CN108203732A - Applications of the TRIM24 in diagnosis of glioma - Google Patents

Applications of the TRIM24 in diagnosis of glioma Download PDF

Info

Publication number
CN108203732A
CN108203732A CN201711031231.9A CN201711031231A CN108203732A CN 108203732 A CN108203732 A CN 108203732A CN 201711031231 A CN201711031231 A CN 201711031231A CN 108203732 A CN108203732 A CN 108203732A
Authority
CN
China
Prior art keywords
trim24
albumen
glioma
genes
egfr
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201711031231.9A
Other languages
Chinese (zh)
Other versions
CN108203732B (en
Inventor
冯海忠
吕德官
张伟伟
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Renji Hospital Shanghai Jiaotong University School of Medicine
Original Assignee
Renji Hospital Shanghai Jiaotong University School of Medicine
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Renji Hospital Shanghai Jiaotong University School of Medicine filed Critical Renji Hospital Shanghai Jiaotong University School of Medicine
Priority to CN201711031231.9A priority Critical patent/CN108203732B/en
Publication of CN108203732A publication Critical patent/CN108203732A/en
Application granted granted Critical
Publication of CN108203732B publication Critical patent/CN108203732B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6863—Cytokines, i.e. immune system proteins modifying a biological response such as cell growth proliferation or differentiation, e.g. TNF, CNF, GM-CSF, lymphotoxin, MIF or their receptors
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6872—Intracellular protein regulatory factors and their receptors, e.g. including ion channels
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/118—Prognosis of disease development
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Cell Biology (AREA)
  • Pathology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Biophysics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention provides EGFR and TRIM24 to co-express the application in diagnosis of glioma.The present invention provides for diagnose the grade malignancy of glioma or predict Response in Patients with Gliomas life cycle kit, it is characterized in that, comprising for detecting the reagent of TRIM24 genes and/or albumen or EGFR gene and/or albumen and TRIM24 genes and/or albumen, TRIM24 genes and/or albumen and the expression of EGFRVIII genes and/or albumen.The present invention provides the molecular labelings of new glioma, for the molecular labeling, Molecular marker kit has also been devised in the present invention, can be used for differentiating the grade malignancy of glioma and the life cycle of tumor patient is predicted, future is expected to develop specificity for p EGFRY1172The new type nerve Treatment for Glioma drug of/TRIM24 signal paths simultaneously verifies its curative effect.

