is 150 μ
mol·m-2·s-1, diurnal temperature is respectively 25 DEG C and 20 DEG C, humidity 60%~80%.It takes and sprouts 60h seedling for sample progress
Cryopreservation by vitrification.
Preferably, further include the defrosting of seedling after cryopreservation, wash and be further cultured for step；It is described thaw for
Thaw 60-120s in 30-50 DEG C of water-bath；The cleaning solution used that washs is the MS culture containing 0.8-2.0mol/L sucrose
Liquid；The recovery media for being further cultured for using is the MS solid medium containing 20-40g/L sucrose.It is further preferred that the defrosting
For the 90s that thaws in 40 DEG C of water-bath；The cleaning solution used that washs is the MS culture solution containing 1.2mol/L sucrose；It is described
The recovery media used is further cultured for as the MS solid medium containing 30g/L sucrose.Washing process are as follows: with cleaning solution in room temperature
It is lower that seedling is impregnated into 30-50min.
Defrosting scheme is accelerated using shake when the water-bath is thawed.
6th aspect, the present invention relates to a kind of purifying Y2SK2The method of type dehydrin protein, comprising: after taking inducing expression
Transetta (DE3) prokaryotic expression Escherichia coli bacteria liquid, boiling lysis, to the Y of prokaryotic expression2SK2Type dehydrin protein carries out
Enriching and purifying.
Existing research shows that dehydrin protein is one of main adverse circumstance protection albuminoid of plant, can stablize and remain thin
The membranous system structure of born of the same parents and the conformation of other protein have the function of that molecular barriers prevent other activated proteins to be denaturalized, maintain
The normal physiological metabolic function of cell.The dehydrin protein ApY used in the present invention2SK2Pass through coli strain protokaryon table
It reaches, further isolate and purify destination protein and is added in vitrification solution, to optimize cryopreservation system.After optimization
Cryopreservation system successively uses loading liquid, vitrification solution processing, finally the cryopreservation in liquid nitrogen.This allogenic material
Addition can effectively improve the preservation effect of vegetable material.Meanwhile dehydrin protein ApY2SK2Being further confirmed has
The significant effect for removing ROS, can effectively reduce the stress damage of isolated cells during ultralow temperature.
Method disclosed in the present invention provides a kind of dehydrin protein, to the cryopreservation effect optimization of vegetable material
Significantly, dehydrin protein ApY2SK2It can when concentration reaches 0.5-2 μm of ol/L in vitrification solution as allogenic material
Vegetable material under effective protection ultralow temperature compound stress.ApY2SK2Albumen has removing as a kind of anti-oxidation function albumen
The effect of ROS, so that it has positive protective effect to the vegetable material of some Oxidative Stress ability differences.External source addition is de-
Water fibroin ApY2SK2Optimize original cryopreservation system, hence it is evident that improve plant germplasm resource after cryopreservation
Recovery percentage, to realize good plant germ plasm resource medium-term and long-term Plantlet in vitro have very big application and promotional value.
Detailed description of the invention
Upon reading the detailed description of non-limiting embodiments with reference to the following drawings, other feature of the invention,
Objects and advantages will become more apparent upon:
Fig. 1 is various concentration ApY2SK2To the influence schematic diagram of arabidopsis 60h seedling recovery percentage；Show embodiment
In with the dehydrin protein ApY being added in vitrification solution2SK2The increase of concentration, wildtype Arabidopsis thaliana 60h seedling it is extensive
The change procedure that multiple growth rate is gradually increased；
Fig. 2 is arabidopsis 60h seedling recovery percentage schematic diagram；Show experimental example in being added to vitrification solution
ApY2SK2When concentration reaches 2 μm of ol/L, the recovery percentage of vegetable material after experience cryopreservation can be promoted with conspicuousness；Its
In, * indicates there is significant difference (P < 0.05) compared with the control group
Fig. 3 is Arabidopsis thaliana Seedlings restoration ecosystem situation schematic diagram；Left side is the restoration ecosystem of Arabidopsis thaliana Seedlings in control group
Situation, right side are to be added to 2 μm of ol/L ApY in experimental group vitrification solution2SK2, after optimizing cryopreservation system, arabidopsis
The restoration ecosystem situation of seedling；
Fig. 4 is ApY2SK2Testing result schematic diagram of the albumen to ROS Scavenging activity, it is shown that ApY2SK2It can significantly inhibit
The generation of hydroxy radical (OH)；Wherein, * * indicates there is significant difference (P < 0.01) compared with BSA positive controls.
