CN109439653A - A kind of lysate and method of fungal nucleic acid rapidly extracting - Google Patents
A kind of lysate and method of fungal nucleic acid rapidly extracting Download PDFInfo
- Publication number
- CN109439653A CN109439653A CN201811436311.7A CN201811436311A CN109439653A CN 109439653 A CN109439653 A CN 109439653A CN 201811436311 A CN201811436311 A CN 201811436311A CN 109439653 A CN109439653 A CN 109439653A
- Authority
- CN
- China
- Prior art keywords
- lysate
- nucleic acid
- chelex
- fungal nucleic
- precipitating
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
- C12N15/1006—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor by means of a solid support carrier, e.g. particles, polymers
- C12N15/1013—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor by means of a solid support carrier, e.g. particles, polymers by using magnetic beads
Landscapes
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Crystallography & Structural Chemistry (AREA)
- Plant Pathology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Analytical Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides the lysate and method of a kind of fungal nucleic acid rapidly extracting, lysate includes 0.2 μM~1 μM of oligonucleotide fragment, dNTP, 5%~20% 10 × PCR buffer, 0.5%~5% chelex-100 and the deionized water of 0.2mM~1mM, extracting method includes sampling this in centrifuge tube, carry out centrifugally operated, supernatant is abandoned, precipitating is stayed；Lysate is added into gained precipitating, and shakes mixing, the volume ratio of lysate and precipitating is 100:1~300:1；In 80-100 DEG C of 10~20min of heating；Centrifugally operated takes supernatant.The lysate and method of the fungal nucleic acid rapidly extracting are by system in conjunction with chelex-100, substantially increase lysis efficiency, compared to traditional chelex-100 method, extraction step is easier, extraction efficiency is higher, expanding effect is more preferable, and is not related to any organic solvent during nucleic acid extraction, small to operator's physical impairment.
Description
Technical field
The invention belongs to technical field of molecular biology, a kind of lysate more particularly, to fungal nucleic acid rapidly extracting and
Method.
Background technique
With the raising that sensitivity and specificity of the people to clinical diagnosis require, nucleic acid extraction is the base of molecular biology
The continuous development of this method, round pcr provides a kind of quick, sensitive, accurate detection method for clinical diagnosis, examines for clinic
Disconnected disease provides foundation, and can instruct clinical application.Meanwhile round pcr is also widely used in judicial and agriculture forest and husbandry, hair
It transforms into as a basic technology.And nucleic acid extraction is the premise of PCR, is the final steps of detection of nucleic acids.
Method for extracting nucleic acid is broadly divided into phenol chloroform method, CTAB method, column formulation, paramagnetic particle method and chelex-100 at present
Method.The extraction having in these methods has limitation, can only extract Plasmid DNA, and it is more to have plenty of chemical reagent, has one to human body
Determine harmful effect, it is preferable to have plenty of extraction effect, but operates too cumbersome.Compared to other methods, chelex-100 method is more
It is easy to operate, it is suitable for a variety of sample types, and sample is required lower.But most chelex-100 method in the prior art
Extraction step is cumbersome in extraction process, and time-consuming, and sample amplification effect is bad after extraction, and the chelex-100 method having was extracted
Need to be added Triton-100 in journey, the organic solvents such as NP-40 are big to operator's physical impairment.
Summary of the invention
The problem to be solved in the present invention is to provide the lysate and method of a kind of fungal nucleic acid rapidly extracting, operating procedure letters
Single, time-consuming short, sample amplification effect is good after extraction, and organic solvent is not used in extraction process.
In order to solve the above technical problems, the technical solution adopted by the present invention is that: a kind of cracking of fungal nucleic acid rapidly extracting
Liquid, including 0.2 μM~1 μM of oligonucleotide fragment, the dNTP of 0.2mM~1mM, 5%~20% 10 × PCR buffer,
0.5%~5% chelex-100 and deionized water.
In technical solution, it is preferred that the concentration of oligonucleotide fragment is 0.4 μM~0.8 μM.
In technical solution, it is preferred that the concentration of dNTP is 0.3mM~0.6mM.
In technical solution, it is preferred that 10 × PCR buffer concentration is 10%~15%.
In technical solution, it is preferred that the concentration of chelex-100 is 1%~2.5%.
Primer, dNTP is added, in 10 × PCR buffer in system by the lysate in conjunction with chelex-100, in lysate
Similar to amplification reaction system, containing the active component that can activate activation Taq enzyme, amplified reaction sensitivity is more reinforced,
Its solution ph meta-alkalescence of the reaction system component being wherein added further improves lysis efficiency, reduces nucleic acid extraction step
Suddenly, higher compared to traditional chelex-100 method extraction efficiency, expanding effect is more preferable, and does not add and any have in the lysate
Solvent, to operator's physical impairment very little.The lysate can effectively crack Aspergillus, Candida albicans, cryptococcus etc., can locate
Manage bronchoalveolar lavage fluid, whole blood, cerebrospinal fluid equal samples.
It is a further object of the present invention to provide a kind of fungal nucleic acid rapid extracting methods, comprising:
The first step, sampling originally in centrifuge tube, carry out centrifugally operated, abandon supernatant, stay precipitating；
Second step is added above-mentioned lysate into precipitating obtained by the first step, and shakes mixing, the lysate with it is described
The volume ratio of precipitating is 100:1~300:1；
Third step, in 80-100 DEG C of 10~20min of heating；
4th step, centrifugally operated, take supernatant.
The fungal nucleic acid rapid extracting method operating procedure is simple, and nucleic acid extraction is high-efficient, and expanding effect is good, in operation not
It is related to any organic solvent, it is small to operator's physical impairment.
In technical solution, it is preferred that centrifugal rotational speed is 10000rpm~14000rpm in the first step.
In technical solution, it is preferred that centrifugation time is 2~10min in the first step.
In technical solution, it is preferred that centrifugal rotational speed is 10000rpm~14000rpm in the 4th step.
In technical solution, it is preferred that centrifugation time is 2~10min in the 4th step.
In technical solution, it is preferred that sample is bronchoalveolar lavage fluid, cerebrospinal fluid or whole blood.
The advantages and positive effects of the present invention are: the fungal nucleic acid rapidly extracting lysate and method by system with
Chelex-100 is combined, and lysis efficiency is substantially increased, and compared to traditional chelex-100 method, extraction step is simpler
Just, extraction efficiency is higher, and expanding effect is more preferable, and is not related to any organic solvent during nucleic acid extraction, to operator's body
It damages small.
Detailed description of the invention
Fig. 1 is using the expanding effect figure that cleavage method extracts nucleic acid and carries out amplification reaction in five embodiments.
In figure:
1 amplification curve for extracting nucleic acid for cleavage method in comparative example one and carrying out amplification reaction.
2 amplification curves for extracting nucleic acid for cleavage method in comparative example two and carrying out amplification reaction.
3 amplification curves for extracting nucleic acid for cleavage method in comparative example three and carrying out amplification reaction.
4 amplification curves for extracting nucleic acid for cleavage method in embodiment one and carrying out amplification reaction.
5 amplification curves for extracting nucleic acid for cleavage method in embodiment two and carrying out amplification reaction.
6 amplification curves for extracting nucleic acid for cleavage method in embodiment three and carrying out amplification reaction.
Specific embodiment
A specific embodiment of the invention is described further below with reference to embodiment:
Comparative example one
This example is the comparative example of the present invention program, extracts nucleic acid using guanidine hydrochloride method paramagnetic particle method.
Lysate contains 50mM Tris-HCl (pH8.0), 6M guanidine hydrochloride, 1% (w/v) SDS, 10% (v/v) Triton
X-100。
Cleaning buffer solution W1 contains 10mM Tris-HCl (pH8.0), 30% ethyl alcohol.
Cleaning buffer solution W2 contains 10mM Tris-HCl (pH8.0), 80% ethyl alcohol.
Elution buffer is 10mM Tris-HCl (pH8.0) solution.
Steps are as follows for the nucleic acid extraction of bronchoalveolar lavage fluid sample:
1. sampling this 800uL, 800uL lysis buffer, 20uL magnetic bead and 5uL internal reference is added, is placed in 2mL centrifuge tube
Uniformly mixing, is placed at room temperature for 10min；
2. by supernatant is abandoned after above-mentioned cracking mixed liquor magnetic 1min；
3. 800uL cleaning buffer solution W2 is added, 1min is mixed, abandons supernatant after magnetic 1min；
4. 100uL elution buffer is added, 5min is mixed, takes the nucleic acid 20uL of elution that 30uL PCR is added after magnetic 1min
Reaction solution carries out amplification reaction.
PCR primer sequence are as follows:
Forward primer: 5 '-AAGCACGGCTTGTGTGTTGG-3 '
Reverse primer: 5 '-AGCCCCATACGCTCGAGGA-3 '
Nucleic acid amplification reaction condition is as follows:
95 DEG C initial denaturation 5 minutes,
95 DEG C 15 seconds → 62 DEG C of denaturation 30 seconds (acquisition fluorescence) → 40 circulations of annealing.
Comparative example two
This example is the comparative example of the present invention program, extracts nucleic acid using dissociative DNA extracts kit.
Steps are as follows for the nucleic acid extraction of bronchoalveolar lavage fluid sample:
1. cracking: taking 15mL centrifuge tube, be added 100uL Proteinase K (commercially available), sequentially add 500uL sample
With 800uL Lysis Buffer, maximum (top) speed vortex oscillation is placed in 55 DEG C of heating 10min after mixing, by centrifuge tube；
2. combining: 0.5mL isopropanol being added in Xiang Shangshu centrifuge tube, vortex oscillation stands 10min after mixing, then will be from
Heart pipe is placed in magnetic separator and clarifies up to solution, sucks supernatant with pipettor, and remove centrifuge tube.
3. washing:
(1) 3mL Washing Buffer, vortex oscillation 1min is added, magnetic bead is resuspended sufficiently, centrifuge tube is placed in magnetic
Property separator up to solution clarify, suck supernatant with pipettor, and remove centrifuge tube.
(2) 3mL75% ethyl alcohol is added, vortex oscillation 1min is resuspended magnetic bead sufficiently, centrifuge tube is placed in magnetic separator
It is clarified up to solution, sucks supernatant with pipettor, and remove centrifuge tube.
(3) 800uL75% ethyl alcohol is added, is transferred in the centrifuge tube of 1.5mL, vortex oscillation 1min, keeps magnetic bead sufficiently heavy
It is outstanding, and it is stored at room temperature 1min, centrifuge tube is placed in magnetic separator and is clarified up to solution, pipe lid is removed with pipettor and tube bottom is molten
Liquid.
4. dry: keeping centrifuge tube on magnetic separator, stand 10min at room temperature, remove centrifuge tube.
5. elution: Elution Buffer, the vortex oscillation 1min of 55 DEG C of 50uL preheatings is added, in 55 DEG C of heating 5min
Afterwards, by centrifuge tube be placed in magnetic separator up to solution clarify, use pipettor Aspirate supernatant to a new centrifuge tube as
Template is expanded.
PCR primer sequence are as follows:
Forward primer: 5 '-AAGCACGGCTTGTGTGTTGG-3 '
Reverse primer: 5 '-AGCCCCATACGCTCGAGGA-3 '
Nucleic acid amplification reaction condition is as follows:
95 DEG C initial denaturation 5 minutes,
95 DEG C 15 seconds → 62 DEG C of denaturation 30 seconds (acquisition fluorescence) → 40 circulations of annealing.
Comparative example three
This example is the comparative example of the present invention program, extracts nucleic acid using traditional chelex-100 method.
Traditional chelex-100 method: 5%chelex-100.
Steps are as follows for the nucleic acid extraction of bronchoalveolar lavage fluid sample:
1. taking out 500 μ L sample bronchoalveolar lavage fluids in a centrifuge tube, 12000rpm revolving speed is centrifuged 10min, careful to inhale
It discards supernatant.
2. taking liquid at once after lysate vortex oscillation is sufficiently mixed uniformly, the lysate of 100 μ L, whirlpool are added into precipitating
Whirlpool oscillation mixes cellular lysate liquid and precipitating.
3. heating 10min at 80 DEG C -100 DEG C.
Supernatant takes out 20uL as template after 4.10000rpm is centrifuged 2min.
PCR primer sequence are as follows:
Forward primer: 5 '-AAGCACGGCTTGTGTGTTGG-3 '
Reverse primer: 5 '-AGCCCCATACGCTCGAGGA-3 '
Nucleic acid amplification reaction condition is as follows:
95 DEG C initial denaturation 5 minutes,
95 DEG C 15 seconds → 62 DEG C of denaturation 30 seconds (acquisition fluorescence) → 40 circulations of annealing.
Embodiment one
The present embodiment uses the lysate and method of fungal nucleic acid rapidly extracting of the invention.
The lysate of fungal nucleic acid rapidly extracting includes: 0.6 μM of oligonucleotide fragment, 0.4mM dNTP, 12%10 × PCR
Buffer, 1.5%chelex-100 (commercially available) and sterile no enzyme deionized water, the sequence of oligonucleotide fragment are as follows:
CTGCGGAAGGATCAGTAGAGATAGCCCTACCTGATTTGAGGTCA；
Steps are as follows for the nucleic acid extraction of bronchoalveolar lavage fluid sample:
1. taking out 500 μ L sample bronchoalveolar lavage fluids in a centrifuge tube, 12000rpm revolving speed is centrifuged 10min, careful to inhale
It discards supernatant.
2. taking liquid at once after lysate vortex oscillation is sufficiently mixed uniformly, the lysate of 100 μ L, whirlpool are added into precipitating
Whirlpool oscillation mixes cellular lysate liquid and precipitating.
3. heating 10min at 80 DEG C -100 DEG C.
Supernatant takes out 20uL as template after 4.10000rpm is centrifuged 2min.
It carries out amplification reaction:
PCR primer sequence are as follows:
Forward primer: 5 '-AAGCACGGCTTGTGTGTTGG-3 '
Reverse primer: 5 '-AGCCCCATACGCTCGAGGA-3 '
Nucleic acid amplification reaction condition is as follows:
95 DEG C initial denaturation 5 minutes,
95 DEG C 15 seconds → 62 DEG C of denaturation 30 seconds (acquisition fluorescence) → 40 circulations of annealing.
Embodiment two
The present embodiment uses the lysate and method of fungal nucleic acid rapidly extracting of the invention.
The lysate of fungal nucleic acid rapidly extracting includes: 0.4 μM of oligonucleotide fragment, 0.3mM dNTP, 10%10 × PCR
Buffer, 1%chelex-100 (commercially available) and sterile no enzyme deionized water, the sequence of oligonucleotide fragment are as follows:
AATCGTAACAAGGTTTCCGTATGCTTAAGTTCAGCGGGT；
Steps are as follows for the nucleic acid extraction of bronchoalveolar lavage fluid sample:
1. taking out 500 μ L sample bronchoalveolar lavage fluids in a centrifuge tube, 12000rpm revolving speed is centrifuged 10min, careful to inhale
It discards supernatant.
2. taking liquid at once after lysate vortex oscillation is sufficiently mixed uniformly, the lysate of 200 μ L, whirlpool are added into precipitating
Whirlpool oscillation mixes cellular lysate liquid and precipitating.
3. heating 10min at 80 DEG C -100 DEG C.
Supernatant takes out 20uL as template after 4.10000rpm is centrifuged 2min.
PCR primer sequence are as follows:
Forward primer: 5 '-AAGCACGGCTTGTGTGTTGG-3 '
Reverse primer: 5 '-AGCCCCATACGCTCGAGGA-3 '
Nucleic acid amplification reaction condition is as follows:
95 DEG C initial denaturation 5 minutes,
95 DEG C 15 seconds → 62 DEG C of denaturation 30 seconds (acquisition fluorescence) → 40 circulations of annealing.
Embodiment three
The present embodiment uses the lysate and method of fungal nucleic acid rapidly extracting of the invention.
The lysate of fungal nucleic acid rapidly extracting includes: 0.8 μM of oligonucleotide fragment, 0.6mM dNTP, 15%10 × PCR
Buffer, 2.5%chelex-100 (commercially available) and sterile no enzyme deionized water, the sequence of oligonucleotide fragment are as follows:
AAGCACGGCTTGTGTGTTGGAGCCCCATACGCTCGAGGA；
Steps are as follows for the nucleic acid extraction of bronchoalveolar lavage fluid sample:
1. taking out 500 μ L sample bronchoalveolar lavage fluids in a centrifuge tube, 12000rpm revolving speed is centrifuged 10min, careful to inhale
It discards supernatant.
2. taking liquid at once after lysate vortex oscillation is sufficiently mixed uniformly, the lysate of 300 μ L, whirlpool are added into precipitating
Whirlpool oscillation mixes cellular lysate liquid and precipitating.
3. heating 10min at 80 DEG C -100 DEG C.
Supernatant takes out 20uL as template after 4.10000rpm is centrifuged 2min.
PCR primer sequence are as follows:
Forward primer: 5 '-AAGCACGGCTTGTGTGTTGG-3 '
Reverse primer: 5 '-AGCCCCATACGCTCGAGGA-3 '
Nucleic acid amplification reaction condition is as follows:
95 DEG C initial denaturation 5 minutes,
95 DEG C 15 seconds → 62 DEG C of denaturation 30 seconds (acquisition fluorescence) → 40 circulations of annealing.
Following table is each comparative example and embodiment amplified reaction Ct value, it can thus be seen that using fungal nucleic acid of the invention
Rapid extracting method extracts nucleic acid and carries out amplification reaction, and Ct value is smaller, and the cycle-index for reaching required when the threshold value of setting is few, because
This, this method lysis efficiency is higher, and extraction efficiency is higher, and expanding effect is more preferable.
| Title | Ct value |
| (comparative example one) guanidine hydrochloride method cracking process | 28.88 |
| (comparative example two) dissociative DNA extracts kit (paramagnetic particle method) | 31.08 |
| (comparative example three) tradition chelex-100 lysate method | 31.23 |
| (embodiment one) chelex-100 lysate method | 26.72 |
| (embodiment two) chelex-100 lysate method | 26.95 |
| (embodiment two) chelex-100 lysate method | 27.03 |
Several embodiments of the present invention are described in detail above, but the content is only preferable implementation of the invention
Example, should not be considered as limiting the scope of the invention.It is all according to all the changes and improvements made by the present patent application range
Deng should still be within the scope of the patent of the present invention.
Claims (10)
1. a kind of lysate of fungal nucleic acid rapidly extracting, it is characterised in that: including 0.2 μM~1 μM of oligonucleotide fragment,
The dNTP of 0.2mM~1mM, 5%~20% 10 × PCR buffer, 0.5%~5% chelex-100 and deionized water.
2. lysate according to claim 1, it is characterised in that: the concentration of the oligonucleotide fragment is 0.4 μM~0.8
μM。
3. lysate according to claim 1 or 2, it is characterised in that: the concentration of dNTP is 0.3mM~0.6mM.
4. lysate according to claim 1 to 3, it is characterised in that: 10 × PCR buffer concentration be 10%~
15%.
5. lysate according to claim 1 to 4, it is characterised in that: the concentration of chelex-100 be 1%~
2.5%.
6. a kind of fungal nucleic acid rapid extracting method, it is characterised in that: include:
The first step, sampling originally in centrifuge tube, carry out centrifugally operated, abandon supernatant, stay precipitating, the sample is preferably alveolar wass
Liquid, cerebrospinal fluid or whole blood；
Second step is added lysate a method as claimed in any one of claims 1 to 5 into precipitating obtained by the first step, and shakes mixing, institute
The volume ratio for stating lysate and the precipitating is 100:1~300:1；
Third step, in 80-100 DEG C of 10~20min of heating；
4th step, centrifugally operated, take supernatant.
7. fungal nucleic acid rapid extracting method according to claim 6, it is characterised in that: centrifugal rotational speed in the first step
For 10000rpm~14000rpm.
8. fungal nucleic acid rapid extracting method according to claim 6 or 7, it is characterised in that: be centrifuged in the first step
Time is 2~10min.
9. according to fungal nucleic acid rapid extracting method as claimed in claim 6 to 8, it is characterised in that: in the 4th step from
Heart revolving speed is 8000rpm~14000rpm.
10. according to any fungal nucleic acid rapid extracting method of claim 6-9, it is characterised in that: in the 4th step
Centrifugation time is 2~10min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811436311.7A CN109439653A (en) | 2018-11-28 | 2018-11-28 | A kind of lysate and method of fungal nucleic acid rapidly extracting |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811436311.7A CN109439653A (en) | 2018-11-28 | 2018-11-28 | A kind of lysate and method of fungal nucleic acid rapidly extracting |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109439653A true CN109439653A (en) | 2019-03-08 |
Family
ID=65555185
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811436311.7A Pending CN109439653A (en) | 2018-11-28 | 2018-11-28 | A kind of lysate and method of fungal nucleic acid rapidly extracting |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109439653A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110294128A1 (en) * | 2007-08-02 | 2011-12-01 | Universite Laval | Concentration and Enrichment of Microbial Cells and Microbial Nucleic Acids from Bodily Fluids |
| CN105838783A (en) * | 2016-03-22 | 2016-08-10 | 北京交通大学 | Rapid separation and detection kit and method for fragmented crosslinked DNA |
| CN108841729A (en) * | 2018-06-15 | 2018-11-20 | 合肥艾迪康临床检验所有限公司 | It is a kind of for fungi and the cell pyrolysis liquid of bacterium and preparation method thereof |
-
2018
- 2018-11-28 CN CN201811436311.7A patent/CN109439653A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110294128A1 (en) * | 2007-08-02 | 2011-12-01 | Universite Laval | Concentration and Enrichment of Microbial Cells and Microbial Nucleic Acids from Bodily Fluids |
| CN105838783A (en) * | 2016-03-22 | 2016-08-10 | 北京交通大学 | Rapid separation and detection kit and method for fragmented crosslinked DNA |
| CN108841729A (en) * | 2018-06-15 | 2018-11-20 | 合肥艾迪康临床检验所有限公司 | It is a kind of for fungi and the cell pyrolysis liquid of bacterium and preparation method thereof |
Non-Patent Citations (2)
| Title |
|---|
| HUEY-PIN TSAI等: "Comparison of Two Commercial Automated Nucleic Acid Extraction and Integrated Quantitation Real-Time PCR Platforms for the Detection of Cytomegalovirus in Plasma", 《PLOS ONE》 * |
| 周双清等: "Chelex-100快速提取放线菌DNA作为PCR扩增模板", 《生物技术通报》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101712954B (en) | Reagent and method for quick release of nucleic acid | |
| JP2004201641A (en) | Detection of eumycetes | |
| CN109182536B (en) | Loop-mediated isothermal amplification detection primer for Pheretima aspergillum and LAMP technology-based method for identifying Pheretima aspergillum | |
| CN111270007A (en) | Primer, micro-fluidic chip and system for detecting classical swine fever virus and application of primer, micro-fluidic chip and system | |
| CN108977499A (en) | A kind of detection method and kit of mankind's alcohol metabolism ability gene mutation site | |
| CN102952896B (en) | Universal loop-mediated isothermal amplification kit for detecting influenza A virus and application of universal loop-mediated isothermal amplification kit | |
| CN109182600B (en) | Fluorescent quantitative PCR kit for synchronously detecting hepatitis B virus, hepatitis C virus and human immunodeficiency virus type 1 | |
| CN101376912A (en) | Loop-mediated isothermal amplification detection kit of influenza A3 viruses and detecting method | |
| CN110093432B (en) | sRNA marker for distinguishing mycobacterium tuberculosis from BCG vaccine and application thereof | |
| CN106811461A (en) | The method that one kind builds pre miRNA5 ' RACE seq libraries in plant | |
| CN109439653A (en) | A kind of lysate and method of fungal nucleic acid rapidly extracting | |
| CN103184214A (en) | Hepatitis B virus nucleic acid rapid extraction reagent | |
| CN114410836A (en) | Kit and method for detecting human parvovirus B19 by integrating sample collection treatment, nucleic acid extraction and multiple isothermal amplification | |
| CN112760361A (en) | Primer and kit for detecting shrimp liver enterocytozoon | |
| CN107881257A (en) | The type of Coxsackie virus A 6 and A10 types combined detection kit and its application | |
| CN109536502B (en) | PCR (polymerase chain reaction) internal reference applicable to plasma exosome miRNA of patient with gestational trophoblastic tumor | |
| JP4301486B2 (en) | Nucleic acid extraction method | |
| JP6318239B2 (en) | Method for extracting fungal nucleic acid | |
| CN114085902B (en) | Application of reagent for detecting miR-671-5p in human serum exosome and osteoporosis detection kit | |
| CN108841819A (en) | For extracting the kit and method of dissociative DNA | |
| CN108866156A (en) | The preparation method and applications of single mass system enzymatic amplification composition for POCT fluorescence RT-PCR system | |
| CN105567867B (en) | Human immunodeficiency virus type 1 real-time fluorescence nucleic acid isothermal amplification detection kit | |
| CN113564275A (en) | Kit for rapidly detecting common pathogenic strains of fungal infectious granuloma | |
| CN108796133B (en) | Real-time fluorescence quantitative detection kit and detection method for HBV DNA in serum | |
| CN106701961B (en) | Reverse transcription loop-mediated isothermal amplification primer, kit and detection method for visually detecting Hobi-like pestivirus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190308 |