CN109439731A - Genetic marker method suitable for the connection of Sepiella maindroni gap - Google Patents
Genetic marker method suitable for the connection of Sepiella maindroni gap Download PDFInfo
- Publication number
- CN109439731A CN109439731A CN201811236675.0A CN201811236675A CN109439731A CN 109439731 A CN109439731 A CN 109439731A CN 201811236675 A CN201811236675 A CN 201811236675A CN 109439731 A CN109439731 A CN 109439731A
- Authority
- CN
- China
- Prior art keywords
- gap
- connection
- sepiella maindroni
- genetic marker
- real
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6841—In situ hybridisation
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides the genetic marker method for being suitable for the connection of Sepiella maindroni gap, belongs to gene-tagging techniques field, using the gene of real-time fluorescence quantitative PCR detection Sepiella maindroni gap connection；Using the expression and distribution of the gene of in situ hybridization detection Sepiella maindroni gap connection；Gene is the labelled protein Innexin of gap connection.The present invention is changed using the expression of real-time fluorescence quantitative PCR and in-situ hybridization method detection Sepiella maindroni gap linkage flag protein I nnexin gene, accurately determine the accurate location of Innexin gene variation, in situ hybridization used can increase chance of the probe in conjunction with target nucleic acid, prevent chromosome condensation, improve hybridization signal, high reliablity as a result.
Description
Technical field
The invention belongs to gene-tagging techniques fields, and in particular to the gene mark suitable for the connection of Sepiella maindroni gap
Note method.
Background technique
Siphonopods belongs to mollusk, is the important component in marine ecosystems, while balancing to marine ecology
There is indispensable role.Cuttlefish belongs to Mollusca (Mollusca), Cephalopoda (Cephalopoda), widely distributed
In each sea area, occupy an important position in biosystem evolution.Its delicious meat is palatable, has good nutritive value,
Protein content is high.Other than edible, there are also very high medical value, ink sac can promote blood clotting and have
Bacteria resistance function, cuttlebone can be medicinal, and otolith can be used to analyze the age of species and the change in time and space of marine environment.In addition, black
Highly important biotic factor in crafty or marine ecosystems, plays highly important angle in the food chain of the ecosystem
Color plays very important effect to the ecological balance for maintaining marine ecosystem.In recent years, cuttlefish is as important economic cephalopodium
Class plays a key role in marine ecosystems.Due to overfishing and environmental change, stock number is once by very big
It destroys, natural resources obviously fails, and yield sharply declines, and fishing season disappears, and closes in imminent danger.Since the last century 80's,
Have benefited from the breakthrough of artificial breeding and Feeding Technique, stock number is in gradually recovery.
The feature of multicellular organism maximum be exactly cell can communication exchange each other, so as to form unified entirety.It realizes more
Mainly there are extracellular communication, cell-cell communication, intracellular communication these three communication networks in unified form of communication in cell biological
Network.Extracellular signal (for example, hormone) triggers intracellular messenger molecule (for example, signal transduction factor), influences in turn thin
Intercellular communication.Gap connection (gap junction, GJ) is one kind of cell connection, universally present in various animal tissues
In.And it is widely distributed, especially important role is carry in heart and brain tissue.Gap connection is by adjacent thin in structure
Upper two connexons of born of the same parents are anchored to be formed mutually, and two hemichannel openings form the intercellular channel that diameter is about 1.5nm, main
It can permit a variety of small molecules, ion and electric signal directly to pass through, be responsible for the conduction of iuntercellular electric current, chemical mediator (the such as second letter
Make molecule cAMP, IP3, Ca2+Deng) and small-molecule substance (molecular weight < 1.5kDa small peptide, amino acid, nucleic acid, ATP, carbohydrate etc.)
Transhipment, the processes such as proliferation, differentiation, metabolism of regulating cell, to maintain body interior ambient stable and growth and development have weight
Want meaning.Functionally, gap connection is a kind of dynamic structure, and the open and close of channel is adjusted by many factors,
In include: internal pH, Ca2+Concentration and cell membrane potential etc.；And there are many function, differentiation and metabolism with cell, battalion for it
Support substance transmitting, ionic equilibrium is adjusted, the metabolism of intercellular substance exchange is coupled has substantial connection with electrical coupling etc..In recent years,
As that studies GJ gos deep into, researchers focus on the effect of GJ incessantly, have focused more on it before not formed GJ, generally
The function and effect of existing hemichannel.And the abnormal expression of Sepiella maindroni inserted by connexin and the change of distribution pattern
It will affect the permeability and quantity in the channel GJ, and then every physiology course such as growth, development for influencing Sepiella maindroni.Cause
This, the genetic marker method that research is suitable for the connection of Sepiella maindroni gap has the cultivation of Sepiella maindroni important
Meaning, while having filled up the technological gap in linkage flag field in gap in the species.
Summary of the invention
Mans needleless is detected using real-time fluorescence quantitative PCR and in-situ hybridization method the purpose of the present invention is to provide a kind of
The gene mark that the expression of cuttlefish gap linkage flag protein I nnexin gene changes and connects suitable for Sepiella maindroni gap
Note method, accurately determines the accurate location of Innexin gene variation, and in-situ hybridization method used can increase probe and target nucleic acid
In conjunction with chance, prevent chromosome condensation, improve hybridization signal, high reliablity as a result.
The technical solution that the present invention is taken to achieve the above object are as follows:
Suitable for the genetic marker method of Sepiella maindroni gap connection, including,
The changes in gene expression of the Sepiella maindroni gap connection is detected using real-time fluorescence quantitative PCR；
The expression and distribution of the gene of the Sepiella maindroni gap connection is detected using in situ hybridization；
Gene is the labelled protein Innexin of gap connection.The present invention uses real-time fluorescence quantitative PCR and in situ hybridization side
Method detect Sepiella maindroni gap linkage flag protein I nnexin gene expression variation, can accurately determine Mans without
The accurate location of Sepia andreana gap linkage flag protein I nnexin gene variation has the cultivation of Sepiella maindroni important
Meaning, while having filled up the technological gap in linkage flag field in gap in the species.
Preferably, real-time fluorescence quantitative PCR detection includes the following steps:
1) Sepiella maindroni genome total serum IgE is extracted, reverse transcription synthesizes cDNA；
2) real-time fluorescence quantitative PCR, detection are carried out using primer pair cDNA；
Wherein, real-time fluorescence quantitative PCR primer are as follows: 5 '-TATGCGAGACGTGGTCCCTA-3 '；5'-
ACCTGAAGCGCCACTAAACA-3’。
Preferably, pcr amplified fragment size is 148bp；Extension increasing sequence is as shown in SEQ ID NO:3.
Preferably, real-time fluorescence quantitative PCR amplification uses SYBR Green dye method.
Preferably, real-time fluorescence quantitative PCR amplification reaction system is 20 μ L:7.6 μ L ddH2O, 20 μM of 0.4 μ L
Forward Primer、0.4μL 20μM Reverse Primer、10μL 2×SYBR Premix Ex Taq、1.6μL
CDNA template.
Preferably, real-time fluorescence quantitative PCR amplified reaction procedure selection two-step method:
Preferably, in situ hybridization include: histotomy rehydration, fixation, digestion, prehybridization and hybridization, post-hybridization washing,
It observes and takes pictures after closing, antibody, washing, incubation, washing, closing, antibody, washing, dye nucleus, colour developing, mounting, the fixation
Step are as follows: immerse the histotomy after rehydration in the 4%PFA-PBS solution containing 0.01% threonine, room temperature is fixed
Then 15min is washed 3 times, each 5min with 1 × PBST solution；The ratio of L-threonine and D-Thr in the threonine
For 100:2.8-4.2, L-threonine and the reasonable of D-Thr exist so that the PFA-PBS solution containing threonine in threonine
It is preferable to the fixation osmotic effect of tissue, it may make the protein of cell membrane to be denaturalized, enhance the permeability of cell membrane, improve
Fixation osmotic effect of the fixative to tissue, can obtain that tissue morphology is complete, the sample with suitable stiffness, convenient for subsequent miscellaneous
The progress handed over and developed the color, while being avoided that RNase pollutes, complete RNA is provided in situ hybridization, improves the result of in situ hybridization
Reliability.
Further preferably, digestion step are as follows: the histotomy after fixation is placed in containing 10 μ g/ml Proteinase Ks and 0.8 μ g/
In the salicylic solution of ml, 10min is digested.The transparency of Sepiella maindroni histotomy is poor, is not easy to the infiltration of probe
And colour developing, Proteinase K have the function of that target DNA protein is surrounded in digestion, probe can be made to be easier to enter the intracellular of embryo,
Increase chance of the probe in conjunction with target nucleic acid, improves hybridization signal, but the excessive concentration of Proteinase K, digestion time are too long or incubate
It educates when the temperature is excessively high, can all there is certain destruction to the structure of cell, lead to tissue loss, the disappearance of nucleus, to influence
Results of hybridization, and salicylic addition can generate above-mentioned adverse effect not only to avoid Proteinase K, but also nucleic acid can be made to precipitate,
Histone dissolution, prevents chromosome condensation, makes chromosome structure from destroying, improves the coloring energy organized in subsequent dyeing course
Power improves hybridization signal.
Preferably, the sequence of in situ hybridization justice and antisense probe are as follows: 5 '-GTCCGGCCGAATTCACATCA-3 '；
5’-CAGGTTGATGGGCAGGACAC-3’。
Preferably, in situ hybridization amplified fragments size is 683bp, shown in the extension increasing sequence SEQ ID NO:6.
Compared with prior art, the invention has the benefit that
1) present invention detects Sepiella maindroni gap linkage flag using real-time fluorescence quantitative PCR and in-situ hybridization method
The expression of protein I nnexin gene changes, and can accurately determine Sepiella maindroni gap linkage flag protein I nnexin base
Because of the accurate location of variation, have great importance to the cultivation of Sepiella maindroni, while having filled up gap in the species and having connected
Connect the technological gap of marker field；2) present invention can be such that nucleic acid precipitates in situ hybridization, and histone dissolution can be such that probe more holds
Easily into the intracellular of embryo, increase chance of the probe in conjunction with target nucleic acid, and chromosome condensation can be prevented, makes chromosome structure
From destroying, the colorability organized in subsequent dyeing course is improved, hybridization signal is improved；3) present invention is in situ hybridization with admittedly
It is preferable to the fixation osmotic effect of embryonic tissue to determine solution, enhances the permeability of cell membrane, can obtain that tissue morphology is complete, has
The embryo samples of suitable stiffness convenient for the progress of subsequent hybridization and colour developing, while being avoided that RNase pollutes, improve in situ hybridization
Result reliability.
The genetic marker method for being suitable for the connection of Sepiella maindroni gap is provided present invention employs above-mentioned technical proposal,
Compensate for the deficiencies in the prior art, reasonable design, easy operation.
Specific embodiment
In the following, in conjunction with specific embodiments to the base for being suitable for the connection of Sepiella maindroni gap of an embodiment of the present invention
Because labeling method is described further.
Embodiment 1:
Suitable for the genetic marker method of Sepiella maindroni gap connection, including,
The changes in gene expression of the Sepiella maindroni gap connection is detected using real-time fluorescence quantitative PCR；
The expression and distribution of the gene of the Sepiella maindroni gap connection is detected using in situ hybridization；
Gene is the labelled protein Innexin of gap connection.It is detected using real-time fluorescence quantitative PCR and in-situ hybridization method
The expression of Sepiella maindroni gap linkage flag protein I nnexin gene changes, and can accurately determine Sepiella maindroni
The accurate location of gap linkage flag protein I nnexin gene variation, has great importance to the cultivation of Sepiella maindroni,
The technological gap in linkage flag field in gap in the species has been filled up simultaneously.
Above-mentioned real-time fluorescence quantitative PCR detection includes the following steps:
1) Sepiella maindroni genome total serum IgE is extracted, reverse transcription synthesizes cDNA；
The 2ml EP of no RNA enzyme is taken to manage, 500ul Trizol, the tweezers clamping tissue steeped with alcohol is added in pipette tips
Sample is dissolved in Trizol liquid, and electric homogenizer grinding is dissolved completely in liquid until tissue, fills Trizol to 1mL, and 4
DEG C, 12000rpm, 10min centrifugation；
It takes supernatant to put into 1.5mL EP pipe, impurity cannot be drawn onto；
The chloroform of 200ul is added, acutely shakes, is stored at room temperature 5 minutes, 4 DEG C, 12000rpm, 15min are centrifuged；
It takes top layer's liquid in three layers into new 1.5mL EP pipe, 500ul isopropanol, room temperature 10min or -20 is added
DEG C overnight；
4 DEG C, 12000rpm, 10min centrifugation remove supernatant, it is seen that white plates, that is, RNA；
75% ethyl alcohol of 1mL is added, pressure-vaccum mixes, and stands 5min；
4 DEG C, 7500rpm, 5min centrifugation remove supernatant, the dry 10min of draught cupboard；
20ul DEPC water, 4 DEG C of overnight or -20 DEG C of preservations are added；
The inspection of RNA mass: be dissolved in DEPC processing water RNA using nucleic acid-protein detector measure its 260nm with
And the absorbing wavelength at 280nm, according to relevant information, 260/280 value shown between 1.8~2.0 extracted RNA mass compared with
Pure, the foreign protein and polysaccharose substance content contained is less, lower than this range RNA it is not recommended that use, illustrate higher than 2.0
Extracted RNA has more degradation, is not suitable for the experiment of next step amplification gene full-length cDNA and uses.After the completion of measurement, 2~3ml is taken
It is splined on 1% agarose gel electrophoresis, deposition condition is set as 135V and 150mA, electrophoresis 15min, in gel image analyser
Middle observation RNA electrophoretic band extracts the preferable RNA of quality and is able to observe that apparent 28S and 18S band, and the ratio between brightness is 2:
1；
3) cDNA is synthesized:
Using M-MLV reverse transcription reagent box, specific steps are as follows:
Following reaction system is added in 0.2ml centrifuge tube:
Total serum IgE 5.0ul
Oligo DT 1.0ul
It is centrifuged, is placed in PCR instrument after mixing, setting temperature is 70 DEG C, is taken out immediately after reacting 10min, ice bath 2min
Terminate.Following reagent is continuously added in above-mentioned reaction system:
Be centrifuged after mixing, in setting reaction condition in PCR instrument as 42 DEG C of 60min, 70 DEG C of 15min, after take out rapidly
Ice bath 15min, extremely -20 DEG C of preservation spare, and long-term preservation is then placed in -80 DEG C of refrigerators；
2) real-time fluorescence quantitative PCR, detection are carried out using primer pair cDNA；
Wherein, real-time fluorescence quantitative PCR primer are as follows: 5 '-TATGCGAGACGTGGTCCCTA-3 '；5'-
ACCTGAAGCGCCACTAAACA-3'；Real-time fluorescence quantitative PCR amplification uses SYBR Green dye method；Real time fluorescent quantitative
Pcr amplification reaction system is 20 μ L:7.6 μ L ddH2O, 0.4 μ L, 20 μM of Forward Primer, 20 μM of 0.4 μ L
Reverse Primer, 10 μ L 2 × SYBR Premix Ex Taq, 1.6 μ L cDNA templates；Real-time fluorescence quantitative PCR amplification
Response procedures select two-step method:
Above-mentioned pcr amplified fragment size is 148bp；Extension increasing sequence is as follows: TATGCGAGACGTGGTCCCTAGCGAGATA
CACTGGAGGGAAGCGAAGGAAATCAATTACTACCAATGGGTCCCAATTATATTGTTATTTATGGCCCTCATGTTCA
AAATCCCGTGTATTATATGGCGCGTGTTTAGTGGCGCTTCAGGT。
Above-mentioned in situ hybridization include: histotomy rehydration, fixation, digestion, prehybridization and hybridization, post-hybridization washing, closing,
It observes and takes pictures after antibody, washing, incubation, washing, closing, antibody, washing, dye nucleus, colour developing, mounting, specific steps are as follows:
It is pure using PCR product recovery purifying kit using restriction enzyme (NcoI, SpeI) difference linearization plasmid
Change the segment of linearisation and dissolved with DEPC water, and is quantitative using nucleic acid quantification instrument；It is respectively synthesized with T7 and SP6RNA transcriptase
Antisense and Sense probes, reaction system is as shown in table 1, and reaction step is as follows:
Table 1RNA transcriptase is respectively synthesized the reaction system of antisense and Sense probes
After mixing, 37 DEG C of incubation 2h；
2 μ l Dnase I, 37 DEG C of incubation 15min are added；
2 μ l 0.2M EDTA solution (pH=8) are added；
100% alcohol of 3 μ l 4M LiCl solution and 75 μ l pre-cooling is added, with -20 DEG C of placement 2h；
12000rpm, 4 DEG C of centrifugation 10min, 70% ethanol wash 2 times；
It is air-dried, is dissolved with 20 μ l DEPC water, and is quantitative；
100ng/ μ L is diluted to pre-hybridization buffer and is saved in -20 DEG C.
Vessel used, centrifuge tube are tested before hybridization, reagent is all made of 0.1%DEPC processing, and autoclave sterilization.Poly relies ammonia
Acid coating glass slide be purchased from Wuhan Boster Biological Technology Co., Ltd., can directly with slice in situ hybridization.With 4% poly first
Aldehyde fixes sample overnight, is dehydrated later using gradient methanol.The good sexual gland sample of paraffin embedding is subjected to histotomy (4 μm)
(or with frozen section, -20 DEG C temporary), after slice is extended with distilled water, piece of drying overnight, is placed in 4 by 37 DEG C of drying
DEG C refrigerator saves.
Histotomy rehydration: dimethylbenzene 3*5min；100% ethyl alcohol 2*5min；95%, 70%, each 5min of 50% ethyl alcohol；
It is fixed: the histotomy after rehydration to be immersed in the 4%PFA-PBS solution containing 0.01% threonine, room temperature is solid
Determine 15min, then washed 3 times, each 5min with 1 × PBST solution, then is washed after handling 10min with 0.2M HCl with 1 × PBST
3 are washed, each 5min；The ratio of L-threonine and D-Thr is 100:2.8-4.2 in above-mentioned threonine, L- Soviet Union ammonia in threonine
The reasonable presence of acid and D-Thr, can so that the PFA-PBS solution containing threonine is preferable to the fixation osmotic effect of tissue
So that the protein of cell membrane is denaturalized, enhance the permeability of cell membrane, improves fixative to the fixed infiltration effect of tissue
Fruit, can obtain that tissue morphology is complete, the sample with suitable stiffness is avoided that simultaneously convenient for the progress of subsequent hybridization and colour developing
RNase pollution, provides complete RNA in situ hybridization, improves the reliability of the result of in situ hybridization；
Digestion: the histotomy after fixation is placed in containing in 10 μ g/ml Proteinase Ks and the 0.8 salicylic solution of μ g/ml,
10min is digested, then washs 3 with 1 × PBST, the transparency of each 5min, Sepiella maindroni histotomy are poor, are not easy to
The infiltration and colour developing of probe, Proteinase K have the function of that target DNA protein is surrounded in digestion, probe can be made to be easier to enter embryo
Intracellular, chance of the increase probe in conjunction with target nucleic acid of tire, raising hybridization signal, but when the excessive concentration of Proteinase K, digestion
Between too long or incubation temperature it is excessively high when, can all have certain destruction to the structure of cell, lead to tissue loss, nucleus disappears
It loses, so that results of hybridization is influenced, and salicylic addition can generate above-mentioned adverse effect, Er Qieneng not only to avoid Proteinase K
Precipitate nucleic acid, histone dissolution prevents chromosome condensation, makes chromosome structure from destroying, improve in subsequent dyeing course
The colorability of tissue improves hybridization signal；
Prehybridization: 1ml prehybridization solution, the prehybridization 1- in 65 DEG C of prehybridization solutions will be added dropwise in the histotomy after fixation
2h, while containing 2*SSCT/50% deionized formamide in wet box as moisturizer；
Hybridization: probe is diluted to 1-2ng/ μ l with prehybridization solution, 80 DEG C of denaturation 10min, every piece 100-200 μ l are miscellaneous
It hands over night, sealed membrane, which divides to be placed in wet box, to be stayed overnight for 65 DEG C；
Post-hybridization washing: taking out the sample of hybridized overnight, via 2 × SSCT/50% deionized formamide, washs at 65 DEG C
2 times, wash 30min every time, 15min is washed at 65 DEG C of 2 × SSCT, then with washing 2 times at 0.2 × SSCT65 DEG C, wash every time
30min is washed, finally washed at room temperature with 1 × PBST 3 times, wash 5min every time.The purpose of washing is that removing is not remaining special
Property combine probe, leave the probe of specific binding, it is non-specific to reduce if background can suitably increase washing times more deeply
Property combine；
Closing: by the sample of post-hybridization washing 2%Blocking reagent antibody confining liquid, 1- is closed at room temperature
2h；
Antibody: closed sample 2%Blocking reagent 1:500 is diluted into antibody, room temperature 2h；
Washing: 5 times are washed with 1 × PBST, washs 10min every time, then washs 5 times with 1 × PBS, wash 10min every time；
It is incubated for: the sample after washing being placed in 1 × plus amplification diluent=1:150, room temperature is incubated
Educate 1h；
Washing: sample is washed 5 times with 1 × PBST, washs 10min every time；
Closing: 2%Blocking reagent, room temperature, 1-2h；
Antibody: antibody, room temperature 2h are diluted with 2%Blocking reagent 1:500；
Washing: 5 times are washed with 1 × PBST, washs 10min every time；1 × PBS is washed 5 times, is washed 10min every time；
Dye nucleus: add DAPI (1 × PBS dilution), be protected from light colour developing；
3 times, every time washing 5min color development stopping are washed with 1 × PBST；
With 50% glycerol mounting, then take pictures.
The sequence of above-mentioned in situ hybridization justice and antisense probe are as follows: 5 '-GTCCGGCCGAATTCACATCA-3 '；5'-
CAGGTTGATGGGCAGGACAC-3’。
In situ hybridization amplified fragments size is 683bp, and extension increasing sequence is as follows:
GTCCGGCCGAATTCACATCAGCGTTCGTGGCGTATACAAAATATTATTGCTGGATATCCAACACCTAC
TACATTCCTATGCGAGACGTGGTCCCTAGCGAGATACACTGGAGGGAAGCGAAGGAAATCAATTACTACCAATGGG
TCCCAATTATATTGTTATTTATGGCCCTCATGTTCAAAATCCCGTGTATTATATGGCGCGTGTTTAGTGGCGCTTC
AGGTTTAAGCTTAGAGAAAATTGTCGACCTCACAGCTGCCACACAGATAGGTTCACCTACTACTCGGGACCAGACT
ATTCATCACATAGCACTTTATATGGACCGCTGGTTAGAGACACATAGAGAGTATCATTGGAATGTAATTGTACGTA
TTAGACAGAAAATAGCGAAGTTCTGCTGCTTCTTCTGTGGTAAACGAGAAGGAACTTATCTAACAGGGTTCTACCT
GTTTATAAAAATGCTCTACGTGGTTAACGCTATAAGTCAGTTTTTTATACTAAACGCCTTCCTTGGACACAATTTC
TATTCCATGTTTGGCTTCGAGGTGGTAGAGAATTTGGCGAAGAACAATGAATGGCGGGAATCGCATCGCTTCCCCC
GGGTCACTTTGTGCGATTTTCAAATCAGACAGTTACAGAATGTCCATCGGTACACCGTGCAGTGTGTCCTGCCCAT
CAACCTG。
The prior art of routine techniques dawn known to those skilled in the art in above-described embodiment, therefore herein no longer in detail
It repeats.
The above embodiments are only used to illustrate the present invention, and not limitation of the present invention, the ordinary skill people of this field
Member can also make a variety of changes and modification without departing from the spirit and scope of the present invention.Therefore, all equivalent
Technical solution also belong to scope of the invention, scope of patent protection of the invention should be defined by the claims.
Sequence table
<110>Zhejiang Ocean university
<120>it is suitable for the genetic marker method of Sepiella maindroni gap connection
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
tatgcgagac gtggtcccta 20
<210> 2
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
acctgaagcg ccactaaaca 20
<210> 3
<211> 148
<212> DNA
<213>Sepiella maindroni (Sepiella maindroni de Rochebrune)
<400> 3
tatgcgagac gtggtcccta gcgagataca ctggagggaa gcgaaggaaa tcaattacta 60
ccaatgggtc ccaattatat tgttatttat ggccctcatg ttcaaaatcc cgtgtattat 120
atggcgcgtg tttagtggcg cttcaggt 148
<210> 4
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
gtccggccga attcacatca 20
<210> 5
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
caggttgatg ggcaggacac 20
<210> 6
<211> 683
<212> DNA
<213>Sepiella maindroni (Sepiella maindroni de Rochebrune)
<400> 6
gtccggccga attcacatca gcgttcgtgg cgtatacaaa atattattgc tggatatcca 60
acacctacta cattcctatg cgagacgtgg tccctagcga gatacactgg agggaagcga 120
aggaaatcaa ttactaccaa tgggtcccaa ttatattgtt atttatggcc ctcatgttca 180
aaatcccgtg tattatatgg cgcgtgttta gtggcgcttc aggtttaagc ttagagaaaa 240
ttgtcgacct cacagctgcc acacagatag gttcacctac tactcgggac cagactattc 300
atcacatagc actttatatg gaccgctggt tagagacaca tagagagtat cattggaatg 360
taattgtacg tattagacag aaaatagcga agttctgctg cttcttctgt ggtaaacgag 420
aaggaactta tctaacaggg ttctacctgt ttataaaaat gctctacgtg gttaacgcta 480
taagtcagtt ttttatacta aacgccttcc ttggacacaa tttctattcc atgtttggct 540
tcgaggtggt agagaatttg gcgaagaaca atgaatggcg ggaatcgcat cgcttccccc 600
gggtcacttt gtgcgatttt caaatcagac agttacagaa tgtccatcgg tacaccgtgc 660
agtgtgtcct gcccatcaac ctg 683
Claims (10)
1. being suitable for the genetic marker method of Sepiella maindroni gap connection, it is characterised in that: including,
The changes in gene expression of the Sepiella maindroni gap connection is detected using real-time fluorescence quantitative PCR；
The expression and distribution of the gene of the Sepiella maindroni gap connection is detected using in situ hybridization；
The gene is the labelled protein Innexin of gap connection.
2. the genetic marker method according to claim 1 suitable for the connection of Sepiella maindroni gap, it is characterised in that:
The real-time fluorescence quantitative PCR detection includes the following steps:
1) Sepiella maindroni genome total serum IgE is extracted, reverse transcription synthesizes cDNA；
2) real-time fluorescence quantitative PCR, detection are carried out using primer pair cDNA；
The real-time fluorescence quantitative PCR primer are as follows: 5 '-TATGCGAGACGTGGTCCCTA-3 '；5'-
ACCTGAAGCGCCACTAAACA-3’。
3. the genetic marker method according to claim 1 or 2 suitable for the connection of Sepiella maindroni gap, feature exist
In: the pcr amplified fragment size is 148bp；The extension increasing sequence is as shown in SEQ ID NO:3.
4. the genetic marker method according to claim 1 or 2 suitable for the connection of Sepiella maindroni gap, feature exist
In: the real-time fluorescence quantitative PCR amplification uses SYBR Green dye method.
5. the genetic marker method according to claim 1 or 2 suitable for the connection of Sepiella maindroni gap, feature exist
In: the real-time fluorescence quantitative PCR amplification reaction system is 20 μ L:7.6 μ L ddH2O, 0.4 μ L, 20 μM of Forward
Primer, 0.4 μ L, 20 μM of Reverse Primer, 10 μ L 2 × SYBR Premix Ex Taq, 1.6 μ L cDNA templates.
6. the genetic marker method according to claim 1 or 2 suitable for the connection of Sepiella maindroni gap, feature exist
In: the real-time fluorescence quantitative PCR amplified reaction procedure selection two-step method:
7. the genetic marker method according to claim 1 suitable for the connection of Sepiella maindroni gap, it is characterised in that:
The in situ hybridization includes: histotomy rehydration, fixation, digestion, prehybridization and hybridization, post-hybridization washing, closing, antibody, washes
It washs, be incubated for, washing, closing, antibody, washing, dye nucleus, colour developing, observing after mounting and take pictures, the fixing step are as follows: will answer
Histotomy after water immerses in the 4%PFA-PBS solution containing 0.01% threonine, the fixed 15min of room temperature, then with 1 ×
PBST solution washs 3 times, each 5min；The ratio of L-threonine and D-Thr is 100:2.8-4.2 in the threonine.
8. the genetic marker method according to claim 7 suitable for the connection of Sepiella maindroni gap, it is characterised in that:
The digestion step are as follows: the histotomy after fixation is placed in containing 10 μ g/ml Proteinase Ks and the 0.8 salicylic solution of μ g/ml
In, digest 10min.
9. the genetic marker method according to claim 1 or claim 7 suitable for the connection of Sepiella maindroni gap, feature exist
In: the sequence of the in situ hybridization justice and antisense probe are as follows: 5 '-GTCCGGCCGAATTCACATCA-3 '；5'-
CAGGTTGATGGGCAGGACAC-3’。
10. the genetic marker method according to claim 1 or claim 7 suitable for the connection of Sepiella maindroni gap, feature
Be: the in situ hybridization amplified fragments size is 683bp, shown in the extension increasing sequence SEQ ID NO:6.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811236675.0A CN109439731A (en) | 2018-10-23 | 2018-10-23 | Genetic marker method suitable for the connection of Sepiella maindroni gap |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811236675.0A CN109439731A (en) | 2018-10-23 | 2018-10-23 | Genetic marker method suitable for the connection of Sepiella maindroni gap |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109439731A true CN109439731A (en) | 2019-03-08 |
Family
ID=65548499
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811236675.0A Pending CN109439731A (en) | 2018-10-23 | 2018-10-23 | Genetic marker method suitable for the connection of Sepiella maindroni gap |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109439731A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110724744A (en) * | 2019-09-16 | 2020-01-24 | 浙江海洋大学 | Marking method of male sepiella maindroni germ line cells |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2012146845A (en) * | 2012-11-02 | 2014-05-10 | Федеральное государственное бюджетное учреждение "Институт общей генетики им. Н.И. Вавилова" Российской Академии Наук | METHOD FOR EARLY DIAGNOSIS OF PSORIASIS BASED ON THE MULTIMARKER PANEL |
| CN105648065A (en) * | 2016-02-05 | 2016-06-08 | 中国科学院海洋研究所 | Method suitable for bastard halibut gonad frozen section mRNA in-situ hybridization |
-
2018
- 2018-10-23 CN CN201811236675.0A patent/CN109439731A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2012146845A (en) * | 2012-11-02 | 2014-05-10 | Федеральное государственное бюджетное учреждение "Институт общей генетики им. Н.И. Вавилова" Российской Академии Наук | METHOD FOR EARLY DIAGNOSIS OF PSORIASIS BASED ON THE MULTIMARKER PANEL |
| CN105648065A (en) * | 2016-02-05 | 2016-06-08 | 中国科学院海洋研究所 | Method suitable for bastard halibut gonad frozen section mRNA in-situ hybridization |
Non-Patent Citations (6)
| Title |
|---|
| SUN-MEE HONG等: "Two gap junction channel (innexin) genes of the Bombyx mori and their expression", 《J INSECT PHYSIOL》 * |
| 刘国树等: "细胞狭隙连接", 《生物学杂志》 * |
| 宋平: "《生物化学与分子生物学实验教程》", 31 March 2003, 高等教育出版社 * |
| 徐信: "细胞连接", 《生物学通报》 * |
| 来茂德: "《病理学高级教程》", 28 February 2015, 人民军医出版社 * |
| 郑芳等主编: "《临床分子诊断学》", 31 July 2014, 华中科技大学出版社 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110724744A (en) * | 2019-09-16 | 2020-01-24 | 浙江海洋大学 | Marking method of male sepiella maindroni germ line cells |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Acloque et al. | In situ hybridization analysis of chick embryos in whole‐mount and tissue sections | |
| Rosen et al. | Whole-mount in situ hybridization in the mouse embryo: gene expression in three dimensions | |
| del Pilar Corena et al. | Carbonic anhydrase in the midgut of larval Aedes aegypti: cloning, localization and inhibition | |
| CN108753776A (en) | A kind of circular rna circGHR and detection primer participating in chicken muscle growth and development | |
| CN107354219B (en) | Method and kit for identifying penguin sex | |
| CN109439731A (en) | Genetic marker method suitable for the connection of Sepiella maindroni gap | |
| CN108203732A (en) | Applications of the TRIM24 in diagnosis of glioma | |
| CN104531724A (en) | Gene PpRd for regulating fruit flesh cyanin synthesis and application thereof | |
| CN105039324B (en) | A kind of specificity amplification primer and its detection kit for detecting Shelled Turtle Trionyx Sinensis hemorrhage virus | |
| WO2024017382A1 (en) | Primer for detecting porcine dna and detection method | |
| CN109988846B (en) | Method suitable for in situ hybridization of red swamp crayfish gonad tissue mRNA paraffin section | |
| Domire et al. | Markers for neuronal cilia | |
| CN106119384A (en) | A kind of Aeromonas hydrophila method for nucleic acid analysis and the application in legal medical expert detects | |
| CN109536451A (en) | Application of the RTL1 gene in regulation myoblast proliferation and differentiation | |
| CN113185558B (en) | Galactose modified detection probe capable of being identified by OGT (one glass solution) | |
| CN110250108A (en) | RPRM gene knock-out mice model and its construction method and application | |
| CN116064826A (en) | Primer and method for detecting bovine-derived DNA | |
| Márquez-López et al. | Auxin immunolocalization in Coffea canephora tissues | |
| Henley et al. | Reliable identification of living dopaminergic neurons in midbrain cultures using RNA sequencing and TH-promoter-driven eGFP expression | |
| Piperidis | GISH: resolving interspecific and intergeneric hybrids | |
| CN106916816B (en) | Target the more target position siRNA molecules and application of EMS1/cortactin | |
| CN102166346B (en) | Lrrc10 micromolecules and application thereof to preparation of medicaments for treating myocardial hypertrophy | |
| CN110117618A (en) | A kind of labeling method of Sepiella maindroni archaeocyte | |
| SALIM | The effect of the interaction between two mutations MSTN/T434C and CAST/T350C on carcass and meat traits in Arabi sheep in Iraq | |
| CN114645076B (en) | miR-589-3p horizontal in-situ hybridization detection kit and detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190308 |
|
| RJ01 | Rejection of invention patent application after publication |