Specific embodiment
Illustrate embodiments of the present invention below by way of specific specific example, those skilled in the art can be by this specification
Other advantages and efficacy of the present invention can be easily understood for disclosed content.The present invention can also pass through in addition different specific realities
The mode of applying is embodied or practiced, the various details in this specification can also based on different viewpoints and application, without departing from
Various modifications or alterations are carried out under spirit of the invention.
In the following examples, the experimental methods for specific conditions are not specified, usually according to normal condition or proposed by manufacturer
Condition.
Wildtype Arabidopsis thaliana seed disinfection method used in the embodiment of the present invention and arabidopsis 60h seedling are specifically cultivated
Method is referring to " stress response mechanism of the Arabidopsis thaliana Seedlings to cryopreservation by vitrification ", Ren Li, Shanghai Communications University doctor
Academic dissertation, 2014.
The formula of experiment reagent is as follows in the embodiment of the present invention:
1) MS culture solution are as follows: 1900mg/L KNO3, 1650mg/L NH4NO3, 170mg/L KH2PO4, 370mg/L
MgSO4·7H2O, 440mg/L CaCl2·2H2O, 37.3mg/L Na2- EDTA, 27.8mg/L FeSO4·7H2O, 100mg/L
Inositol, 0.5mg/L niacin, 0.5mg/L puridoxine hydrochloride, 0.1mg/L thiamine hydrochloride, 2mg/L glycine, 0.83mg/L KI,
6.2mg/L H3BO3, 22.3mg/L MnSO4·4H2O, 8.6mg/L ZnSO4·7H2O, 0.25mg/L Na2MoO4·2H2O,
0.025mg/L CuSO4·5H2O, 0.025mg/L CoCl2·6H2O, surplus are water, and pH is 5.6-6.2 (preferably 5.8-6.0).
2) MS solid medium are as follows: 1900mg/L KNO3, 1650mg/L NH4NO3, 170mg/L KH2PO4, 370mg/L
MgSO4·7H2O, 440mg/L CaCl2·2H2O, 37.3mg/L Na2- EDTA, 27.8mg/L FeSO4·7H2O, 100mg/L
Inositol, 0.5mg/L niacin, 0.5mg/L puridoxine hydrochloride, 0.1mg/L thiamine hydrochloride, 2mg/L glycine, 0.83mg/L KI,
6.2mg/L H3BO3,22.3mg/L MnSO44H2O, 8.6mg/L ZnSO4·7H2O, 0.25mg/L Na2MoO4·2H2O,
0.025mg/L CuSO4·5H2O, 0.025mg/L CoCl2·6H2O, 30g/L sucrose, 10g/L agar powder, surplus are water, pH
For 5.8-6.0.
3) loading liquid are as follows: the MS culture solution containing 2mol/L glycerine, 0.4mol/L sucrose, surplus is water.
4) vitrification solution are as follows: containing 30%w/v glycerine, 15%w/v ethylene glycol, 15%w/v dimethyl sulfoxide,
The MS culture solution of 0.4mol/L sucrose, or 0.5-2 μm of ol/L Y of addition2SK2Protein solution, remaining is water.
5) cleaning solution are as follows: the MS culture solution containing 1.2mol/L sucrose, surplus are water.
Embodiment 1, dehydrin protein ApY2SK2Prokaryotic expression and enriching and purifying
1, coding dehydrin protein ApY is obtained2SK2ORF sequence.
Using Afriocan agapanthus cDNA as template, pass through RACE (rapid-amplification of cDNA ends) full length gene
The method of clone obtains the ApY that overall length is 561bp2SK2Gene ORF region sequence (SEQ ID NO.1) encodes ApY2SK2Albumen.
2, prokaryotic expression carrier is constructed
1) according to ApY2SK2Multiple cloning sites in gene ORF sequence and plasmid select EcoR I and the I digestion position Xhol
Point, and use 5.0 software Design primers pET-YSK-S/A of Primer, carry out PCR amplification target fragment and introduce restriction enzyme site.
pET-YSK-S(SEQID NO.2):TCGAATTCATGGACATGAGGGATCAGT
pET-YSK-A(SEQ ID NO.3):AAACTCGAGCTGATGGGAGCCAGG
2) to the ApY after pET21a plasmid and introducing restriction enzyme site2SK2Overall length target gene carries out double digestion, using 2 ×
Connection product is converted E. coli competent, carries out positive monoclonal bacterial strain screening by Ligation mix connection digestion products.
Picking monoclonal colonies carry out PCR detection to bacterium solution and are sequenced, sequencing result is compared with ORF sequence, confirm carrier structure
Build errorless rear extraction plasmid；
3) successful pET21a-ApY will be constructed2SK2Plasmid is transferred in Transetta (DE3) prokaryotic expression Escherichia coli,
Escherichia coli are cultivated at 37 DEG C, under conditions of 200rpm to growing mid-log phase (bacterium solution OD600=0.5-0.7) after, add IPTG
To final concentration of 1.0-1.5mM, 5~6h of inducing expression under the conditions of 35 DEG C.
4) bacterium solution after taking induction, thalline were collected by centrifugation, is suspended, is placed in boiling water bath afterwards twice with sterile water wash, boiled
Boiling processing 20-60min, carries out thallus to crack while removing non-thermostable albumen, every 5-10min is to centrifuge tube during boiling water bath
It is shaken.After being cooled to room temperature, 10min is centrifuged under 4 DEG C, 15000g revolving speed, the supernatant after collecting boiling lysis, as
ApY after purification2SK2Sample detects purity of protein using SDS-PAGE.
5) Coomassie Brilliant Blue measures protein sample concentration, is stored in spare in -80 DEG C of refrigerators.
Embodiment 2, addition albumin A pY2SK2, optimization vitrification ultra-low temperature preservation system
1) Arabidopsis thaliana Seedlings culture: will be seeded in MS solid medium after wildtype Arabidopsis thaliana (Col-0) seed disinfection, training
Support 60h seedling.Specifically: arabidopsis (Col-0) seed is used into 70% ethyl alcohol, 2% hypochlorite disinfectant is seeded in MS solid
Culture medium is transferred to illumination box, photoperiod 8h after 4 DEG C of purification process 48h, and intensity of illumination is 150 μm of olm
-2·s-1, diurnal temperature is respectively 25 DEG C and 20 DEG C, humidity 60%~80%.It takes and sprouts 60h seedling for sample progress vitrifying
Method cryopreservation.
2) loading liquid is handled: arabidopsis 60h seedling goes to soaking at room temperature in loading liquid and handles 20min；
3) vitrification solution is handled: seedling is transferred in vitrification solution dehydration 50min under the conditions of 0-4 DEG C；
4) Liquid nitrogen storage: it is placed on cryopreservation 1h or more in the Arabidopsis thaliana Seedlings investment liquid nitrogen of vitrification solution.
According to above-mentioned steps, whether external source ApY is added according to vitrification solution2SK2, experiment is divided into experimental group and right
According to group.
Dehydrin protein ApY is not contained in the vitrification solution of control group2SK2, add in the vitrification solution of experimental group respectively
Add 0.5 μm of ol/L, 1 μm of ol/L, 2 μm of ol/L dehydrin protein ApY2SK2。
Specifically, 0.5 μm of ol/L dehydrin protein ApY is contained in the vitrification solution of experimental group group 12SK2；Experimental group group 2
Vitrification solution in contain 1 μm of ol/L dehydrin protein ApY2SK2；Contain 2 μm of ol/L in the vitrification solution of experimental group group 3
Dehydrin protein ApY2SK2。
5) it thaws: taking out, be quickly put into 40 DEG C of water-baths, defrosting 90s, and gently shaken after saving 1h in liquid nitrogen frequently
It is dynamic；
6) it washs: vitrification solution is absorbed, cleaning solution is added, room temperature handles 40min, changes once washing every 10min
Liquid；After Arabidopsis thaliana Seedlings after washing move on to MS solid medium renewal cultivation 10d, calculate and in comparative experiments group and control group
The recovery percentage of arabidopsis.
With the ApY being added in vitrification solution2SK2The increase of concentration, the arabidopsis 60h seedling of 3 experimental groups it is extensive
Multiple growth rate is gradually increased (see Fig. 1).When concentration reaches 2 μm of ol/L, ApY2SK2Very to the protective effects of Arabidopsis thaliana Seedlings
Obviously, recovery percentage is increased to 49.4% (see Fig. 2) by 23.7%, and the restoration ecosystem situation of Arabidopsis thaliana Seedlings is substantially better than pair
According to group (see Fig. 3).
Embodiment 3, verifying dehydrin protein ApY2SK2Protective effect with Oxidative Stress
1) by 0.2mL 0.2mM FeSO4It is mixed with 0.2mL 1mM bromo-pyrogallol red, adds 0.2mL 0.5%H2O2It is molten
Liquid and BSA, ApY2SK2Protein solution.
2) 0.2mL 0.5%H is added in experimental group2O2With BSA solution, ApY2SK2Protein solution, concentration 0.02,0.05 and
0.1mg/mL；0.2mL 0.5%H is added in negative control group2O2, protein solution is not added；Blank group is added without H2O2It is molten with albumen
Liquid.
3) absorbance value of sample is measured at Yu Bochang 550nm.Experimental group absorbance value is As, negative control group absorbance
Value is AC, blank group absorbance value is A0。
4) experiment with computing group BSA, ApY2SK2Protein solution generates relative inhibition to hydroxy radical (OH).
As shown in Figure 4, as a result ApY2SK2The generation of hydroxy radical can be significantly inhibited, and with the increase of protein concentration, it is right
The influence of reaction gradually increases.When concentration is 0.05mg/mL, ApY2SK2The inhibiting rate formed for hydroxy radical reaches about
50%, it is significantly higher than 9% inhibiting rate of BSA.These results indicate that ApY2SK2Fenton can be inhibited anti-under stressed condition
It answers, reduces the generation of hydroxy radical, play a positive role in ROS reset procedure.It further proves, ApY2SK2It is protected in ultralow temperature
During depositing, injury of the oxidative stress to vegetable material can reduce, for optimizing germ plasm resource cryopreservation system, improve
The survival rate of the vegetable material of renewal cultivation has great application and popularization value.
The above-described embodiments merely illustrate the principles and effects of the present invention, and is not intended to limit the present invention.It is any ripe
The personage for knowing this technology all without departing from the spirit and scope of the present invention, carries out modifications and changes to above-described embodiment.Cause
This, institute is complete without departing from the spirit and technical ideas disclosed in the present invention by those of ordinary skill in the art such as
At all equivalent modifications or change, should be covered by the claims of the present invention.