Description

Applications of the TRIM24 in diagnosis of glioma
Technical field
The present invention relates to EGFR-TRIM24 to co-express the application in diagnose and treat glioma.
Background technology
Glioma is most common Primary intracranial tumor, mainly includes 4 kinds of histological types：Astrocytoma is lacked Prominent spongiocytoma, ependymoma and Mixed Gliomas.It is counted according to brain tumor registration center of the U.S., glioblastoma is about Account for the 70% of primary malignancy brain tumor.In glioblastoma, human anaplastic astrocytoma (AA, WHO III level) and pleomorphism Glioblastoma (IV grades of GBM, WHO) is most common, and wherein GBM accounts for about the 50% of all gliomas.At present, glioma Diagnosis rely primarily on CT and MRI.Some new MRI, as DTI, DWI, PWI, MRS, fMRI help to improve diagnostic level and Judging prognosis.PET, SPECT help to differentiate tumor recurrence and radionecrosis.But it is final, it still needs to pass through tumor resection Art or biopsy carry out the pathological diagnosis of clear and definite glioma.That is：Morphologic observation is to glioma always Carry out the basis of pathological diagnosis and classification.The basic principle of glioma classification is following 7：Oncocyte density；Oncocyte Pleomorphism or atypical, including it is low differentiation and undifferentiated ingredient；The height heteromorphism or atypical of oncocyte core, goes out Existing multinuclear and macronucleus；The nuclear fission activity of height；(there is glomerulus sample blood vessel hyperplasia) in vascular endothelial proliferation；Necrosis is (false Palisade necrosis) and the raising of Ki-67 proliferation indexes.
To coordinate treatment, observation of curative effect and the judging prognosis of patients with gliomas,《2012 editions Chinese central nervous system glue The diagnosis of matter knurl, treatment guidelines》It is required that China's situation of all-level hospitals, according to actual conditions, adaptation to local conditions carries out selectivity to glioma Mark of molecular biology.LGG, which detects IDH1 gene mutations and chromosome 1p/19q loss of heterozygosity, has clinical prognosis judgement Significance.It is in GFAP with the glioma to Astrocyte differentiation feature and 60%-70% oligodendrogliomas Positive expression.Oligodendroglia specificity nuclear factor (Olig2) is to differentiating that oligodendroglioma and astrocyte come The glioma in source has certain reference value.The Ki-67 proliferation indexes and differentiation degree of tumour, infiltration or transfer and prognosis There is close association, be to judge one of important references index of tumor prognosis.Neuron-specific nucleoprotein (NeuN) is to judging tumour In neuron composition be of great significance, the diagnosis and discriminating for being mainly used for colloid neuron tumour and nerve-cell tumor are examined It is disconnected.In addition, according to the relevant mark of molecular biology of signal transduction pathway, and medulloblastoma can be divided into several molecule Hypotype, such as Wnt types, Shh types and non-Wnt/Shh types.This classification is formulated the therapeutic scheme more optimized for clinic and is accurately sentenced Disconnected prognosis is significant, but the further verification for the large sample size clinical pathology that needs.
At present, the treatment of glioma is based on excision of performing the operation, and combines radiation and chemotherapy etc..Temozolomide (TMZ) Concurrent radiotherapy joint adjuvant chemotherapy has become the standard regimens of new diagnosis GBM.How glioblastoma is predicted to chemotherapeutic The reactivity of object reduces the treatment focus that chemoresistant is chemotherapy.Endogenous O6- methyl guanines-dnmt rna (MGMT) methylation level and chromosome 1p/19q loss of heterozygosity can be respectively used to prediction GBM and oligodendroglioma Chemotherapy side effect and prognosis.Different types of glioma is also different to the sensibility of radiotherapy, it is considered that differentiation The tumour of difference is height compared with having broken up.It is most sensitive to radiotherapy with medulloblastoma, it is secondly ependymoblastoma, multiform Property glioblastoma only medium sensitivity, astrocytoma, oligodendroglioma, pinealocytoma etc. is more worse.To marrow Blastoma and ependymoma because easily being sent out with cerebrospinal fluid, are irradiated complete should include canalis spinalis.
Therefore, the diagnosis that the continuous progress in terms of tumor cells pathology and science of heredity could be glioma is had only More detailed information is provided, directive function is made, and to the prognosis of patient for the classification of clinical tumor and the selection of therapeutic modality It makes and more accurately assessing.But in China, particularly some middle and small hospitals are due to lacking skilled europathology doctor, hand Postoperative pathological diagnosis is inaccurate, and some areas are classified not yet using WHO, makes the shortage of the successive treatment after corrective surgery can The pathology foundation leaned on.This is very unfavorable to the complex treatment of patient and the raising of curative effect, while also makes its clinical efficacy Assessment is more difficult.And on the other hand, the glioma of height heterogeneity certainly will need a large amount of new gliomas point The continuous excavation of son label could realize individuation comprehensive strategic, optimization and Canonical management side to the treatment of glioma Case to reach maximum therapy benefit, extends patient's progression free survival phase, improves life quality as much as possible.
Invention content
The technical problems to be solved by the invention are to provide a kind of molecular labeling of new glioma, for diagnosing With treatment glioma.
In order to solve the above technical problem, the present invention provides following technical solutions：
The grade malignancy diagnostic kit of a kind of glioma, which is characterized in that comprising for detecting TRIM24 genes And/or albumen or EGFR gene and/or albumen and TRIM24 genes and/or albumen, TRIM24 genes and/or albumen and The reagent of the expression of EGFRVIII genes and/or albumen.
The present invention also provides a kind of Response in Patients with Gliomas life cycle predict kit, which is characterized in that including with In detection TRIM24 genes and/or albumen or EGFR gene and/or albumen and TRIM24 genes and/or albumen, TRIM24 The reagent of gene and/or albumen and the expression of EGFRVIII genes and/or albumen.
The present invention also provides for detect TRIM24 genes and/or albumen or EGFR gene and/or albumen and TRIM24 genes and/or albumen, TRIM24 genes and/or albumen and the expression of EGFRVIII genes and/or albumen Application of the reagent in the diagnostic reagent of grade malignancy of glioma is prepared.
The present invention also provides for detect TRIM24 genes and/or albumen or EGFR gene and/or albumen and TRIM24 genes and/or albumen, TRIM24 genes and/or albumen and the expression of EGFRVIII genes and/or albumen Application of the reagent in the life cycle prediction reagent for preparing Response in Patients with Gliomas.
The preferred EGFR albumen is p-EGFRY1172。
The present invention also provides can inhibit TRIM24 genes and/or albumen or TRIM24 genes and/or albumen and The reagent of the expression of EGFR gene and/or albumen or TRIM24 genes and/or albumen and EGFRVIII genes and/or albumen Application in the medicine for preparing glioma.
Preferably, the EGFR albumen is p-EGFRY1172。
The present invention also provides a kind of glioma diagnostic kits, which is characterized in that comprising for detecting TRIM24 Gene and/or albumen or EGFR gene and/or albumen and TRIM24 genes and/or albumen, TRIM24 genes and/or albumen And the reagent of the expression of EGFRVIII genes and/or albumen.
The preferred EGFR albumen is p-EGFRY1172。
The principle of the present invention is as follows：One important feature of human tumor be amplification or high expression oncogene so as to Abnormal activation oncogenic signals access.In human glioma, EGF-R ELISA (Epidermal growth Factor receptor, EGFR) frequently amplification and often with its constitutive activation mutant (Δ EGFR also known as EGFRVIII or de2-7EGFR) coexpression.The carcinogenic EGFR signal paths of this activation participate in the generation of tumour, development and its To the resistance for the treatment of.In general, EGFR is mainly by activating Akt access induced tumors, then stimulate tumor cell proliferation, Survival and drug resistance.In the glioma of people, the activation of Akt accesses is expanded and is mutated derived from EGFR mostly, PI3KCA mutation or PTEN is lacked.In prostate cancer and breast cancer, Akt albumen can pass through insulin-like growth factor-Ⅱ tumor necrosis factor respectively Receptor associated factor 6 (Tumor necrosis factor receptor-associated factor 6, TRAF6) or The ubiquitination that HER2-Skp2 axis is induced is activated.In addition to the EGFR-Akt signal shafts of abnormal activation and other in nerve Determined oncogenic pathways in glioma, it is more likely that also have other more crucial genes by participating in or being parallel to It plays a role in above-mentioned generally acknowledged oncogenic signals conduction path and promotes tumour.
Tri- motif protein family members 24 (TRIM24) of TRIM24 are also referred to as 1 α of transcriptional intermediary factor (TIF1a). TRIM24 Amino terminal RBCC structural domains (Ring, B-Box and Coiled-Coil) and definition TIF1 with TRIM families feature are sub- PHD-bromo the structural domains of family.TRIM24 has been demonstrated that oncogene or tumor suppressor can be used as.Although mouse The gene delection of TRIM24 promotes hepatocellular carcinoma (HCC), but the expression of the abnormal excessive of mankind TRIM24 (is wrapped with kinds cancer Including gastric cancer, carcinoma of urinary bladder, non-small cell lung cancer, head and neck cancer and breast cancer) cancer progression of patient and survival be in positive It closes.In drosophila and human breast carcinoma, TRIM24 targets p53 as ubiquitin E3 ligases.TRIM24 is in breast cancer and prostate cancer It is accredited the transcriptional coactivator of the transcription factors such as estrogen receptor and androgen receptor respectively, activation is relevant with tumour progression Downstream signal transduction.However, functions of the TRIM24 in cancer is still largely unknown.Pass through multiple database point Analysis is it was found that TRIM24 is high expression in glioma, and expression is apparent to be increased as rank increases.By right The different type cancer cell of EGFR/EGFRVIII stimulations carries out proteomics research, it was verified that TRIM24 genes and egg White expression all can be raised significantly, this shows to play a role in the cancer cell behavior that TRIM24 may be stimulated in EGFR.
The present invention is had found using Oncomine data analyses and immunohistochemical method detection glioma sample Protein science expression raising of the TRIM24 genes in clinical glioma tumor sample, derives cancer cell line in glioma In, EGF stimulates cellular proliferation and survives and must be mediated by TRIM24, and TRIM24 transmits EGFR signals and participates in Related oncogene table Up to regulation and control, TRIM24 is the key factor that EGFR driving tumours are formed.The present invention at home and abroad takes the lead in finding in glioma EGFR causes TRIM24 genes and protein expression level significantly to increase.This novel TRIM24 signal that the present invention is had found Access becomes the crucial terminal of EGFR oncogenic signals accesses.The present invention is research shows that the EGFR (p- for expressing activated form high simultaneously EGFRY1172) with the glioma of TRIM24, WHO pathological grading ranks higher (grade malignancy is higher), patient survival are shown It writes and shortens.
The present invention also provides with TRIM24 and p-EGFRY1172For the immunohistochemistry lesion detection kit of index, Expression of two indexs in patients' neural's glioma sample can be semi-quantitatively weighed, so as to malignancy It makes and more accurately judging, and tumor patient life cycle is made and is more accurately predicted.This new type nerve diagnosis of glioma tries Agent box quickly and accurately grasps TRIM24 and p-EGFR for pathology workerY1172The immunohistochemistry dye of two big indexs Color operating method so as to accurately detect the expression of two kinds of albumen, is made malignancy and is more accurately judged, and Tumor patient life cycle is made and is more accurately predicted.The present invention screening for cancer method can easily with other method knots It closes, to provide more structurally sound diagnosis or prediction index, thus provides multiple labeling inspection.
Compared with prior art, the beneficial effects of the invention are as follows：
The present invention provides new glioma molecular labeling TRIM24, and for the molecular labeling, the present invention also designs Molecular marker kit can be used for differentiating the grade malignancy of glioma and life cycle of tumor patient carried out Prediction, future are expected to develop new type nerve Treatment for Glioma drug of the specificity for TRIM24 signal paths, and pass through Patient is carried out more careful parting by testing result, so as to more targetedly with effective medication, cure or improve disease The people living phase improves patients with gliomas life quality.
Description of the drawings
Fig. 1 a analyze the TRIM24 mRNA expression water of Normal brain and GBM from TCGA databases with oncomine It is flat.TCGA databases statistics indicate that, compared with normal cerebral tissue, TRIM24 gene expression doses in glioblast patient It is significantly raised.
Fig. 1 b are the normal brain activity from GSE4290 data sets, II-III grade of astroglia and TRIM24 in GBM The analysis of the expression of mRNA.(a and b) and One-way ANOVA and Newman-Keuls are examined by using two-way t is matched Post-hoc tests calculate P values.As a result it shows, the higher patients with gliomas TRIM24 expression of rank is higher.TRIM24 may be with colloid Knurl lesion, deterioration have digestion relationship.
The influence that Fig. 2 qRT-PCR analyses EGFRvIII expresses LN229 and U87GBM cell TRIM24 mRNA.
Stablized by slow virus and be overexpressed exogenous EGF RvlII, qRT-PCR analysis TRIM24 expression discoveries, be overexpressed EGFRvlII can be obviously promoted glioma cell TRIM24 mRNA expression.
It is exogenous to show that our successes are overexpressed in U87MG and LN229 glioma cells for Fig. 3 a immune protein traces EGFRvlII, EGFRvIII can increase TRIM24 protein expressions, at the same we successfully struck with two no shRNA it is low U87/EGFRvIII cell TRIM24 protein expressions.TRIM24 strikes the low expression and activation for not interfering with glioma cell EGFR, Will not influence actin (β-actin) expression, but the expression of TRIM24 can be significantly reduced, illustrate our carrier without Undershooting-effect, and ShTRIM24 is effective.
Fig. 3 b cell proliferation experiments confirm that EGFRvIII can dramatically increase glioma U87 and LN229 cell Proliferation, and U87 and LN229 cell Proliferations caused by knockout TRIM24 can significantly inhibit EGFRvIII.
Fig. 3 c soft-agar clonings form experiment and show that EGFRvIII being capable of significantly induction gum knurl U87 and LN229 cells Proliferating clones are formed, and clonality caused by EGFRvIII can significantly be inhibited by knocking out TRIM24, prompt TRIM24 pairs The glioma growth of EGFRvIII drivings is important.
Fig. 3 d TransweII cells migrate it is experimentally confirmed that EGFRvIII can significantly induction gum knurl U87 and LN229 it is thin Born of the same parents are proliferated local transfer, and knock out cell caused by TRIM24 can significantly weaken EGFRvIII and shift.
The experiment of Fig. 3 e nude mice intracerebral allografts knurl further demonstrates that it is thin that FGFRvIII can dramatically increase glioma U87 Born of the same parents' tumor growth, and knock out glioma tumor caused by TRIM24 can inhibit EGFRvIII and grow.
Fig. 3 f statistics shows that EGFRvIII increases glioma U87 and LN229 cell growth in vivo and knocks out TRIM24 suppressions Glioma tumor growth is respectively provided with statistical significance caused by EGFRvIII processed.
Fig. 4 a we using mRNA-seq technologies analysis TRIM24 how to mediate EGFRvIII regulation and control glioma send out Exhibition.It is overexpressed EGFRvIII and strikes low TRIM24, the gene that reconciliation TRIM24 is lowered on mRNA-seq analyses EGFRvIII, I Find that TRIM24 adjusts 35 gene expressions and may mediate the effect of EGFRvIII.
Fig. 4 b by functional annotation (GO) analysis find by EGFRvIII raise and struck by TRIM24 the gene lowly adjusted with Cell proliferation pathways are related.
Fig. 4 c we analyze expression of the said gene in patients with gliomas.Patient gene expresses data (GSE4290) hierarchical cluster analysis shows compared with normal structure occur in 22 gene glioblast patients apparent Height expression shows that there are notable positive correlations with glioma for EGFR-TRIM24 high expression.
The tumor specimen of the clinical Response in Patients with Gliomas of Fig. 5 a immunohistochemical stainings analysis, p-EGFRY1172Dyeing is strong The tissue T RIM24 dyeing of positive (shown in white coil) is also strong positive (shown in white coil), and p-EGFRY1172Dyeing is cloudy Property (shown in black wire frame) tissue T RIM24 dyeing be also negative (shown in black wire frame).Prompt p-EGFRY1172In people's colloid Can also TRIM24 be promoted to express in knurl.
Fig. 5 b immunohistochemical stainings are high simultaneously to express p-EGFRY1172With the life of the clinical patients with gliomas of TRIM24 It deposits the phase and significantly shortens.
Fig. 6 is Q-PCR reaction condition figures.
Specific embodiment
With reference to specific embodiment, the present invention is further explained.It should be understood that these embodiments are merely to illustrate this hair It is bright rather than limit the scope of the invention.In addition, it should also be understood that, after reading the content taught by the present invention, this field skill Art personnel can make various changes or modifications the present invention, and such equivalent forms equally fall within the application the appended claims Limited range.
Embodiment 1：Genomics expression raising of the TRIM24 genes in clinical glioma tumor sample
(1) bioinformatic analysis 1：
Open oncomine databases (https：//www.oncomine.org/), TRIM24 inspections are inputted in search column Rope selects brain and CNS cancer, in left side inside Disease Summary for TRIM24 tables Inside primary filters after selection cancer VS.Normal Analysis, selected inside the result of right side containing The database of Glioblastoma vs.Normal checks result.
As a result as Fig. 1 a are shown：Show TRIM24mRNA being averaged in 10 normal cerebral tissues from TCGA data analyses Expression value is (log2) 2.403, and the mean expression value in 542 glue blastoma patients is 3.678 (log2), it is normal 2.503 times of brain tissue, expressions of the TRIM24 in glue blastoma patient are apparently higher than normal cerebral tissue, and have There is significant difference (p=1.17E-8).
(2) bioinformatic analysis 2：
Pass through GEO databases (https：//www.ncbi.nlm.nih.gov/geo/) downloading data collection GSE4290 (Expression data of glioma samples from Henry Ford Hospital), analyzes each patient's The expressing information (the incomplete pathological sample of information not uses) of TRIM24, and be grouped with WHO pathological gradings, pass through Graphpad softwares are mapped, and as a result as shown in Figure 1 b as pathological grading increases (2 to 4), TRIM24 expression is apparent to be increased Add.
Embodiment 2：Exogenous EGF RvlII dramatically increases glioma U87, LN229 cell TRIM24 gene expression doses
EGFRvIII is infected into glioma U87 and LN229 cell by slow virus, RNA is then extracted, passes through QRT-PCR detection TRIM24 expression.
2.1293T cell packs lentiviral particle：
By 293T cells, (purchased from ATCC, ATCC numbers are CRL-3216TM) it is incubated at DMEM culture mediums：Contain 10% tire Cow's serum (Sigma, 12006C), 1% mycillin (Gibco, 15140-122) and DMEM culture solutions (Gibco, 10564011), in 37 DEG C, 5%CO2 sterile cultures case (thermo) is cultivated.
It first day, takes and is inoculated into the 293T cells in 10cm culture dish logarithmic growth latter stages (cell number is about 5 × 106), it inhales Fall culture medium.Cell is gently washed with 2mL DPBS (Invitrogen, 14190250) to remove remaining medium, is gently inhaled Fall DPBS (being careful not to dispel 293T cells), be repeated 3 times.Add in 37 DEG C of 0.25% pancreatin of 1ml (Gibco, 25200-072) It after digestion 2 minutes, is terminated and digested with 10ml fresh DMEM mediums, nose heave cell is blown and beaten again with suction pipe or 1000ml substitutes Cell is made to be uniformly dispersed, 293T is counted with blood platelet counting plate, suitable volumes cell suspension is then drawn and is taped against six orifice plates (Corning, 3516), cell number is about 5 × 105, allow growth for 24 hours, the cell confluency degree before transfection should be 80%.
It second day, is operated according to the specification of fugen-6 kits.By EGFRvlII virus particles (viral vectors, Addgene, Plasmid 20737), psPAX2 (packaging plasmid, Addgene, Plasmid 12260), pMT24G (outer chitins Grain, Addgene, Plasmid 12259) cotransfection 293T cells.Single hole be respectively necessary for virus particle 1ug, PsPAX20.75ug, pMT24G 0.25ug, i.e., 4: 3: 1.
Third day after transfection for 24 hours, is replaced with every hole 3ml fresh DMEM mediums, starts enriching virus.
4th day, after transfecting 48h, collect culture medium, that is, viral supernatants.The viral supernatants collected are drawn with 5mL syringes, After being filtered via 0.45 μm of filter (Millipore companies, SLHV013SL), it is sub-packed in 1.5ml centrifuge tubes, as 48h diseases Malicious suspension preserves 3-7 days or -80 DEG C long-term keep for future use at 4 DEG C.
The 293T cells of transfected virus are continued to be changed to 3ml fresh DMEM mediums, after for 24 hours, after as transfecting 72h collects vial supernatant, according to the operating procedure identical with transfection 48h, obtains 72h viral suspensions, -80 DEG C of preservations are standby With.
2.2 slow-virus infection LN229/EGFRvIII and U87/EGFRvIII cell experiment methods：
1) 18-24h before slow-virus infection, by LN229 and U87 cells, (LN229, U87 cell are purchased from ATCC, ATCC numbers Respectively CRL-2611TMAnd HTB-14TM) with 1 × 105/ hole is taped against in 24 orifice plates, is added in fresh DMEM medium and is cultivated, It is 2 × 10 to make quantity of the cell in slow-virus transfection5/ hole or so.Fresh DMEM medium ingredient is contains 10% tire ox blood The DMEM culture solutions (Gibco, 10564011) of (Sigma, 12006C), 1% mycillin (Gibco, 15140-122) clearly.
2) it second day, is replaced with the fresh DMEM culture mediums of the 2ml containing 6 μ g/ml polybrene (Sigma, H9628) Former culture medium adds in 100 microlitres of transfection 48h 72h viral suspensions.37 DEG C of incubations.
3) after 24 hours, the culture medium containing virion is replaced with fresh DMEM medium.
4) continue to cultivate.Since the slow virus contains GFP fluorescins, general visible apparent fluorescence table after transfecting 48h It reaches, it is more obvious after 72h.The slow virus contains puromycin resistance gene, transfection starts after 3 days plus puromycin (Sigma, P8833, final concentration of 400-800ng/ml), cell, which covers with, to pass on.Every 3 days of period was replaced once fast containing same concentrations The fresh culture of purine mycin, 2 week of step sizing obtain LN229/EGFRvIII, U87/EGFRvIII cells.
2.3qRT-PCR detects TRIM24 gene expressions
By the cell inoculation for needing to extract RNA to six orifice plates (corning), wait after cells cover with hole wall, according to The operating procedure extraction mRNA of Trizol kits, according still further to reverse transcription reagent box (RR037A) specification of Takara companies, It is CDNA by mRNA reverse transcriptions.Real-time quantitative PCR is carried out using Applied Biosciences 7900HT real-time PCR systems TRIM24 gene expression doses are detected, ACTB is internal reference.Practical Applied Biosystems SDS softwares 2.2.2 is calculated Threshold cycle number.
Primer sequence is respectively (the synthesis identification of Shanghai Sheng Gong bioengineering Co., Ltd)：
TRIM24 sequence 1Forward Sequence：5’-TGTGAAGGACACTACTGAGGTT-3’(SEQ ID NO：1)
Sequence 2Reverse Sequence：5’-GCTCTGATACACGTCTTGCAG-3(SEQ ID NO：2)
ACTB sequence 3Forward Sequence：5’-CATGTACGTTGCTATCCAGGC-3’(SEQ ID NO：3)
Sequence 4Reverse Sequence：5’-CTCCTTAATGTCACGCACGAT-3’(SEQ ID NO：4)
Q-PCR reaction systems：Final concentration of 0.2 μM of primer, reaction total volume are 50 μ l
Q-PCR reaction conditions are as shown in Figure 6.
Experiment is repeated 3 times.The results are shown in Figure 2, and EGFRvIII dramatically increases glioma cell TRIM24 gene expressions, It is about 3 times to increase multiple.
Embodiment 3：In glioma derives cancer cell line, EGF stimulates its cell Proliferation and survival that TRIM24 is needed to mediate
(1) using fugen-6 kits (purchased from Roche, 04709705001) experimental procedure to specifications by two ShRNA virus particles (shT24-1 virus particles, lucky triumphant gene, 22927, shT24-2 virus particles, the Ji Kai of a TRIM24 Gene, 22930) and shRNA comparison virus plasmid (shC virus particles, lucky triumphant gene, CONO77) respectively with psPAX2 (packagings Plasmid, Addgene, Plasmid 12260), pMT24G (shell plasmid, Addgene, Plasmid 12259) formed virus Infect in LN229/EGFRv III and the U87/EGFRvIII cells of 2 gained of embodiment (LN229, U87 cell are purchased from ATCC, ATCC numbers are respectively CRL-2611TMAnd HTB-14TM)。
3.1293T cell packs lentiviral particle：
(purchased from ATCC, ATCC numbers are CRL-3216 to 293T cellsTM) it is incubated at DMEM culture mediums：Contain 10% tire ox Serum (Sigma, 12006C), 1% mycillin (Gibco, 15140-122) and DMEM culture solutions (Gibco, 10564011), In 37 DEG C, 5%CO2Sterile culture case (thermo) is cultivated.
It first day, takes and is inoculated into the 293T cells in 10cm culture dish logarithmic growth latter stages (cell number is about 5 × 106), it inhales Fall culture medium.Cell is gently washed with 2ml DPBS (Invitrogen, 14190250) to remove remaining medium, is gently inhaled Fall DPBS (being careful not to dispel 293T cells), be repeated 3 times.Add in 37 DEG C of 0.25% pancreatin of 1ml (Gibco, 25200-072) It after digestion 2 minutes, is terminated and digested with 10ml fresh DMEM mediums, nose heave cell is blown and beaten again with suction pipe or 1000ml substitutes Disperse cell and uniformly, 293T is counted with blood platelet counting plate, then draw suitable volumes cell suspension and be taped against six orifice plates (Corning, 3516), cell number is about 5 × 105, allow growth for 24 hours, the cell confluency degree before transfection should be 80%.
It second day, is operated according to the specification of fugen-6 kits.By shRNA virus particles, the psPAX2 of TRIM24 (packaging plasmid, Addgene, Plasmid 12260), pMT24G (shell plasmid, Addgene, Plasmid 12259) cotransfection 293T cells.Single hole is respectively necessary for virus particle 1ug, psPAX20.75ug, pMT24G 0.25ug, i.e., 4: 3: 1.Same sample prescription Method is by shRNA comparison virus plasmid, psPAX2 (packaging plasmid, Addgene, Plasmid 12260), pMT24G (outer chitins Grain, Addgene, Plasmid 12259) cotransfection 293T cells.
Third day after transfection for 24 hours, is replaced with every hole 3ml fresh DMEM mediums, starts enriching virus.
4th day, 48h after transfection, collect culture medium, that is, viral supernatants.The viral supernatants collected are drawn with 5ml syringes, After being filtered via 0.45 μm of filter (Millipore companies, SLHV013SL), it is sub-packed in 1.5ml centrifuge tubes, as 48h viruses Suspension preserves 3-7 days or -80 DEG C long-term keep for future use at 4 DEG C.
The 293T of transfected virus is continued to be changed to 3ml fresh DMEM mediums, after for 24 hours, 72h after as transfecting is received Collect vial supernatant, according to the identical operating procedures of 48h after transfection, remove the 293T cells in virus liquid, obtain 72h viruses Suspension saves backup.
3.2 slow-virus infection LN229/EGFRvIII and U87/EGFRvIII cell experiment methods：
1) 18-24h before slow-virus infection, by LN229/EGFRvIII and U87/EGFRvIII cells with 1 × 105/ hole is spread It into 24 orifice plates, adds in fresh DMEM medium and is cultivated, it is 2 × 10 to make quantity of the cell in slow-virus transfection5/ hole Left and right.The fresh DMEM medium ingredient of LN229/EGFRvIII and U87/EGFRvIII cells is contains 10% fetal calf serum The DMEM culture solutions (Gibco, 10564011) of (Sigma, 12006C), 1% mycillin (Gibco, 15140-122).
2) it second day, is replaced with the fresh DMEM culture mediums of the 2ml containing 6 μ g/ml polybrene (Sigma, H9628) Former culture medium adds in 100 microlitres of 48h 72h viral suspensions.37 DEG C of incubations.
3) after 24 hours, the culture medium containing virion is replaced with fresh DMEM medium.
4) continue to cultivate.Since the slow virus contains GFP fluorescins, general visible apparent fluorescence table after transfecting 48h It reaches, it is more obvious after 72h.The slow virus contains puromycin resistance gene, transfection starts after 3 days plus puromycin (Sigma, P8833, final concentration of 400-800ng/ml), cell, which covers with, to pass on.Every 3 days of period was replaced once fast containing same concentrations The fresh culture of purine mycin after 2 week of step sizing, i.e., observes more than 90% GFP positive cells (i.e. under the microscope Represent shRNA successes infection cell).
3.3 Western blots verification shRNA knocks out the efficiency of TRIM24 and its to EGFR, p-EGFR, β-actin expression Influence
1) protein sample is collected
Using the Western produced added with the green skies of 1x protease inhibitors (cocktail, Roche, 17938100) and IP cell pyrolysis liquids (P0013) crack LN229, U87, LN229/EGFRvIII, U87/EGFRv III, LN229/ on ice EGFRvIII/shTRIM24 and U87/EGFRvIII/shTRIM24 cells ten minutes, then 4 DEG C, 12000rmp/min, centrifugation 10 minutes.It collects in lysate supernatant to new EP pipes and marks, after protein sample is collected, to ensure each protein sample Applied sample amount it is consistent, according to BCA quantification kit operational manuals, using BCA determination of protein concentration kit (the green skies, P0009 the protein concentration of each protein sample) is measured.
2) electrophoresis
A, PAGE gel is prepared
The PAGE gel reagent preparation box (P0012A) produced using the green skies.The kit provide water removal and The formula of all reagents and the various concentration SDS-PAGE of preparation outside with glue utensil.The required glass plate of gel will be prepared, The wash cleans such as clip, silicagel pad, then 37 DEG C of drying.Glass plate is clipped and adds in deionized water leak detection, according to matching for specification It tabulates suitable deionized water, 30% polyacrylamide, separation gel buffer solution, 10%APS and TEMED mixed preparings institute The separation gel of concentration is needed, outwells the deionized water inside glass plate, bubble will be prevented in the careful addition glass plate of separation gel It generates, adds in deionized water closing 30min and wait for gelling solid.After waiting separation gelling solid, prepared according to specification with tabulation dense Contracting glue.By suitable deionized water, 30% polyacrylamide concentrates glue buffer solution, 10%APS and TEMED mixed preparings Glue is concentrated, outwells the water on separation gel upper strata, adds in concentration glue, quickly insertion comb gently, obtains SDS-PAGE offset plates.
B, sample treatment
SDS-PAGE albumen sample-loading buffer (the green skies of the 5X of concentration are proportionally added into the protein sample of collection SDS-PAGE albumen sample-loading buffer (5X, P0015).Boiling water bath heats 5 minutes, with abundant albuminate.
C, loading and electrophoresis
After samples is waited to be cooled to room temperature, the SDS-PAGE offset plates prepared from clip are removed, are fixed on electrophoretic apparatus On.The SDS-PAGE electrophoresis liquids (P0014A) of the green skies productions of 1X are added in electrophoresis tank, comb both sides are vertical uniform firmly It extracts.
Protein sample is directly loaded in SDS-PAGE glue well.
For the ease of observation electrophoretic effects and transferring film effect, egg is judged using pre-dyed protein molecular weight standard (P0066) White molecular size range.
The 1xSDS-PAGE electrophoresis liquids (P0014A) that outer groove is also produced using the green skies during electrophoresis.
In upper strata glue using low-voltage constant pressure electrophoresis during electrophoresis, and in SDS-PAGE albumen sample-loading buffer (the green skies Using high voltage constant pressure electricity when the bromophenol blue contained in SDS-PAGE albumen sample-loading buffer (5X, P0015) enters lower floor's glue Swimming.For the standard electrophoretic apparatus of Bio-Rad, low-voltage can be arranged on 80V, and high voltage can be arranged on 120V.
Bromophenol blue reaches during electrophoresis can stop electrophoresis near the bottom end of glue.
3) transferring film
Select green skies production pvdf membrane (FFP36/FFP39).
The pvdf membrane cut is put into proper amount of methanol and impregnates activation, cuts concentration glue, by soaked pvdf membrane and Separation gel is put into jointly in the sandwich structure of transferring film folder (filter paper-pvdf membrane-gel-filter paper), and transferring film is pressed from both sides and is inserted into transferring film slot In, add in 1 × Tris- glycine transferring films liquid (health be century, CW0044), constant 300 milliamperes of electric current transferring films about 90min.
Note：Pvdf membrane is in positive pole, and in power cathode, preventing from putting back albumen can not be transferred on film gel.In transferring film Very serious fever phenomenon is had in the process, therefore transferring film slot is placed in ice bath and carries out transferring film.
4) it closes
After transferring film, immediately protein film be placed into preprepared Western cleaning solutions (the green skies, P0023C it in), rinses 2 minutes, to wash away the transferring film liquid on film.The all steps after the transferring film are certain it is noted that film Moisturizing avoids the drying of film, otherwise easily generates higher background.Cleaning solution is exhausted with dropper etc., adds in Western closings Liquid (the green skies, P0023B), slowly shakes on shaking table, room temperature closing 1-2h.
5) primary antibody is incubated
With reference to the specification of primary antibody, diluted according to proper proportion Western primary antibodies dilution (the green skies, P0023A) Primary antibody.EGFR antibody (Ab-1, Oncogene Science, 1: 1000), TRIM24 antibody (#14208-1-AP, Proteintech Group, 1: 1000) and β-actin (I19, Santa Cruz Biotechnology, 1: 2000).With drop Pipe exhausts confining liquid, adds in the primary antibody diluted immediately, and 4 DEG C are slowly shaken overnight incubation on the side shaker.Recycle primary antibody. Western cleaning solutions (the green skies, P0023C) are added in, slowly shake washing 10 minutes on the side shaker.Exhaust cleaning solution Afterwards, cleaning solution is added to wash 10 minutes.It washs 3 times altogether.If result background is higher can be appropriately extended wash time and increase Add washing times.
6) secondary antibody is incubated
With reference to two anti-green skies horseradish peroxidase-labeled goat anti-mouse IgG (H+L (A0216), goat antirabbits The specification of IgG (H+L) (A0217) dilutes horseradish according to 1: 1000 ratio Western secondary antibody diluents (P0023D) The secondary antibody of peroxidase (HRP) label.Cleaning solution is exhausted with dropper, adds in the secondary antibody diluted immediately, room temperature is shaken in side-sway It slowly shakes and is incubated one hour on bed.Recycle secondary antibody.Western cleaning solutions (P0023C) are added in, are slowly shaken on the side shaker Dynamic washing 10 minutes.After exhausting cleaning solution, add cleaning solution and wash 10 minutes.It washs 3 times altogether.If result background is higher Wash time can be appropriately extended and increase washing times.
7) Protein Detection
With reference to instructions book, albumen is detected using BeyoECL Plus (P0018) ECL reagents.Using X mating plates certainly Dynamic developing machine is developed a film.
As a result as shown in Figure 3a, compared with compareing slow virus plasmid shC, shTRIM24 can significantly reduce LN229 and It is successful and effective to show that we build cell line for the expression of TRIM24 in U87 cells.ShTRIM24 stimulations do not influence The expression of EGFR in LN229 and U87 cells, β-actin.This illustrates that TRIM24 is located at the downstream of EGFR accesses.
(2) TRIM24 in LN229 and U87 is reduced, the cell increasing of LN229 and U87 that EGFRvIII is stimulated can be inhibited It grows.
It is thin that LN229 and U87, cancer are detected to specifications using WST-1 kits (purchased from Roche, 05015944001) The in-vitro multiplication ability of born of the same parents' strain.As a result EGFRvIII stimulations can significantly improve the cell increasing of LN229 and U87 as shown in Figure 3b Grow ability.After the TRIM24 expression in LN229 and U87 is reduced using shT24, EGFRvIII can not stimulate LN229 and U87 again Cell Proliferation.
(3) reduce LN229 and U87 in TRIM24, can inhibit EGFRvIII stimulation generate LN229 and U87 it is soft Agar Clone formation.
1) take the logarithm growth period cell, digested with 0.25% pancreatin and gently blow and beat, make unicellular, make it is living carefully Born of the same parents count, and cell density is adjusted to 1 × 10 with the DMEM culture mediums containing 20% fetal calf serum6Cell/L.
2) agar solution (BD, 214220) of 1.2% and 0.7% two concentration, high pressure sterilization are prepared respectively with distilled water Afterwards, maintaining in 40 DEG C will not solidify.
3) 1.2% agar solution and 2 × DMEM culture mediums is made (to contain 2 × antibiotic and 20% tire ox in 1: 1 ratio Serum) mixing after, take 3mL mixed liquors injection diameter 6cm plates in, cooled and solidified can put CO as bottom-layer agar2It is standby in incubator With.
4) 0.7% agar solution is allowed and after 2 × DMEM culture mediums mutually mix in sterile test tube in 1: 1 ratio, then to pipe (cell number is 5 × 10 to middle addition 0.2mL4/ ml) cell suspension, abundant mixing, injection be covered with 1.2% agar bottom plate In, form double agar layers.After top-layer agar solidification, it is placed in 37 DEG C of 5%CO2It is cultivated 10 days in incubator.
5) plate is placed under inverted microscope, observes number of cell clones.Calculate formation rate.Use Olympus SZX12 stereoscopes scored to clone's number after 2-3 weeks, and used GraphPad software analysis datas.
As a result as shown in Figure 3c, exogenous overexpression EGFRvlII can dramatically increase the cell clonal formation of cell strain Rate.And after reducing TRIM24 expression on the basis of exogenous overexpression EGFRvlII, EGFRvIII can not be further added by cell strain Cell colonies assay.
(4) TRIM24 in LN229 and U87 is reduced, LN229's and U87 moves caused by EGFRvIII can be inhibited to stimulate It moves.Cell migration assay is carried out using the transwell cells of corning.Various cell serums are 24 hours hungry, use PBS Wash and be resuspended in plus 0.1%FBS DMEM in.Then, cell is placed in the overhead compartment of cell, and floor chamber is added Enter the DMEM of 10%FBS.Cell is made to be migrated 10 or 16 hours by the film in 8 μm of apertures at 37 DEG C.Then, film is fixed, tied Crystalviolet dyes, selected at random up and down using center as starting point with 10 times or 20 times object lens of inverted microscope 8 points take pictures and minute Analysis.As shown in Figure 3d, the migration of Transwell cells is it is experimentally confirmed that EGFRvIII being capable of significantly induction gum knurl U87 and LN229 Cell Proliferation local transfer, and knock out cell caused by TRIM24 can significantly weaken EGFRvlII and shift.
(5) the exogenous U87 cells (U87/vIII) for being overexpressed EGFRvIII can be formed independent of EGF ligands Type activates EGFR, such cell is transplanted to nude mice intracerebral can be with induced tumor.TRIM24 in U87/vIII is reduced to express (U87/vIII/shT24#1, U87/vIII/shT24#2) can inhibit U87/vIII in the one-tenth knurl ability of nude mice intracerebral.
5.1 nude mice intracerebrals are tested into knurl：
Every group of 6 nude mices are anaesthetized through 1% yellow Jackets, are fixed on stereotaxic apparatus, sterilize skin, overhead Median incision, exposure bregma found bitmap by mouse brain and compose, the 1.5mm after bregma, and on the right side of center line at 0.8mm, Hamilton is micro- Syringe (701-N) is measured from the vertical inserting needle 2.8mm in brain surface, 5 μ l cells (totally 5 × 10 are slowly injected into unilateral brain parenchym5Carefully Born of the same parents are resuspended in DPBS), injection time 5min, let the acupuncture needle remain at a certain point 2min, the slow withdraw of the needle.All operations aseptically carry out, It sews up a wound.Nude mice is put back into the raising of SPF laminar-flow racks, observes and records nude mice life cycle.
5.2 nude mice brains materials, OCT embeddings, frozen section：
After 2-5 weeks, treat that nude mice build occurs and significantly becomes thin, back height is bent when brain tumors sign, uses CO2It anaesthetizes naked Mouse.Disconnected neck rapidly.Overhead skin is cut off, skull and pia mater is removed, exposes entire mouse brain.Lightly mouse brain is removed, After cutting off olfactory bulb and cerebellum, OCT (Sakura, 14-373-65) is embedded in, is immediately placed in -80 DEG C of refrigerators.Next day, by embedded block It is sliced through freezing microtome, thickness is 7 microns.Slice is positioned over -80 DEG C of refrigerators and preserves.
5.3 frozen section HE are dyed：
Slice is taken out from -80 DEG C of refrigerators, equilibrium at room temperature to water droplet is dried, the HE staining reagents produced using the green skies Box stained slice.
As a result as shown in Figure 3 e, transfected in the parental cell that U87/P/shC representatives are expressed in no exogenous EGF RvlII The control plasmid shC of shTRIM24.In the U87/vIII cells that U87/vIII/shC representatives are overexpressed in exogenous EGFRvlII Transfect the control plasmid shC of shT24.U87/vIII/shT24 representatives are thin in the U87/vIII that exogenous EGFRvIII is overexpressed ShT24 is transfected in born of the same parents.U87 parent controls cell (U87/P/shC) forms tumour (the black surround institute in figure of very little in nude mice intracerebral Show), after being overexpressed EGFRvIII and transfecting shT24 controls shC, U87/vIII/shC can be in the apparent induced tumor of nude mice intracerebral (in figure shown in black surround), and reduce the expression of the TRIM24 in U87/vIII (U87/vIII/shT24#1, U87/vIII/shT24# 2) after, U87/vIII/shT24 can hardly be in nude mice intracerebral induced tumor (in figure shown in black surround).
(6) using Graphpad prism5.0 softwares, by the more each index of one-way analysis of variance in U87/ The significant difference of vIII/shT24#1, U87/vIII/shT24#2 and U87/vIII/shC and control group U87/P/shC, knot Fruit is as illustrated in figure 3f：The size of U87/vII/shC group nude mice intracerebrals into knurl is more notable than U87 parent controls cell (U87/P/shC) Increase.And the TRIM24 expression (U87/vIII/shT24#1, U87/vIII/shT24#2) of U87/vIII is reduced, U87/vIII It can not be in nude mice intracerebral into knurl.
Embodiment 4：TRIM24 adjusts proliferation channel associated signaling expression mediation EGFR drivings tumour and is formed
(1) mRNA-seq analyses find that TRIM24 regulates and controls a part of oncogene expression mediation EGFR and promotees glioma growth Effect.It will need to maintain the improvement DMEM bases for being supplemented with 10% fetal calf serum in the cell inoculation to 10cm culture dishes analyzed Basal culture medium, all cell lines are in 37 DEG C and 5%CO2Lower culture.LN229/P/shC is represented in no exogenous EGF RvIII tables The control plasmid shC (virus particle, lucky triumphant gene, CONO77) of shT24 is transfected in the parental cell LN229 reached.LN229/ The control plasmid shC of shT24 is transfected in the LN229/vIII cells that vIII/shC representatives are overexpressed in exogenous EGFRvIII (virus particle, lucky triumphant gene, CONO77).LN229/vIII/shT24 representatives are overexpressed in exogenous EGFRvIII ShT24 is transfected in LN229/vIII cells, and (shT24-1 virus particles, lucky triumphant gene, 22927, shT24-2 virus particles are lucky Triumphant gene, 22930), transfection method has used two shT24 plasmid transfections in order to preferably with embodiment 3 in this experiment Verify that TRIM24 expression reduces the influence to follow-up signal access.Use Qiagen RNeasy Mini kits (Valencia, CA, USA) extracts and purifies according to the manufacturer's instructions total serum IgE.It is assessed before sequencing by biological analyser The quality of RNA.Poly- (A)+RNA libraries are prepared according to the scheme of Illumina.Library is on ten platforms of Illumina HiSeqX It is sequenced.The standard that difference expression gene detects in this research is wrong discovery rate (FDR) ＜ 0.05, multiple variation ＞ 1.5 Times.Gene phenotype is integrated with Cluster 3.0, and is checked using Java Tree View 3.0.As a result such as Fig. 4 a institutes Show, TRIM24 adjusts 35 gene expressions, these genes contain the proliferation-associated genes such as ID1, ID3, FGFR, these genes EGFR has been mediated to promote glioma occurrence and development jointly.
(2) gene ontology (GO) annotation analysis TRIM24 adjusts the function of gene.Utilize GO databases (http：// Geneontology.org/ the life of Enrichment analysis function on-line analysis EGFR-TRIM24 institutes controlling gene) Object function, as shown in Figure 4 b, TRIM24 regulation and control gene and cell cycle regulating, metabolism etc. cell proliferation signals it is related.
(3) clinical related data analyzes the high expression in glioma of TRIM24 controlling genes.Next TRIM24 is analyzed Whether the gene regulated and controled is closely related with clinical glioma occurrence and development.Pass through GEO databases (https：// Www.ncbi.nlm.nih.gov/geo/) downloading data collection GSE4290 (Expression data of glioma samples From Henry Ford Hospital), analyze TRIM24 institutes controlling gene table in glioma pathological tissue and normal cerebral tissue Up to situation, heatmap results as illustrated in fig. 4 c, in glioma express bright by the gene that the overwhelming majority (22/35) TRIM24 regulates and controls Aobvious up-regulation, TRIM24 pathway associated proteins others can mutually distinguish healthy volunteer and glioma.
Embodiment 5：TRIM24 and p-EGFRY is co-expressed in clinical glioma sample1172Patient survival significantly contract It is short
A kind of reagent for diagnosing the life cycle of the grade malignancy of glioma or prediction Response in Patients with Gliomas Box, comprising for detecting the reagent of the expression of EGFR albumen and TRIM24 albumen, it is described for detect EGFR and The reagent of the expression of TRIM24 is p-EGFRY1172Antibody (Rabbit polyclonal to p-EGFRY1172, Signalway Antibody) and TRIM24 antibody (Rabbit polyclonal to TRIM24, proteintech Group, 14208-1-AP).
(1) the clinical glioma sample slice row immunohistochemical staining of 132 II-IV grades of WHO is collected：
The 1.1 glioma tumor samples for collecting 132 people (including 31 II grades of WHO, 23 WHOIII grades, 78 WHOIV grades of glioma tumors) and 7 normal cerebral tissues without apparent pathology damage and medical history.Conventional method is made paraffin and cuts Piece.
Tissue paraffin embeds and slicing step：
1) it draws materials：The patients with gliomas that pathological tissue Lai Renji hospitals confirm, the equal signed informed consent form of patient
2) it is fixed：The pathological tissue taken off is put into fixer (10% formalin or more than 4% at once Polyformaldehyde) it fixes overnight, the purpose being fixed is to prevent tissue itself structure of the destruction such as metabolism tissue in itself occurs.
3) it washs：Fully fixed tissue is gently taken out, is put into embedding capsule, then places into beaker, use is small The tap water of flow rinses a hour, and fixer is rinsed well.
4) it is dehydrated：Because large quantity of moisture is contained in tissue the inside, water be not desired to paraffin it is miscible, so to slough tissue In moisture could carry out paraffin and fix.Alcohol is common dehydrating agent.Tissue after washing completion is put into 70% alcohol The inside is dehydrated overnight.Sample from 70% sample is taken out, passes sequentially through 80%, 90%, 95%, 100% alcohol is taken off Water, 80%, 90%, 95% alcohol are respectively dehydrated 30min, 100% dehydration of alcohol 1h.Sample cannot be in successive concentrations excessively Dehydration or permanent holding, successive concentrations can cause tissue to be hardened.
5) it is transparent：By dehydration, the moisture in sample is replaced by alcohol, but alcohol is still not with paraffin It is miscible, thus next using can not only be dissolved in alcohol but also can be dissolved in paraffin dimethylbenzene carry out it is transparent.It will be dewatered Tissue impregnates dimethylbenzene, dimethylbenzene substitution alcohol is made to enter tissue referred to as transparent.First had to the molten of dimethylbenzene and alcohol 1: 1 Liquid 30 minutes, then to transparent, completion clearing process in pure dimethylbenzene is put into.It is transparent not thorough if clearing time is too short Bottom, paraffin are difficult to immerse tissue；Clearing time is long, then the hardening of tissue becomes fragile, and is just not easy to cut out whole slices.If tissue There is transparent and nigrescence phenomenon, illustrate transparent success, if white occurs in tissue, illustrate that dehydration is incomplete, need to take off again Water).
6) waxdip：Transparent complete tissue can then carry out waxdip operation, paraffin is allowed to enter organization internal, play support Fixed function, conducive to histotomy.It is respectively put into paraffin I, II, III processing of melting.
7) it embeds：The tissue that waxdip is completed is taken and is embedded at embedding machine, melting is added in inside the mold of preheating Clean paraffin, then the tissue of preheating is quickly transferred to go inside mold, with embedding box cover on mold, and mould Tool gently detains wax stone after being placed on cooled on ice 15 minutes.
8) it is sliced：The wax stone thoroughly solidified is sliced, makes section preparation.Wax stone is put into paraffin slicing machine (LEICA, RM2235) buckle the inside, adjusts cutter head position, places wax stone, be then sliced by slicer working specification, will be complete And more smooth tissue is gently chosen in hot water, is gently picked up open and flat good slice 45° angle with glass slide, will carry glass Piece shakes obliquely removes extra water, and slice is made firmly to be attached on glass slide, then spare after 37 DEG C of baking oven drying.
It is as follows that 1.2 pairs of paraffin sections carry out immunohistochemical staining (two step method)：
Reagent：Phosphate buffered saline (PBS), distilled water, graded ethanol, dimethylbenzene, the lemon of 0.01M (pH7.4) Lemon acid antigen retrieval buffer solution (steps new, MVS-0100)；Concentrated type DAB kits (Dako, K340811), neutral gum, p- EGFRY1172Antibody (Rabbit polyclonal to p-EGFRY1172, Signalway Antibody), TRIM24 antibody (Rabbit polyclonal to TRIM24, proteintech group), negative control (PBS for being free of primary antibody), anti-rabbit Abiotic element two step method immunohistochemistry detection reagent (Bioisystech Co., Ltd of PV-6001, Zhong Shan Golden Bridge).
Instrument：Slide holding frame；It is incubated box；Oven；Pipettor；Small glass decorating cylinder；Water-bath
Specific steps：
1) paraffin section is placed in 60 DEG C of baking ovens, dries piece 30 minutes.
2) pure dimethylbenzene dewaxing：I, each 20 minutes of II.
3) graded ethanol dewaxes：100% alcohol I, 100% alcohol II, 95% alcohol, 90% alcohol, 80% alcohol each 5 Minute, distilled water is washed 5 minutes × 2 times.
4) antigen hot repair is answered：Slice is put into and fills the container that citric acid antigen repairs buffer solution (stepping new, MVS-0100) In, it puts in micro-wave oven and heats, fluid temperature in container is made to be maintained at 98 DEG C or so, and continue 15 minutes.Take out container, room temperature Cooling 30 minutes (slice from buffer solution can not be taken out and cooled down, so that albumen is enable to restore original steric configuration). PBS is washed 5 minutes × 3 times.
5) liquid around tissue is blotted with filter paper, every slice plus 1 drop endogenous peroxydase block reagent (the abiotic plain two step method immunohistochemistry detection reagent 1 of anti-rabbit, Zhong Shan Golden Bridge Bioisystech Co., Ltd PV-6001), is put into and incubates It educates in box, a small amount of distilled water is put in cassette bottom portion.Box is put into 37 DEG C of water baths and is incubated 15 minutes, to block endogenous peroxide The activity of compound enzyme.PBS is washed 5 minutes × 3 times.
6) liquid around tissue is blotted with filter paper, every slice plus 1 drop (30~50ul) (pEGFRY1172Antibody 1: 100, TRIM24 antibody 1: 200) diluted primary antibody, 37 DEG C are incubated 2 hours, and PBS is washed 5 minutes × 3 times.
7) be added dropwise 100 μ L enzyme mark goat anti-rabbit iggs polymer (the abiotic plain two step method immunohistochemistry detection reagent 2 of anti-rabbit, Zhong Shan Golden Bridge Bioisystech Co., Ltd PV-6001), it is incubated at room temperature 20 minutes；PBS buffer solution is rinsed 3 minutes × 3 times.
8) liquid around tissue is blotted with filter paper, the DAB liquid of every slice plus 1 drop Fresh is (to specifications 2.5 μ l B liquid are added in every 500 μ l A liquid), it develops the color 5 minutes, colour developing degree is grasped under microscope, brown spot is seen, is put into Color development stopping in distilled water.
9) haematoxylin is redyed 3 minutes, and tap water rinses 30 seconds, hydrochloride alcohol (hydrochloric acid: the volume ratio of alcohol is 1: 100) break up 5 seconds, tap water rinses 15 minutes.
10) gradient alcohol dehydration：80% alcohol, 90% alcohol, 95% alcohol, 100% alcohol I, 100% alcohol II each 5 Minute.
11) dimethylbenzene is transparent：I, each 10 minutes of II.
12) neutral gum mounting.
12) it is put into 60 DEG C of baking ovens and dries, micro- Microscopic observation, TRIM24 antibody and p-EGFRY1172Antibody stained positive Glioma sample as shown in Figure 5 a.
(2) Kaplan- is carried out to the scoring of immunohistochemical staining and patient survival using Graphpad Prism5.0 Meier survival are analyzed.Percentage according to shared by signaling molecule positive cell scores to sample：, all tumour cells It all can't detect signal, 0%；±, low expression or no signal, 1% positive cells of ＜；1+ ,~5-25% positive cell；2+, ~25% positive cell；3+ ,~50% positive cell.Or the tumour of ± dyeing is considered as low expression tumour, and 1+ to 3 + tumour be high expression tumour.As a result as shown in Figure 5 b, while height expresses TRIM24, p-EGFRY1172(dotted line expression) faces The life cycle of bed patients with gliomas significantly shortens.The present invention is research shows that the EGFR (p-EGFR for expressing activated form high simultaneouslyY1172) With the glioma of TRIM24, WHO pathological grading ranks higher (grade malignancy is higher), patient survival significantly shorten.
<110>Renji Hospital Attached to Medical College of Shanghai Jiaotong Univ.
<120>Applications of the TRIM24 in diagnosis of glioma
<160>4
<210> 1
<211> 22
<212> DNA
<213>The mankind (Homo sapiens)
<400> 1
TGTGAAGGACACTACTGAGGTT 22
<210> 2
<211> 22
<212> DNA
<213>The mankind (Homo sapiens)
<400>2
GCTCTGATACACGTCTTGCAG 22
<210> 3
<211>21
<212> DNA
<213>The mankind (Homo sapiens)
<400> 3
CATGTACGTTGCTATCCAGGC 21
<210> 4
<211> 21
<212> DNA
<213>The mankind (Homo sapiens)
<400> 4
CTCCTTAATGTCACGCACGAT 21

Claims (7)

1. a kind of kit for diagnosing the life cycle of the grade malignancy of glioma or prediction Response in Patients with Gliomas, Be characterized in that, comprising for detect TRIM24 genes and/or albumen or EGFR gene and/or albumen and TRIM24 genes and/ Or the reagent of albumen, TRIM24 genes and/or albumen and the expression of EGFRVIII genes and/or albumen.
2. kit as described in claim 1, which is characterized in that the reagent for being used to detect the expression of TRIM24 Antibody for TRIM24；Described is p-EGFR for detecting the reagent of the expression of EGFR and TRIM24Y1172Antibody and The antibody of TRIM24.
3. for detect TRIM24 genes and/or albumen or EGFR gene and/or albumen and TRIM24 genes and/or albumen, The reagent of TRIM24 genes and/or albumen and the expression of EGFRVIII genes and/or albumen is preparing glioma Grade malignancy diagnostic reagent or Response in Patients with Gliomas life cycle prediction reagent in application.
4. application as claimed in claim 4, which is characterized in that the described reagent of expression for detecting TRIM24 is The antibody of TRIM24；Described is p-EGFR for detecting the reagent of the expression of EGFR and TRIM24Y1172Antibody and The antibody of TRIM24.
5. can inhibit TRIM24 genes and/or albumen or TRIM24 genes and/or albumen and EGFR gene and/or albumen, Or the reagent of the expression of TRIM24 genes and/or albumen and EGFRVIII genes and/or albumen is preparing glioma Application in medicine.
6. application as claimed in claim 5, which is characterized in that the EGFR is p-EGFRY1172。
7. a kind of glioma diagnostic kit, which is characterized in that comprising for detect TRIM24 genes and/or albumen or EGFR gene and/or albumen and TRIM24 genes and/or albumen, TRIM24 genes and/or albumen and EGFRVIII genes And/or the reagent of the expression of albumen.
CN201711031231.9A 2017-10-27 2017-10-27 Application of TRIM24 in glioma diagnosis Active CN108203732B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201711031231.9A CN108203732B (en) 2017-10-27 2017-10-27 Application of TRIM24 in glioma diagnosis

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201711031231.9A CN108203732B (en) 2017-10-27 2017-10-27 Application of TRIM24 in glioma diagnosis

Publications (2)

Publication Number Publication Date
CN108203732A true CN108203732A (en) 2018-06-26
CN108203732B CN108203732B (en) 2021-07-27

Family

ID=62603695

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201711031231.9A Active CN108203732B (en) 2017-10-27 2017-10-27 Application of TRIM24 in glioma diagnosis

Country Status (1)

Country Link
CN (1) CN108203732B (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108441488A (en) * 2018-03-29 2018-08-24 上海交通大学 A kind of deubiquitinating enzymes for stablizing BMI1 in glioma
CN109593860A (en) * 2019-02-12 2019-04-09 山东大学齐鲁医院 Application of the TMSB10 in diagnosis and treatment glioma
CN112662775A (en) * 2021-01-18 2021-04-16 中国医科大学附属第一医院 Glioma marker SPC25 and application thereof
US20220091136A1 (en) * 2020-09-16 2022-03-24 Ajou University Industry-Academic Cooperation Foundation Early detection marker for degenerative osteoarthritis with trim24-rip3 axis

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012031008A2 (en) * 2010-08-31 2012-03-08 The General Hospital Corporation Cancer-related biological materials in microvesicles
US20120082659A1 (en) * 2007-10-02 2012-04-05 Hartmut Land Methods And Compositions Related To Synergistic Responses To Oncogenic Mutations
WO2016133449A1 (en) * 2015-02-16 2016-08-25 Xintela Ab Detection and treatment of malignant tumours in the cns
CN107188969A (en) * 2011-04-08 2017-09-22 美国卫生和人力服务部 Anti-epidermal growth factor receptor variant III Chimeric antigen receptors and its purposes for treating cancer

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120082659A1 (en) * 2007-10-02 2012-04-05 Hartmut Land Methods And Compositions Related To Synergistic Responses To Oncogenic Mutations
WO2012031008A2 (en) * 2010-08-31 2012-03-08 The General Hospital Corporation Cancer-related biological materials in microvesicles
CN107188969A (en) * 2011-04-08 2017-09-22 美国卫生和人力服务部 Anti-epidermal growth factor receptor variant III Chimeric antigen receptors and its purposes for treating cancer
WO2016133449A1 (en) * 2015-02-16 2016-08-25 Xintela Ab Detection and treatment of malignant tumours in the cns

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
EMILY PADFIELD等: "Current Therapeutic Advances Targeting EGFR and EGFRvIII in Glioblastoma", 《FRONT ONCOL.》 *
JOHANNES C VAN DER MIJN等: "Evaluation of different phospho-tyrosine antibodies for label-free phosphoproteomics", 《J PROTEOMICS》 *
L-H ZHANG等: "TRIM24 promotes glioma progression and enhances chemoresistance through activation of the PI3K/Akt signaling pathway", 《ONCOGENE》 *
LI MA等: "Histone H3 lysine 23 acetylation is associated with oncogene TRI TRIM24 expression and a poor prognosis in breast cancer", 《TUMOR BIOL.》 *
MASAHIRO MIZOGUCHI等: "Activation of STAT3, MAPK, and AKT in Malignant Astrocytic Gliomas: Correlation With EGFR Status, Tumor Grade, and Survival", 《J NEUROPATHOL EXP NEUROL》 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108441488A (en) * 2018-03-29 2018-08-24 上海交通大学 A kind of deubiquitinating enzymes for stablizing BMI1 in glioma
CN109593860A (en) * 2019-02-12 2019-04-09 山东大学齐鲁医院 Application of the TMSB10 in diagnosis and treatment glioma
US20220091136A1 (en) * 2020-09-16 2022-03-24 Ajou University Industry-Academic Cooperation Foundation Early detection marker for degenerative osteoarthritis with trim24-rip3 axis
CN112662775A (en) * 2021-01-18 2021-04-16 中国医科大学附属第一医院 Glioma marker SPC25 and application thereof

Also Published As

Publication number Publication date
CN108203732B (en) 2021-07-27

Similar Documents

Publication Publication Date Title
CN108203732A (en) Applications of the TRIM24 in diagnosis of glioma
EP2910948B1 (en) Novel cancer marker and utilization thereof
CN111929447B (en) PD-L1 immunohistochemical reference product and preparation method and application thereof
Jixiang et al. YEATS4 promotes the tumorigenesis of pancreatic cancer by activating beta-catenin/TCF signaling
EP3127918A1 (en) Ehd2 antibody and application thereof in preparation of immunohistochemical detection reagent for breast cancer
CN107607727B (en) Application of the H3K23ac in diagnosis of glioma
CN113755594B (en) System and application for predicting benefit of auxiliary chemotherapy of small cell lung cancer and identifying chemotherapy drug resistance treatment target point
CN112980948B (en) Application of NFAT3 as therapeutic target in screening or preparing head and neck squamous cell carcinoma drugs
CN107779503A (en) The related difference expression gene of Alzheimer and its application
CN105483246A (en) Application of differential expression of gene in oral cancer diagnosis
CN105233290B (en) The application of C22orf26 genes and its expression product in Parkinson&#39;s diagnosis and treatment reagent is prepared
CN109402253A (en) Application of the ALDH18A1 in the treatment and diagnosis of colorectal cancer
CN108465108A (en) A kind of specific gene target spot prevented or treat glioma
CN112662775A (en) Glioma marker SPC25 and application thereof
CN106834288A (en) A kind of long non-coding RNA and its application in diagnosis/treatment stomach cancer
CN107881240B (en) The diagnosis and treatment marker of osteosarcoma
CN112656805A (en) Application of substance for inhibiting YTHDF1 activity in preparation of product for preventing or treating gastric cancer
CN109295101A (en) It is overexpressed miR-125a-5p lentiviral vector construction method and its application
CN115094134B (en) Application of PCSK9 in macrophage M2 type polarization and related diseases thereof
CN108918874A (en) The MiR-210 experimental method that related target is predicted in glioma
CN114908172B (en) Application of APOBEC3B in diagnosis, prognosis prediction and treatment of prostate cancer
CN104083775B (en) Phosphorylation DCBLD2y750application in diagnosis and treatment glioma
CN107022627A (en) The siRNA of application and the suppression KPNA2 gene expressions of KPNA2 genes application
CN108114283A (en) Applications of the biomarker MUC21 in osteosarcoma diagnose and treat
CN113101368B (en) Application of SLC7A8 in auxiliary diagnosis, precancerous early warning and targeted therapy of esophageal squamous cell carcinoma

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant