CN102260684A - Use of CaWRKY40 gene in hot pepper in tobacco anti-bacterial wilt genetic engineering - Google Patents

Abstract

The invention provides the use of a CaWRKY40 gene in hot pepper in tobacco anti-bacterial wilt genetic engineering. The gene in the hot pepper is named CaWRKY40 gene and is isolated from the cDNA library of hot pepper laminae treated by ultraviolet B (UV-B). The gene at least has a nucleotide sequence represented by SEQIDNo.1. The invention also discloses the use of the gene or overexpression vector constructed by the gene in tobacco anti-bacterial wilt genetic engineering. Compared with wild tobacco, the overexpression of the CaWRKY40 gene in tobacco can obviously improve the bacterial wilt resistance in transgenic tobacco. The gene has a high application value in plant anti-bacterial wilt genetic engineering.

Description

The application of capsicum CaWRKY40 gene in tobacco resistance to bacterial wilt genetically engineered

Technical field

The present invention relates to a kind of capsicum CaWRKY40The structure of gene and overexpression vector thereof and the application in genetically engineered have related more specifically to the application of this capsicum overexpression vector in plant of Solanaceae tobacco resistance to bacterial wilt genetically engineered, belong to the plant gene engineering technology field.

Background technology

Plant grows at it, suffer the disease worm in the growth course inevitably, extreme temperature, biologies such as arid and abiotic stress are coerced, being induced the degeneration-resistant reaction of generation under environment stress is plant formed cost-effective degeneration-resistant mechanism in the evolution of long period of time process, comprise other degeneration-resistant approach of closing, suitably reduce the matter and energy that is used for g and D, the reverse feedback of degeneration-resistant reaction is regulated and is made limited matter and energy be applied to relevant degeneration-resistant reaction as much as possible during environment stress, and degeneration-resistant response intensity is unlikely to too greatly with the waste that reduces matter and energy with to self injury, the startup of this specific degeneration-resistant approach, closing of other degeneration-resistant approach and growth all is that signal delivery network by complexity is realized.Therefore, the analysis of signal network is the important channel of illustrating the plant stress-resistance molecular mechanism.Studies show that Ca ²⁺Courier, plant hormone (SA, JA, ABA, ethene, brassinolide etc.), protein phosphorylation, kinases, transcription factor etc. have been formed the various signal paths of replying adverse circumstance, they are interact with each other, constitute signal network, finally make endonuclear gene generation adverse circumstance, cell, tissue-specific expression adjustment, coordinate plant growth also improves plant to stress resistance.Enter nucleus and regulate the related gene expression transcription factor from the tenuigenin transmission as integrating the adverse circumstance signal, the great attention that it has been subjected to people in recent years in the explaination and the effect in the adversity gene engineering of plant stress-resistance molecular mechanism, studies show that, WRKY, ATAF1, MYB, AP2/ERF, CAERF1, AREB, DREB etc. have participated in the regulation and control of plant to the environment stress induction of resistance, and the overexpression of these transcription factors in transfer-gen plant can significantly improve the resistance of plant to specific adverse circumstance.Therefore, plant separation, Function Identification and the application in the plant stress-resistance genetically engineered thereof of replying the transcription factor of adverse circumstance become very active research field of the biological educational circles in the current world.

Capsicum is a kind of important vegetables and insutrial crop, and its sown area occupies and is only second to Chinese cabbage occupies second in vegetables in recent years, and its output value then shelter has the hats of vegetables.It is the current pattern of farming adjustment of China that capsicum produces, yet the important selection of growth of agricultural efficiency and increasing peasant income, capsicum is very avoided continuous cropping again, be that soil-borne disease is more, comparatively serious plant of Solanaceae falls ill, and to high temperature, the high humidity sensitivity (Gao Zhikui. capsicum harvesting high-quality high-yield cultivation philosophy and technique [M]. Beijing: Chinese agriculture press, 2002.19～20.), cultivating and applying disease-resistant and degeneration-resistant capsicum variety and take corresponding cultivation management technology is the essential technique measure that solves pepper diseases and adverse circumstance harm, disease-resistant and the degeneration-resistant molecular mechanisms of plant of Solanaceae such as announcement capsicum are the important foundations of effectively carrying out the degeneration-resistant genetic improvement of capsicum, the transcription factor 26S Proteasome Structure and Function identifies that plants of Solanaceae such as then not only helping disclosing capsicum is disease-resistant and obtains degeneration-resistant molecular mechanism, also can be the gene that the degeneration-resistant genetic improvement of crop such as capsicum provides using value.

WKRY is a class plant specific transcription factor family, 74 members in Arabidopis thaliana, have been found, paddy rice contains more than 100 member, these WRKY albumen all contain by 1 to 2 conservative WRKY functional domain, refer to that by WRKYGQK sequence and CX4-7-CX23-28-HX1-2-(H/C) class zinc of regulating WRKY albumen and DNA binding characteristic the territory is constituted.According to the number in the conservative territory of contained WRKY, WRKY albumen can be divided into 3 types, and they all can be discerned and in conjunction with the influence that W box (C/T) TGAC (T/C) on the target gene promoters also to a certain degree is subjected to its flanking sequence, regulate target gene expression.WRKY participates in aging, growth, dormancy and plant to biological procedureses such as replying of environment-stress, mainly concentrates on plant to the effect in abiotic stress stress response such as biological adverse circumstance such as pathogenic bacteria, insect and arid, salt stress, high temperature, heavy metal stress, physical abuse, UV-B and the resistance about the research reports of WRKY function in a large number so far.For example, Arabidopis thaliana WRKY70 and WRKY72 have not only participated in the basic resistance (PTI) of plant to pathogenic bacteria, and the gene overexpression such as gene pairs gene specificity resistance (ETI) rice Os WRKY03, OsWRKY13, WRKY45, OsWRKY71 that has also participated in the R gene mediated can improve the pathogenic bacteria resistance.The mechanism of WRKY family protein regulation and control biological character is very complicated, and the part membership table reveals function specificity and diversity, to play a part just to regulate with a kind of proterties or negative regulate etc. different; A WRKY albumen can be regulated another WRKY expression of gene among the part member, or several WRKY albumen synergy, constitutes complicated WRKY regulating networks and shows certain functional redundancy; Part member plant reply different biological adverse circumstances, abiotic stress even with biological adverse circumstance and the signal crosstalk of abiotic stress in serve as important node, show replying and resistance to multiple environment stress.Because the diversity of organic evolution environment and approach, the WRKY family member's of different plants function and mechanism of action, WRKY signal network and the mechanism of action in the multiple signal crosstalk that replys different adverse circumstances may all have its specificity.Yet a large amount of relevant so far WRKY structure, function and Its Mechanisms majorities concentrate on the part member in the minority model plants such as paddy rice, Arabidopis thaliana, are still waiting to further investigate for the complexing action mechanism of WRKY family in most of plants.

A WRKY family member's of separation acquisition full-length cDNA the cDNA library of the present invention under capsicum UV-B handles ( CaWRKY40), its expression product is positioned nucleus, can combine with the W box, shows the proteic characteristic feature of WRKY.This expression of gene is subjected to ralstonia solanacearum and infects induce (the seeing accompanying drawing 10) of coercing.Its overexpression in tobacco can significantly improve the resistance of transgene tobacco to bacterial wilt, shows CaWRKY40Reply in the transmission of ralstonia solanacearum signal plant and to play important regulatory role.

Summary of the invention

This discovery provides a kind of capsicum CaWRKY40The application of gene in tobacco resistance to bacterial wilt genetically engineered, will make greater efforts to promote engineered development of tobacco resistance to bacterial wilt and application.

Of the present invention peppery CaWRKY40Gene contains at least just like the nucleotide sequence shown in the SEQ ID No.1.

Construction process is as follows:

With capsicum CaWRKY40Gene and CaMV35S promotor core sequence merge, and are built into CaWRKY40Overexpression vector.Described CaMV35S promotor core sequence is CGACCGCAAG

ACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGAC。Described capsicum CaWRKY40Gene is to separate to obtain from the cDNA library of uv b radiation capsicum blade CaWRKY40Gene.

The application of overexpression vector in plant of Solanaceae tobacco resistance to bacterial wilt genetically engineered that makes up.Described overexpression vector is transformed Agrobacterium tumefaciensThe EHA105 Agrobacterium is adopted leaf dish genetic transformation method to infect tobacco and obtains transgene tobacco, and the result proves and improved the resistance to bacterial wilt of this transgenosis to tobacco.

Remarkable advantage of the present invention:

Capsicum of the present invention CaWRKY40The overexpression of gene in tobacco compared the bacterial wilt resistance that significantly improves transgene tobacco with wild-type tobacco, this gene has important application in plant resistance to bacterial wilt genetically engineered.

Description of drawings

Fig. 1 is CaWRKY40Albumen is guarded domain analysis;

Fig. 2 is CaWRKY40Infer proteic hydrophobic profile;

Fig. 3 is CaWRKY40Subcellular Localization on onion epidermis;

Fig. 4 is the pBT10-GUS plasmid map;

Fig. 5 is CaWRKY40Moment expression analysis with the W box;

Fig. 6 is CaWRKY40Expression under bacterial wilt infects;

Fig. 7 is CaWRKY40The resistance that overexpression infects bacterial wilt in transgene tobacco.

Embodiment

1 vector construction process

1.1 material

Capsicum variety is the local capsicum variety 120 of Lianhua County, Jiangxi Province ^#, preserve by life science institute of University Of Agriculture and Forestry In Fujian laboratory; Flue-cured tobacco cultivars K326 kind is so kind as to give by University Of Agriculture and Forestry In Fujian's virus; The cDNA library of the capsicum blade that UV-B handles (UV-B UV treatment: plant is placed the irradiation of 25cm place 2h, 6h, 12h, 24h and 48h under ultraviolet lamp (UV-B), the plant that all different treatment time periods handle carries out putting into after quick-frozen is handled-80 ℃ of refrigerators preservations with liquid nitrogen) for life science institute of University Of Agriculture and Forestry In Fujian laboratory makes up (according to the description operation on the Invitrogen company test kit), titre is up to 1 * 10 ⁷CloneMiner ^TMCDNA Library Construction Kit and Gateway vector construction test kit are all available from American I nvitrogen company.The Type B plasmid in a small amount the rapid extraction test kit available from vast Tyke, Beijing biological gene technology limited liability company, PCR be correlated with dNTP, TaqEnzyme, PCR buffer are available from Dalian TaKaRa company product, and reverse transcription and Real-Time PCR test kit are available from Dalian TaKaRa company.Gentamicin, kantlex, Rifampin, carboxylic Bian penicillin etc. are Sigma company product.Other chemical reagent is homemade chemical pure.

1.2 method

1.2.1 capsicum CaWRKY40The separation of candidate gene

With the proteic aminoacid sequence of the WRKY of Arabidopis thaliana is probe, and search obtains the relevant EST of capsicum, by capsicum EST is spliced, designs, synthesizes Auele Specific Primer according to consensus sequence, and primer sequence is P1 5'-GCTCAAGTGATGAAGAGTC-3'; P2:5'-AATGGTTGGTCCTGAAGG-3'.Adopt 96 well plate method of PCR-based technology from the cDNA library, to screen the cDNA positive colony then, sequencing result shows, the length of this cDNA positive colony is 1431bp, the long 1086bp of its open reading frame, infer protein that contains 361 amino acid (aa), molecular weight 39.6 kDa, iso-electric point (pI) 8.12 of coding, be the conservative region (see figure 1) of WRKY between the 168th to 234 aminoacid sequence, the C end has a C ₂H ₂Zinc fingers is with this cDNA positive colony called after CaWRKY40Gene.

Right in the NCBI website CaWRKY40The amino acid of gene carries out Blastp homologous sequence search, can find that the aminoacid sequence of the WRKY gene that the different plants with other of this gene have been reported has very big homology, with tobacco ( Nicotiana tabacum) WIZZHomology the highest by 80%, with celery ( Petroselinum crispum) homology of transcription factor WRKY4 (gb|AAG35658.1|AF204925_) is 52%, with grape ( Vitis aestivalis) homology of putative WRKY4 transcription factor (AAR37421.1) is 53%, with soybean ( Glycine max) homology of WRKY27 (ABC26917.1) is 48%, with short Oak Tree ( Larrea tridentata) homology of WRKY transcription factor 21 (AAW30662.1) is 47%.With CaWRKY40Concern the proteic compare of analysis result of nearer WRKY, conservative property is mainly reflected in the WRKY structural domain as can be seen.Hydrophobicity analysis is found CaWRKY40The small part zone of C end and the hydrophobicity of subregion broad in the middle stronger, the wetting ability in small portion zone is (Fig. 2) by force.

1.2.2 capsicum CaWRKY40The gene overexpression vector makes up

The present invention uses gateway technology (Walhout et al., 2000) and makes up dicotyledons transgenosis overexpression vector.

At first according to gateway vector construction technical project and synthetic inboard special primer WRKY40F 5-AAAAAGCAGGCTTATGGAATTTACCAGTTTGGTTGA-3; The WRKY40R 5-AGAAAGCTGGGTCT TACCATCTGCCCGTCTGA-3(first round) and the lateral joint primer AttB1 5 '-G GGG ACA AGT TTG TAC AAA AAA GCA GGC T-3 '; AttB2 5 '-GGG GAC CAC TTT GTA CAA GAA AGC TGG GT-3 ' (second takes turns).Then according to interpolation AttThe two-wheeled pcr amplification program of B joint, CaWRKY40The attB joint is added in the gene both sides, and two-wheeled pcr amplification program program is as follows:

The first round adds in order fully to obtain AttThe PCR product of B joint, inboard special primer can only add 10 pmoles at most for every kind in 50 μ l PCR reaction systems, and the amplification parameter is:

Pre-95 ° of C 1 cycle of sex change 2min

94 ° of C of sex change 15 s

55 ° of C of annealing 30s

Extend 68 ° of C 10 cycles of 1 min

Second takes turns transfer first round PCR product 10 μ l to containing 40pmoles AttB1 and AttIn the 40 μ lPCR mixed solutions of B2 lateral joint primer, use the first low temperature special annealed of the high temperature two cover amplification parameters of annealing again to be continuously:

Pre-95 ° of C 1 cycle of sex change 1min

94 ° of C of sex change 15 s

45 ° of C of 30 s anneal

Extend 68 ° of C 5 cycles of 1 min

94 ° of C of sex change 15 s

55 ° of C of 30 s anneal

Extend 68 ° of C 15-20 of 1 min cycles

Agarose gel electrophoresis test strip quality and glue reclaim purifying AttThe B-PCR product.

Then by the BP reaction system with goal gene (purifying AttThe B-PCR product) is cloned into entry vector pDONR207 and goes up the ABC of clone of formation, pDONR207-ROP, after order-checking testing goal gene order is errorless, by the LR reaction system goal gene clone is transferred to overexpression vector pMDC32 again, so also just goal gene is cloned in the CaMV35S of Ti-plasmids promotor downstream, formation contains the overexpression vector of goal gene, can realize its overexpression in transfer-gen plant, the further Transformed E HA105 Agrobacterium of overexpression vector that will contain goal gene at last with reference to the molecular cloning guide is to be ready for use on the tobacco genetic transformation.The BP reaction system:

PCR?products 100?ng

Vector?(pDONR207) 30-50?ng

5×Buffer 1?μl

BP?enzyme?mix 0.3?μl

Add?water?to?total 5μl

25 ℃ of temperature are bathed and are spent the night, and reaction finishes the back and adds Proteinase K, and 37 ℃ of digestion 10min transform DH5 α competent cell with reaction product.

The LR reaction system:

Entry?clone 50-100?ng

Destination?vector 100?ng

LR?Enzyme?mix 0.?5?μl

Add?water?to?total 5?μl

25 ℃ of temperature are bathed and are spent the night, and reaction finishes the back and adds Proteinase K, and 37 ℃ of digestion 10min transform DH5 α competent cell with reaction product.

1.2.3 capsicum CaWRKY40The gene Subcellular Localization

Suitable restriction enzyme site is contained at first-selected synthetic two ends CaWRKY40The total length primer of gene,, with EcoRI/ BamHI and these two couples of digestion with restriction enzyme carrier pEGAD of SmaI/BamHI, reclaim big fragment and connect.The plasmid through order-checking is a template on the T carrier to be connected simultaneously, increase with primer (WRKY40-GFPF:5-CGGAATTCATGATGGAATTTACCAGTTTGGTTGA-3 EcoRI, WRKY40-GFPR:5-CGGGATCCTTACCATCTGCCCGTCTGA-3 BamHI) CaWRKY40Complete encoding sequence, with being inserted into behind EcoRI/ BamHI and the SmaI/BamHI double digestion on the pEGAD carrier that enzyme cuts back to close, be built into p35S-equally CaWRKY40-GFP fusion vector is also cut by PCR and enzyme and to be identified and sequence verification.Identify that successful recombinant plasmid bombards onion epidermis cell with particle gun, behind the importing onion epidermis, flat board is put into group training chamber lucifuge cultivate 24-36 h, plasmid-encoded GFP fusion rotein is given full expression in onion epidermis cell.Place distilled water to soak onion epidermis then, use 0.45 mol/L N.F,USP MANNITOL (preparing) to handle 1.5 h again,, produce on the Olimpus fluorescent microscope in Germany subsequently and observe until cell generation plasmolysis with distilled water, observation condition is a blue excitation light, the row image collection of going forward side by side.Can find out that from the result fusion rotein is positioned in the nucleus, under fluorescent microscope, observe the green glow (see figure 3), illustrate that this gene conforms to prediction result, illustrate that tentatively they have the feature of transcription factor.

1.2.4 CaWRKY40Gene and W box binding characteristic are analyzed

WRKY albumen in the plant is proved and can combines (Rushton with the W box element that has core sequence TGAC or its complementary sequence GTCA Et al, 1996).WRKY albumen combines oneself and is confirmed by many external and intravital experiments with the W box element.Moment, expression analysis was a kind of comparatively easy method, after exogenous genetic material imports in the vegetable cell, as outer genetic material (before the degraded) generation moment expression within a certain period of time of a kind of genome, and accumulated expression product in transformant.We use moment expression analysis technology isolating capsicum WRKY gene are carried out the preliminary evaluation of function, for follow-up study lays the foundation on the basis of using Gateway vector construction technique construction report carrier and effector plasmid.

Entrust synthetic following cis-acting elements (italicized item the is a core sequence) strand of Shanghai Bo Ya biotech company, two ends have BamHI and XbaI enzyme cutting site sticky end, make the double-stranded both sides of positive anti-chain annealing synthetic have BamHI and two restriction enzyme site sticky ends of XbaI respectively.Positive-sense strand: 5-GATCCTTATTCAGCCATCAAAAGT TGACCAATAATTTATTCAGCCATCAAAAGT TGACCAATAATT-3; Antisense strand: 3-GAATAAGTCGGTAGTTTTCA ACTGGT

TATTAAATAAGTCGGTAGTTTTCA ACTGGTTATTAAGATC-5，

The single stranded oligonucleotide of equivalent is dissolved in the NaCl solution of 50mM, place 70 ℃ of 5min after, naturally cooling to room temperature (30min) can be with the strand synthetic dsdna.

Extract pBT10-GUS plasmid (Fig. 4), and carry out enzyme with BamHI and two Restriction Enzymes of XbaI and cut, the big fragment that enzyme is cut back to close is connected with the T4 dna ligase with the nucleotide double DNA of 2W box cis-acting elements, connecting product is pBT10-2W-GUS, transformed into escherichia coli DH-5 α, according to a pair of primer A1A2 of carrier sequences Design: positive-sense strand: 5 ' AGCGAGGAAGCGGAAGAGC3 ', antisense strand: 5 ' GGACACCCGTAAGTCAGAC3 ', the amplification fragment length is about 300bp, and the screening positive monoclonal is also identified through this primer PCR and order-checking.

1.2.5 the structure of effector plasmid (seeing 1.2.2)

1.2.6 moment expresses

With particle gun (Bio-Rad PDS-1000/He) bombardment onion scale entocuticle cell, the function of checking plasmid was provided with pBT10-2W-GUS simple substance grain and is converted into negative control after plasmid construction was finished.Process comprises: (1) specimen preparation: with each 1 μ l of 1ug/ul plasmid DNA and 25 μ l tungsten powders (1.6 μ m, 60mg/ml), 25 μ l 2.5mol/L CaCl ₂With 10 μ l 0.1mol/L spermidines mixing on vibrator, through 70% and dehydrated alcohol fully dewater after the washing, be suspended in 50 μ l dehydrated alcohols, get 10 μ l and drip on the loading film.(2) conversion condition is: sample vacuum chamber degree 27Pa, and pressure 1100psi, sample is 25cm apart from loading film distance.Bombard the back under the moistening environment of dark, incubated at room temperature 24h.Examine under a microscope after the X-Gluc dyeing and take pictures.

The method that adopts moment to express experiment has confirmed CaWRKY40Positive colony can combine (see figure 5) with cis element, activates its institute's driven GUS and expresses in the onion upper epidermis, illustrates that this gene is a proteic encoding gene of capsicum WRKY.

The acquisition of 2 tobacco transfer-gen plants and resistance to bacterial wilt analysis

2.1 tobacco genetic transformation and T1 are for the results of transgenic seed

Adopt leaf dish genetic transformation method (Xu Gangbiao etc., 2007; Plant genetic engineering (second edition)), utilizes the Agrobacterium of the overexpression vector that contains goal gene constructed among the 1.2.2, infect the leaf dish (0.5cm * 0.5cm) of 2 months aseptic wild-type tobacco K326 seedling.Screening resistance seedling on the MS substratum that contains kantlex (100 mg/L), and the genomic dna of antagonism seedling carries out PCR and detects, to determine the reliability of kantlex screening.Obtain 15 transgenic lines.All strain systems all gather in the crops T1 for transgenic seed with the bagging selfing.Utilize T2 to carry out transgene tobacco phenotype analytical and Function Identification for transgenic seed.

The regulation and control of involved in plant resistance to bacterial wilt bacterium

The present invention has analyzed CaWRKY40Ralstonia solanacearum is infected may act in coercing plant, the T2 of results is steeped 24h for transgenic seed and the water logging of K326 wild-type mature seed difference seed asepsis, 75% alcohol 30s, 10% hydrogen peroxide 10min, sterile water wash 5-6 time, in the sowing MS cultivation, after 15 days, transplant in seedling pan, after choosing transplantation of seedlings of the same size after one month and in small flower, cultivating for 9 weeks, tobacco seed is carried out Ralstonia solanacearum (take from the local pepper ralstonia solanacearum bacterium in Fuqing, now be stored in life science institute of University Of Agriculture and Forestry In Fujian laboratory) root irrigation, handle 30 back wild-type tobaccos and whole strain wilting even dead occurs, and CaWRKY40The overexpression tobacco plant is normal growth (Fig. 6) then, and this illustrates capsicum CaWRKY40The overexpression tobacco plant reveals the obvious resistance that ralstonia solanacearum is infected with respect to the wild-type synopsis.More than test triplicate at least, same trend result is all arranged.Found that, CaWRKY40The transgene tobacco mutant obviously is better than wild-type contrast (Fig. 7,30d behind the Ralstonia solanacearum filling root), explanation to ralstonia solanacearum CaWRKY40Having participated in plant regulates the resistance of ralstonia solanacearum.

3 results

The present invention finds capsicum CaWRKY40Can significantly improve the resistance that transgene tobacco infects ralstonia solanacearum, this gene has important application on plant resistance to bacterial wilt genetically engineered.

＜110〉University Of Agriculture and Forestry In Fujian

＜120〉application of capsicum CaWRKY40 gene in tobacco resistance to bacterial wilt genetically engineered

<160>?2

<210>?1

<211>?1431

<212>?DNA

＜213〉capsicum (Capsicum annuum Linn)

<220>

<221>?CDS

<222>?(88)...(1143)

<400>?1

accttcatct?tatttaagga?gaaaaaactg?tttgttttct?tatacacctg?aagaaagact?60

agaagagctt?tgttgattct?tggatat?atg?gaa?ttt?acc?agt?ttg?gtt?gat?act?114

Met?Glu?Phe?Thr?Ser?Leu?Val?Asp?Thr

1?5

tca?ttg?gat?ttg?agc?ttt?agg?cct?cgt?cca?gtt?ctt?gat?aaa?ttg?ccg?162

Ser?Leu?Asp?Leu?Ser?Phe?Arg?Pro?Arg?Pro?Val?Leu?Asp?Lys?Leu?Pro

10?15?20?25

aaa?caa?gaa?gtt?cag?agt?gat?ttc?act?gga?ttg?agg?gga?gac?aat?atg?210

Lys?Gln?Glu?Val?Gln?Ser?Asp?Phe?Thr?Gly?Leu?Arg?Gly?Asp?Asn?Met

30?35?40

ggg?gtg?aaa?aat?gag?aca?gtg?gat?ttg?tta?gag?gaa?cta?aat?aga?gtg?258

Gly?Val?Lys?Asn?Glu?Thr?Val?Asp?Leu?Leu?Glu?Glu?Leu?Asn?Arg?Val

45?50?55

agc?agt?gaa?aac?aag?aag?ctt?act?gag?atg?ctc?aca?gtg?gtt?tgt?gaa?306

Ser?Ser?Glu?Asn?Lys?Lys?Leu?Thr?Glu?Met?Leu?Thr?Val?Val?Cys?Glu

60?65?70

aat?tac?aat?gtt?tta?aga?aac?caa?atg?atg?gag?tat?atg?agc?aca?caa?354

Asn?Tyr?Asn?Val?Leu?Arg?Asn?Gln?Met?Met?Glu?Tyr?Met?Ser?Thr?Gln

75?80?85?90

aat?ggt?gtg?gca?gat?gat?agt?gca?ggg?tca?agg?aag?aga?aaa?gct?gaa?402

Asn?Gly?Val?Ala?Asp?Asp?Ser?Ala?Gly?Ser?Arg?Lys?Arg?Lys?Ala?Glu

95?100?105

agt?atc?tcc?aat?ccc?aac?aac?agc?aac?agc?aac?gtc?aac?atc?aac?aac?450

Ser?Ile?Ser?Asn?Pro?Asn?Asn?Ser?Asn?Ser?Asn?Val?Asn?Ile?Asn?Asn

110?115?120

aac?aac?aac?aac?ttg?gat?gtt?gtg?cct?gga?cgt?tca?tca?gaa?agt?agc?498

Asn?Asn?Asn?Asn?Leu?Asp?Val?Val?Pro?Gly?Arg?Ser?Ser?Glu?Ser?Ser

125?130?135

tca?agt?gat?gaa?gag?tct?tct?tgc?aag?aaa?ctt?aga?gaa?gag?cac?ata?546

Ser?Ser?Asp?Glu?Glu?Ser?Ser?Cys?Lys?Lys?Leu?Arg?Glu?Glu?His?Ile

140?145?150

aaa?gcc?aag?gtt?aca?gtt?gtt?tct?atg?aag?act?gat?gca?tct?gat?acc?594

Lys?Ala?Lys?Val?Thr?Val?Val?Ser?Met?Lys?Thr?Asp?Ala?Ser?Asp?Thr

155?160?165?170

tct?ctt?att?gta?aag?gat?ggt?tat?cag?tgg?agg?aag?tat?ggc?cag?aaa?642

Ser?Leu?Ile?Val?Lys?Asp?Gly?Tyr?Gln?Trp?Arg?Lys?Tyr?Gly?Gln?Lys

175?180?185

gta?aca?aga?gac?aac?cct?tgt?cca?aga?gct?tac?ttt?aga?tgc?tca?ttt?690

Val?Thr?Arg?Asp?Asn?Pro?Cys?Pro?Arg?Ala?Tyr?Phe?Arg?Cys?Ser?Phe

190?195?200

gca?cct?acc?tgt?cct?gtc?aag?aag?aag?gtt?cag?aga?agc?ata?gaa?gat?738

Ala?Pro?Thr?Cys?Pro?Val?Lys?Lys?Lys?Val?Gln?Arg?Ser?Ile?Glu?Asp

205?210?215

cag?tct?att?gtg?gtg?gca?aca?tat?gaa?gga?gaa?cat?aac?cat?cca?atg?786

Gln?Ser?Ile?Val?Val?Ala?Thr?Tyr?Glu?Gly?Glu?His?Asn?His?Pro?Met

220?225?230

acc?tca?aaa?cca?gaa?gca?gga?ggt?gca?aat?act?act?agt?act?tcc?act?834

Thr?Ser?Lys?Pro?Glu?Ala?Gly?Gly?Ala?Asn?Thr?Thr?Ser?Thr?Ser?Thr

235?240?245?250

ggc?agc?cgg?tta?aat?gtg?acg?act?atc?gcg?ggt?act?act?gct?tca?gta?882

Gly?Ser?Arg?Leu?Asn?Val?Thr?Thr?Ile?Ala?Gly?Thr?Thr?Ala?Ser?Val

255?260?265

cct?tgc?tct?aca?act?ctc?aat?cct?tca?gga?cca?acc?att?act?ctc?gat?930

Pro?Cys?Ser?Thr?Thr?Leu?Asn?Pro?Ser?Gly?Pro?Thr?Ile?Thr?Leu?Asp

270?275?280

ctt?act?gca?ccg?aaa?aca?gta?gaa?aaa?cgc?gat?atg?aag?atg?aat?cag?978

Leu?Thr?Ala?Pro?Lys?Thr?Val?Glu?Lys?Arg?Asp?Met?Lys?Met?Asn?Gln

285?290?295

agt?gct?agt?cct?acc?ggt?ggc?aat?agc?att?cat?aca?tca?aca?gga?gtt?1026

Ser?Ala?Ser?Pro?Thr?Gly?Gly?Asn?Ser?Ile?His?Thr?Ser?Thr?Gly?Val

300?305?310

gaa?tat?caa?aat?agg?cca?gag?ttc?caa?cag?ttc?ttg?ata?gag?caa?atg?1074

Glu?Tyr?Gln?Asn?Arg?Pro?Glu?Phe?Gln?Gln?Phe?Leu?Ile?Glu?Gln?Met

315?320?325?330

gct?act?tcc?ttg?acc?aaa?gat?cca?agc?ttc?aaa?gca?gca?ctt?gct?gcc?1122

Ala?Thr?Ser?Leu?Thr?Lys?Asp?Pro?Ser?Phe?Lys?Ala?Ala?Leu?Ala?Ala

335?340?345

gcc?ata?tca?gga?aaa?atc?ctc?caa?cat?aat?aat?cag?acg?ggc?aga?tgg?1170

Ala?Ile?Ser?Gly?Lys?Ile?Leu?Gln?His?Asn?Asn?Gln?Thr?Gly?Arg?Trp

350?355?360

taaaagaaag?tccagcagag?cagtcaacta?ctgtgtgtgg?atgaagaagc?cggtgtacta?1230

aagctcccgc?gataatctcc?tagccacacg?gcagcagttt?taccaattac?tccaaagctc?1290

tccttctaca?actctgtacg?gatggcttag?acaattgttc?aatattttcc?aatttgtcga?1350

ctcattttaa?aagttcttag?agaaaaaggc?aacaagttat?tgttcaatgt?aaataccgga?1410

aaagttgttt?aacttggacc?g?1431

 

<210>?2

<211>?362

<212>?PRT

＜213〉capsicum (Capsicum annuum Linn)

<400>?2

Met?Glu?Phe?Thr?Ser?Leu?Val?Asp?Thr?Ser?Leu?Asp?Leu?Ser?Phe?Arg

1?5?10?15

Pro?Arg?Pro?Val?Leu?Asp?Lys?Leu?Pro?Lys?Gln?Glu?Val?Gln?Ser?Asp

20?25?30

Phe?Thr?Gly?Leu?Arg?Gly?Asp?Asn?Met?Gly?Val?Lys?Asn?Glu?Thr?Val

35?40?45

Asp?Leu?Leu?Glu?Glu?Leu?Asn?Arg?Val?Ser?Ser?Glu?Asn?Lys?Lys?Leu

50?55?60

Thr?Glu?Met?Leu?Thr?Val?Val?Cys?Glu?Asn?Tyr?Asn?Val?Leu?Arg?Asn

65?70?75?80

Gln?Met?Met?Glu?Tyr?Met?Ser?Thr?Gln?Asn?Gly?Val?Ala?Asp?Asp?Ser

85?90?95

Ala?Gly?Ser?Arg?Lys?Arg?Lys?Ala?Glu?Ser?Ile?Ser?Asn?Pro?Asn?Asn

100?105?110

Ser?Asn?Ser?Asn?Val?Asn?Ile?Asn?Asn?Asn?Asn?Asn?Asn?Leu?Asp?Val

115?120?125

Val?Pro?Gly?Arg?Ser?Ser?Glu?Ser?Ser?Ser?Ser?Asp?Glu?Glu?Ser?Ser

130?135?140

Cys?Lys?Lys?Leu?Arg?Glu?Glu?His?Ile?Lys?Ala?Lys?Val?Thr?Val?Val

145?150?155?160

Ser?Met?Lys?Thr?Asp?Ala?Ser?Asp?Thr?Ser?Leu?Ile?Val?Lys?Asp?Gly

165?170?175

Tyr?Gln?Trp?Arg?Lys?Tyr?Gly?Gln?Lys?Val?Thr?Arg?Asp?Asn?Pro?Cys

180?185?190

Pro?Arg?Ala?Tyr?Phe?Arg?Cys?Ser?Phe?Ala?Pro?Thr?Cys?Pro?Val?Lys

195?200?205

Lys?Lys?Val?Gln?Arg?Ser?Ile?Glu?Asp?Gln?Ser?Ile?Val?Val?Ala?Thr

210?215?220

Tyr?Glu?Gly?Glu?His?Asn?His?Pro?Met?Thr?Ser?Lys?Pro?Glu?Ala?Gly

225?230?235?240

Gly?Ala?Asn?Thr?Thr?Ser?Thr?Ser?Thr?Gly?Ser?Arg?Leu?Asn?Val?Thr

245?250?255

Thr?Ile?Ala?Gly?Thr?Thr?Ala?Ser?Val?Pro?Cys?Ser?Thr?Thr?Leu?Asn

260?265?270

Pro?Ser?Gly?Pro?Thr?Ile?Thr?Leu?Asp?Leu?Thr?Ala?Pro?Lys?Thr?Val

275?280?285

Glu?Lys?Arg?Asp?Met?Lys?Met?Asn?Gln?Ser?Ala?Ser?Pro?Thr?Gly?Gly

290?295?300

Asn?Ser?Ile?His?Thr?Ser?Thr?Gly?Val?Glu?Tyr?Gln?Asn?Arg?Pro?Glu

305?310?315?320

Phe?Gln?Gln?Phe?Leu?Ile?Glu?Gln?Met?Ala?Thr?Ser?Leu?Thr?Lys?Asp

325?330?335

Pro?Ser?Phe?Lys?Ala?Ala?Leu?Ala?Ala?Ala?Ile?Ser?Gly?Lys?Ile?Leu

340?345?350

Gln?His?Asn?Asn?Gln?Thr?Gly?Arg?Trp

355?360

 

  

Claims (3)

1. capsicum gene, it is characterized in that: described capsicum unnamed gene is CaWRKY40Gene, the cDNA library of the capsicum blade of handling from UV – B separate and obtain, and this gene contains at least just like the nucleotide sequence shown in the SEQ ID No.1.

One kind require as right 1 as described in the construction process of overexpression vector of gene, it is characterized in that: with capsicum CaWRKY40Gene and CaMV35S promotor core sequence merge, and are built into CaWRKY40Overexpression vector.

3. the application of overexpression vector in tobacco resistance to bacterial wilt genetically engineered that contains the described gene of claim 1 or make up by the described method of claim 2.

Images