Sequence table
<110>Shanghai Communications University
<120>it reduces Cellular stress injury and improves the Y2SK2 Dehydrins of cryopreservation effect
<130> DAG37838
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 981
<212> DNA
<213>Afriocan agapanthus (Agapanthus praecox ssp. Orientalis)
<400> 1
acatgggatc ataaaatcaa aagatcagtt gaaaagagag agaggaaaag aacaagaaaa 60
ccatttcgag agaatttgat cagttttgga gagcgatgga catgagggat cagtatggga 120
accgggtcgg gcagatggat gcctacggca acccgatcca acagacggac gcttacggca 180
acccgttacc ggcccgcgag ggctacgggc atggcacggg tgtcggaggg cacgggaccg 240
gcggcactgg ctacgccggt accgggcatg acacgggcat cggaggtcat gggaccggta 300
caggctacac ggggaccggt gggcaggcgc agctgaagca cccggaggag caccagcgcg 360
gcgggatttt gcgccgctcc ggtagctcca gctccagctc ctcggaggat gacggcatgg 420
gggggaggag gaagaagaag ggactgaagg agaagatcaa ggagaagctc cctggcaccc 480
acaagaccga cgagtacggg cacgggcaag ccaccacggg cgcggggtat ggaaccacca 540
ccaccggcac ggggtacgga gggactacta cgactaccgc aacagggcgc catgagccgg 600
agaagaaggg ggtgatggaa aagatcaagg agaagctccc tggctcccat cagtaaatca 660
tatgtatatt tcacttaatt aaaaaggctc actcatgtta gtgaatgtgg gctagttttt 720
agtatgtgca tgttttgctt tgggaataag tggcatgcag ccatgagcat gcaccgcttg 780
cattttgcat gtgcgagcgt gcttggggct gcagtgtgtg cgcgcttctt gttgctgttg 840
tttttatgtg cgtgtgattg gggaggttat atcctgttta tgctatgtaa ttcatagact 900
atattttata tatcatatat gttataaagt aaaattagtg atagtcaaaa aaaaaaaaaa 960
aaaaaaaaaa aaaaaaaaaa a 981
<210> 2
<211> 27
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
tcgaattcat ggacatgagg gatcagt 27
<210> 3
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
aaactcgagc tgatgggagc ca 22
Claims (9)
1. a kind of Afriocan agapanthus dehydrin protein ApY2SK2Purposes in plant cell anti-oxidation protection.
2. purposes as described in claim 1, which is characterized in that the dehydrin protein ApY2SK2For inhibiting hydroxy radical
It generates.
3. a kind of Afriocan agapanthus dehydrin protein ApY2SK2It is used as cell tissue oxidative stress protective agent in cryopreservation system
In purposes.
4. purposes as claimed in claim 3, which is characterized in that the dehydrin protein ApY2SK2For inhibiting hydroxy radical
It generates.
5. a kind of vitrification ultra-low temperature saves solution, which is characterized in that the solution is to contain 20-40%w/v glycerine, 10-
20%w/v ethylene glycol, 10-20%w/v dimethyl sulfoxide, 0.2-0.6mol/L sucrose and 0.5-2 μm of ol/L Afriocan agapanthus dehydration
Fibroin ApY2SK2MS culture solution.
6. vitrification ultra-low temperature as claimed in claim 5 saves solution, which is characterized in that Afriocan agapanthus Dehydrins in the solution
Albumin A pY2SK2It is to be obtained by the inclusion of the method for following steps: Transetta (DE3) prokaryotic expression after taking inducing expression
Escherichia coli bacteria liquid, boiling lysis, to the Afriocan agapanthus dehydrin protein ApY of prokaryotic expression2SK2Carry out purification enrichment.
7. vitrification ultra-low temperature as claimed in claim 6 saves solution, which is characterized in that Bacillus coli expression albumin A pY2SK2
Optimum inductive condition are as follows: ApY will be contained2SK2The Transetta strain of recombinant plasmid is inoculated in LB liquid medium, 37
DEG C, Escherichia coli are cultivated to mid-log phase is grown under conditions of 200rpm, at this time bacterium solution OD600=0.5-1.0；Add IPTG extremely
Final concentration of 1.0-1.5mM, 4~8h of inducing expression under the conditions of 30-37 DEG C.
8. a kind of vitrification ultra-low temperature preservation solution using as described in any one of claim 5-7 to plant germplasm resource into
The method of row cryopreservation, which is characterized in that described method includes following steps:
S1, it carries out disinfection, cultivate to vegetable seeds, taking and sprout 36h-72h seedling；
S2, by the seedling in loading liquid immersion treatment 15-30min；The loading liquid be containing 2mol/L glycerine,
The MS culture solution of 0.4mol/L sucrose；
S3, by step S2, treated that seedling moves to that the vitrification ultra-low temperature saves solution, and dehydration is impregnated under the conditions of 0-4 DEG C
Handle 40-60min；
S4, step S3 is taken out treated seedling is immediately placed in liquid nitrogen preservation 1h or more.
9. method according to claim 8, which is characterized in that further include the defrosting of seedling after cryopreservation, washing and
It is further cultured for step；It is described to thaw for the 60-120s that thaws in 30-50 DEG C of water-bath；It is described wash the cleaning solution that uses for containing
The MS culture solution of 0.8-2.0mol/L sucrose；The recovery media for being further cultured for using is solid for the MS containing 20-40g/L sucrose
Body culture medium.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811347978.XA CN109452265B (en) | 2018-11-13 | 2018-11-13 | Y2SK2 dehydrin for reducing cell stress injury and improving ultralow temperature preservation effect |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811347978.XA CN109452265B (en) | 2018-11-13 | 2018-11-13 | Y2SK2 dehydrin for reducing cell stress injury and improving ultralow temperature preservation effect |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109452265A true CN109452265A (en) | 2019-03-12 |
| CN109452265B CN109452265B (en) | 2021-05-25 |
Family
ID=65610219
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811347978.XA Active CN109452265B (en) | 2018-11-13 | 2018-11-13 | Y2SK2 dehydrin for reducing cell stress injury and improving ultralow temperature preservation effect |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109452265B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110117317A (en) * | 2019-04-26 | 2019-08-13 | 上海交通大学 | Lotus embryo dehydrin protein and its purposes in enzymatic activity protection and anti-oxidation protection |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005122697A2 (en) * | 2004-06-21 | 2005-12-29 | Carmel-Haifa University Economic Corp. Ltd | Transgenic plants containing a dehydrin gene |
| CN102823582A (en) * | 2012-09-18 | 2012-12-19 | 上海交通大学 | Vitrification ultralow-temperature preserving method for agapanthus embryogenic callus |
| CN104255706A (en) * | 2014-09-15 | 2015-01-07 | 上海交通大学 | Method for optimizing vitrification ultra-low temperature preservation effect of arabidopsis seedlings |
| CN104273119A (en) * | 2014-09-15 | 2015-01-14 | 上海交通大学 | Method for improving storage effect of arabidopsis thaliana seedlings |
| CN106946986A (en) * | 2017-03-27 | 2017-07-14 | 上海交通大学 | Afriocan agapanthus Y2SK2 types dehydrin protein and its encoding gene and probe |
-
2018
- 2018-11-13 CN CN201811347978.XA patent/CN109452265B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005122697A2 (en) * | 2004-06-21 | 2005-12-29 | Carmel-Haifa University Economic Corp. Ltd | Transgenic plants containing a dehydrin gene |
| CN102823582A (en) * | 2012-09-18 | 2012-12-19 | 上海交通大学 | Vitrification ultralow-temperature preserving method for agapanthus embryogenic callus |
| CN104255706A (en) * | 2014-09-15 | 2015-01-07 | 上海交通大学 | Method for optimizing vitrification ultra-low temperature preservation effect of arabidopsis seedlings |
| CN104273119A (en) * | 2014-09-15 | 2015-01-14 | 上海交通大学 | Method for improving storage effect of arabidopsis thaliana seedlings |
| CN106946986A (en) * | 2017-03-27 | 2017-07-14 | 上海交通大学 | Afriocan agapanthus Y2SK2 types dehydrin protein and its encoding gene and probe |
Non-Patent Citations (8)
| Title |
|---|
| A.M. LIVERNOIS: "Obtaining highly purified intrinsically disordered protein by boiling lysis and single step ion exchange", 《ANALYTICAL BIOCHEMISTRY》 * |
| DI ZHANG: "Y2SK2‑ and SK3‑type dehydrins from Agapanthus praecox act", <PLANT CELL, TISSUE AND ORGAN CULTURE》 * |
| JIE LUO: "Abscisic Acid-Responsive Protein, Bovine Serum Albumin, and Proline Pretreatments Improve Recovery of in Vitro Currant Shoot-Tip Meristems and Callus Cryopreserved by Vitrification", 《CRYOBIOLOGY》 * |
| T. HALDER: "Isolation, cloning, and characterization of a novel Sorghum dehydrin (SbDhn2) protein", 《PROTOPLASMA》 * |
| VLADAN BOZOVIC: "Dehydrins (LTI29, LTI30, and COR47) from Arabidopsis", 《J. SERB. CHEM. SOC.》 * |
| 任丽: "拟南芥幼苗对玻璃化法超低温保存的逆境响应机制", 《博士学位论文》 * |
| 夏慧: "植物脱水素对多种逆境的响应", 《干旱地区农业研究》 * |
| 马杰 等: "非生物胁迫下植物脱水素的研究进展", 《生物学杂志》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110117317A (en) * | 2019-04-26 | 2019-08-13 | 上海交通大学 | Lotus embryo dehydrin protein and its purposes in enzymatic activity protection and anti-oxidation protection |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109452265B (en) | 2021-05-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106868023B (en) | Cucumber CsERF004 gene and coding protein and application thereof | |
| CN109553671A (en) | Trifoliate orange Cold resistant genes PtrTZF1 and its application in plant cold resistance genetic improvement | |
| CN112430584B (en) | Du pear ubiquitin ligase gene, encoding protein and application thereof in plant drought-resistant genetic improvement | |
| CN108315335B (en) | Pear drought-induced transcription factor PbrWRKY53 and application thereof in improving drought resistance of plants | |
| CN113493794B (en) | Gene GmGRX4 with resistance to soybean mosaic virus and application thereof | |
| CN109452265A (en) | It reduces Cellular stress injury and improves the Y of cryopreservation effect2SK2Dehydrins | |
| CN101748144B (en) | Torch pear haloduric gene PpGST and application thereof | |
| CN101845445B (en) | Cre recombinase recombination gene and Cre/loxP-mediated transgene safe plant expression vector | |
| CN113444734A (en) | Preparation method and application of salt-tolerant transgenic poplar | |
| CN101864372A (en) | Preparation method of antibacterial peptide gene engineering strain | |
| CN111675757A (en) | Du pear vacuole type proton pump PbVHA-B1 and application thereof in plant salt-resistant genetic improvement | |
| CN111394365A (en) | Application of OsDUF6 gene in improving drought tolerance of rice | |
| CN113957085B (en) | Application of clematis isoprenoyl transferase PT1 gene, and overexpression Arabidopsis thaliana strain and construction method thereof | |
| CN105585621B (en) | Soybean protein GmAIRP1 and its encoding gene and application | |
| CN107586324B (en) | TabZIP15 albumen and its encoding gene and application | |
| CN109619094B (en) | Baizilian SK3Application of dehydrin protein in reducing cell stress injury and improving ultralow temperature preservation effect | |
| CN116162645A (en) | Application of induction transcription factor CoWRKY3 in plant anthracnose resistance | |
| CN103146748A (en) | Agrobacterium mediated rose bud transgenosis infecting method | |
| CN103993017B (en) | A kind ofly control the leaf zinc finger protein gene OsRLZP of paddy rice and application thereof | |
| KR101300658B1 (en) | Method for increasing transformation efficiency of Chrysanthemum and Chrysanthemum plant tolerant against multiple stress produced by the same | |
| CN114540408B (en) | Gene for regulating drought resistance of plants, and encoding protein and application thereof | |
| CN108018307B (en) | Application of AtNIA1 gene in improving heavy metal pollution resistance and oxidation resistance of Hangzhou white chrysanthemum seedlings | |
| Yu et al. | Functional Analysis of Genes GlaDFR1 and GlaDFR2 Encoding Dihydroflavonol 4-Reductase (DFR) in Gentiana lutea L. Var. Aurantiaca (M. Laínz) M. Laínz | |
| CN102260684A (en) | Use of CaWRKY40 gene in hot pepper in tobacco anti-bacterial wilt genetic engineering | |
| CN102260685A (en) | Application of chili CaWRKY40 gene in tobacco high temperature resistant gene engineering |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |