CN106811461A - The method that one kind builds pre miRNA5 ' RACE seq libraries in plant - Google Patents

The method that one kind builds pre miRNA5 ' RACE seq libraries in plant Download PDF

Info

Publication number
CN106811461A
CN106811461A CN201710051850.8A CN201710051850A CN106811461A CN 106811461 A CN106811461 A CN 106811461A CN 201710051850 A CN201710051850 A CN 201710051850A CN 106811461 A CN106811461 A CN 106811461A
Authority
CN
China
Prior art keywords
primer
plant
seq
rna
race
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201710051850.8A
Other languages
Chinese (zh)
Inventor
宋剑波
刘琳
岳路明
莫小为
杨海奇
陈雪梅
莫蓓莘
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shenzhen University
Original Assignee
Shenzhen University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shenzhen University filed Critical Shenzhen University
Priority to CN201710051850.8A priority Critical patent/CN106811461A/en
Publication of CN106811461A publication Critical patent/CN106811461A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1096—Processes for the isolation, preparation or purification of DNA or RNA cDNA Synthesis; Subtracted cDNA library construction, e.g. RT, RT-PCR
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
    • C40B50/06—Biochemical methods, e.g. using enzymes or whole viable microorganisms

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biomedical Technology (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • General Health & Medical Sciences (AREA)
  • Analytical Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Immunology (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides the method that one kind builds the RACE seq libraries of pre miRNA 5 ' in plant, the situation of change of the terminal bases of pre miRNA 5 ' in plant can be clearly seen using the method.The extraction that the present invention passes through RNA, adjunction head, reverse transcription, the method such as cyclization and PCR is successfully solved and is difficult to the technical barrier of adjunction head at 5 ' ends, and the RACE seq library construction new methods of pre miRNA 5 ' for high-flux sequence have been founded in plant.The present invention separates the technologies such as RNA technologies, 3 ' RACE joint techniques and single stranded DNA cyclisation using SDS PAGE.This method introduces looping technique during pre miRNA build storehouse first, solves the problems, such as the addition of joint, and can construct the RACE seq libraries of high-quality pre miRNA 5 '.

Description

The method that one kind builds the RACE-seq of pre-miRNA 5 ' libraries in plant
Technical field
The present invention relates to the method that one kind builds the RACE-seq of pre-miRNA 5 ' libraries in plant.
Background technology
With the development of sequencing technologies, the sequencing of transcript profile and degraded group is increasingly universal, used as the base of two generation sequencing technologies Plinth, the structure in library plays decisive role to sequencing result.Although now very ripe to the structure in mRNA libraries, In plant, the library construction to pre-miRNA is not yet reported that.Pre-miRNA as miRNA precursor, its modification for The formation of ripe miRNA is most important, so verifying the shape of the situation of change for research miRNA of the nucleotides of pre-miRNA Into with important biological significance.At present, the method for mRNA and miRNA library constructions is ripe, but in plant, pre- The construction method or blank out in miRNA5 ' RACE-seq libraries.Reason is that pre-miRNA has compared with ripe miRNA There is loop-stem structure, and 3 ' ends protrude, and cause common RNA ligase to work, it is difficult to joint is added in 5 ' ends, so Common method cannot be utilized to complete library construction.
The content of the invention
The present invention is directed to above weak point, and the present invention provides one kind and builds pre-miRNA5 ' RACE-seq texts in plant The method in storehouse, constructs high-quality miRNA libraries.
The purpose of the present invention is realized by following technology：The RACE-seq of pre-miRNA 5 ' libraries in one kind structure plant Method, including it is as follows：
(1) extraction of plant total serum IgE；
(2) preparation of RNA：The plant total serum IgE for being extracted is separated using SDS-PAGE, between 50bp-400bp RNA carry out gel extraction；
(3) connect：The length of the RNA for having reclaimed concentrates on 50bp-400bp, special in the 3 ' ends of RNA by ligase The addition joint of property；
(4) reverse transcription：Using reverse transcription reagent box, the RNA to having added good joint carries out reverse transcription, reverse transcription into cDNA；
(5) annulation：Using cyclic kit, the successful cDNA of reverse transcription is joined end to end, become circlewise；
(6) PCR reactions：Ring-type cDNA after cyclization and first round primer are entered into performing PCR reaction, then with PCR primer and the Two wheel primers carry out the second wheel PCR reactions, can thus amplify and：Primer amplifies the miRNA for coming.
The present invention also has following technical characteristic：
1st, the as described above a kind of method for building the RACE-seq of pre-miRNA 5 ' libraries in plant, described in step 6 First round primer, upper primer as shown in sequence table SEQ ID No.1, lower primer such as sequence table SEQ ID No.2-SEQ ID Shown in No.11.
2nd, the as described above a kind of method for building the RACE-seq of pre-miRNA 5 ' libraries in plant, described in step 6 Second wheel primer, upper primer as shown in sequence table SEQ ID No.12, lower primer such as sequence table SEQ ID No.13-SEQ ID Shown in No.22.
The advantage of the method for the present invention is to verify the formation of the situation of change to miRNA of the nucleotides of pre-miRNA Biological action when, the situation of change of the terminal bases of pre-miRNA 5 ' in plant can be clearly seen using the method. This method introduces looping technique during pre-miRNA builds storehouse first, solves the problems, such as the addition of joint, and can construct height The RACE-seq of the pre-miRNA 5 ' libraries of quality.
Brief description of the drawings
Fig. 1 is Library development flow sketch of the present invention.
Specific embodiment
The present invention will be further described for citing below：
Embodiment 1
The extraction of step one, plant total serum IgE
1st, the fresh plant tissues of 100mg are taken in clean 1.5mL centrifuge tubes.
2nd, it is plant tissue is quick-frozen in liquid nitrogen, smashed to pieces with pipette tips.
3rd, add 1mL TRIZOL to turn upside down mixing, 5min is stood at room temperature.
4th, 200 μ L chloroforms are added, is overturned and is mixed, be stored at room temperature 15min.
5th, 12000X g centrifugations 15min, draws the μ L of supernatant 400.
6th, 400 μ L isopropanols are added, is overturned and is mixed, -20 DEG C stand 30min shallow lake RNA.
7th, 4 DEG C, 12000X g centrifugation 15min abandon supernatant.
8th, the ethanol washing RNA of 1mL75%, 4 DEG C, 12000X g centrifugations 5min are added.
9th, drying at room temperature RNA, adds 30 μ L ddH2O dissolves RNA.
10th, the RNA of extraction is deposited in into -80 DEG C of preservations.
The preparation (50-400) of step 2, RNA
1st, 15% urea-PAGE glue, common 15mL are configured：
Glue is poured into clamping plate, comb, gel at least 30min is put.
2nd, in the total serum IgE of 30 μ L, 2 × small RNA loading dye of equivalent are added, 70 DEG C of denaturation after mixing 5min, is placed on ice immediately after.
Wherein, 2 × small RNA loading dye：80%formamide (formamide), 0.1%Xylene FF (two Toluene FF), 0.1%Brophenol Blue (bromophenol blue).
3rd, point sample, and add DNA marker, the 150V electrophoresis 1-1.5h of 10 μ L 10bp.(Running buffer:0.5 ×TBE)
4th, EB dyeing 5min.
5th, glue is cut, the glue of 50-400bp is reclaimed to 1.5mL centrifuge tubes, and glue is consulted broken with the pipette tips of 1mL.
6th, 500 μ L 0.4N NaCl-DEPC are added to centrifuge tube, and ensures that glue can flow when centrifuge tube is overturn It is dynamic.
7th, centrifuge tube upset 6h or overnight is held for 4 DEG C.
8th, 4 DEG C, be transferred to supernatant in new centrifuge tube by 13200r/m centrifugation 1min.Repeat 2-3 times, until removal All of glue.
9th, add 1 μ L Glycogen (glycogen), 50uLNaOAc and the ethanol of 1mL 100%, be put into after mixing -20 DEG C of 6h or Person is overnight.
10th, it is centrifuged and washs RNA with 70% ethanol.
11st, with 20 μ L DEPC- water dissolving RNAs, this RNA is used for building storehouse.
Step 3, connection
(1), (20uL systems) is connected
Reaction condition：
1st, 25 DEG C of reaction 2h.
2nd, 65 DEG C of reaction 20min make enzyme denaturation.
(2) (50bp -420bp) is reclaimed
1st, in the total serum IgE of 30 μ L, 2 × small RNA loading dye of equivalent are added, 70 DEG C of denaturation after mixing 5min, is placed on ice immediately after.
Wherein, 2 × small RNA loading dye：80%formamide (formamide), 0.1%Xylene FF (two Toluene FF), 0.1%Brophenol Blue (bromophenol blue).
2nd, point sample, and add DNA marker, the 150V electrophoresis 1-1.5h of 10 μ L 10bp.(Running buffer:0.5 ×TBE)
3rd, EB dyeing 5min.
4th, glue is cut, the glue of 50-400bp or 50-250bp is reclaimed to 1.5mL centrifuge tubes, and glue is stabbed broken with 1mL pipette tips.
5th, 500 μ L 0.4N NaCl-DEPC are added to centrifuge tube, and ensures that glue can flow when centrifuge tube is overturn It is dynamic.
6th, 4 DEG C keep centrifuge tube upset 6h or overnight.
7th, 4 DEG C, be transferred to supernatant in new centrifuge tube by 13200r/m centrifugation 1min.Repeat 2-3 times, until removal All of glue.
8th, 1 μ L Glycogen (glycogen) are added, 50 100% ethanol of Μ l NaOAc and 1mL are put into -20 DEG C of 6h after mixing Or overnight.
9th, it is centrifuged and the ethanol with 70% washes RNA, 20 μ L DEPC- water, -80 DEG C of preservations is dissolved in after drying.
Step 4, reverse transcription reaction
(1) reverse transcription
1st, predegeneration
Ligated RNA 12μL
RT Primer 1μL
70 DEG C of reaction 10min, put rapidly 2min on ice.
2. reverse transcription reaction (20 μ L systems)
30 DEG C of 10min,
42 DEG C of 1h,
After 70 DEG C of 15min denaturation,
4 DEG C of preservations.
(2) fragment of 50-420bp is reclaimed
1st, 12% PAGE glue (common 15mL) is prepared
Add 10 μ L 6 × DNA loading dye in PCR primer, all of DNA is clicked and entered into glue hole, with time point 10 μL 10bp DNA marker。
2nd, gel electrophoresis 150V, 1.5h are carried out.
3rd, the DNA bands of 50-420bp are cut, DNA is reclaimed with the method for reclaiming tiny RNA.
4th, it is centrifuged, washing is dried.
5th, DNA is washed with 70% ethanol, 20 μ L DEPC- water, -80 DEG C of preservations is dissolved in after drying.
Step 5, annulation
1st, annulation (20 μ L systems):
2nd, 60 DEG C of reaction 2h.
3rd, 80 DEG C of reaction 10min go out enzyme activity.
Step 6, PCR reactions
Two-wheeled PCR reacts (LA Taq)
(1) 10 circulations of the first round
Primer：
Sense:1st PCR Forward primer
GTTCAGAGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGC
Anti-sense:miRNA-R(mix)
MIR158b-R TCTACATTTGGGGAAAA
MIR166a-R GATCCAACATGAATAGAGC
MIR168a-R TCCCTGCTCACAAACCAATAAAG
MIR168b-R TGTCGGTGTCAGCCAATC
MIR169h-R ACGCAGGCAAGTCATCC
MIR169j-R GATCAGGCAAGTCATCC
MIR390b-R ATACAAAACATACAGCACT
MIR394b-R CACCGTAGATACGTACACTTATT
MIR398b-R GTAACAATGACGTAGCG
MIR398c-R GTAACAATGACGTAGCG
System：(20 μ l systems)
Reaction condition：
98 DEG C of predegenerations 3min, 98 DEG C of denaturation 10s, 60 DEG C of annealing 30s, 72 DEG C of extension 30s, totally 10 circulations, 72 DEG C of ends Extend 5min, 12 DEG C of ∞.
(2) fragment of 50-200bp is reclaimed
1st, add 10 μ L 6 × DNA loading dye in PCR primer, all of DNA is clicked and entered into glue hole, with time point 10μL 10bp DNA marker
2nd, gel electrophoresis 150V, 1.5h are carried out.
3rd, the DNA bands of 50-200bp are cut, DNA is reclaimed with the method for reclaiming tiny RNA
4th, it is centrifuged, washing is dried
5th, with the water dissolves DNA of 20-30 μ L.
(3) second wheel PCR (16 circulations)
Primer：
Sense:2nd PCR Forward primer
AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGAAnti-sense:miRNA-R- 2nd(mix)
MIR158b-R-2nd
CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCATCTACA TTTGGGGAAAA
MIR166a-R-2nd
CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCAGATCCA ACATGAATAGAGC
MIR168a-R-2nd
CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCATCCCTG CTCACAAACCAATAAAG
MIR168b-R-2nd
CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCATGTCGG TGTCAGCCAATC
MIR169h-R-2nd
CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCAACGCAG GCAAGTCATCC
MIR169j-R-2nd
CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCAGATCAG GCAAGTCATCC
MIR390b-R-2nd
CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCAATACAA AACATACAGCACT
MIR394b-R-2nd
CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCACACCGT AGATACGTACACTTATT
MIR398b-R-2nd
CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCAGTAACA ATGACGTAGCG
MIR398c-R-2nd
CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCAGTAACA ATGACGTAGCG
Reaction system：(20 μ l systems)
Reaction condition：98 DEG C of predegeneration 3min；98 DEG C of denaturation 10s, 60 DEG C of annealing 30s, 72 DEG C of extension 30s, totally 16 are followed Ring；72 DEG C extend 5min, 12 DEG C of ∞ eventually.
(4) fragment of 100-300bp is reclaimed
1st, add 10 μ L 6 × DNA loading dye in PCR primer, all of DNA is clicked and entered into glue hole, with time point 10μL 10bp DNA marker
2nd, gel electrophoresis 150V, 1.5h are carried out.
3rd, the DNA bands of 100-300bp are cut, DNA is reclaimed with the method for reclaiming tiny RNA.
4th, it is centrifuged, washing is dried.
5th, with the water dissolves DNA of 20-30 μ L, it is used to be sequenced.
Advantage of this approach is that verifying the biology of the situation of change of the nucleotides of pre-miRNA to the formation of miRNA When act on, common banking process cannot see the situation of change at plant pre-miRNA5 ' ends.Because plant pre- 3 ' the terminal bases of miRNA are protruded, and common RNA ligase cannot work, and cause 5 ' ends to be difficult to add joint.This method is first Looping technique first is introduced during pre-miRNA builds storehouse, the addition of joint is solved the problems, such as, and can construct high-quality Pre-miRNA5 ' RACE-seq libraries.
The ＞ Shenzhen University of ＜ 110
A kind of methods for building the RACE-seq of pre-miRNA 5 ' libraries in plant of the ＞ of ＜ 120
The ＞ 22 of ＜ 160
The ＞ 1 of ＜ 210
The ＞ 48 of ＜ 211
The ＞ DNA of ＜ 212
The ＞ 1st PCR Forward primer of ＜ 213
The ＞ 1 of ＜ 400
gttcagagtt ctacagtccg acgatctgga attctcgggt gccaaggc 48
The ＞ 2 of ＜ 210
The ＞ 17 of ＜ 211
The ＞ DNA of ＜ 212
The ＞ MIR158b-R of ＜ 213
The ＞ 2 of ＜ 400
tctacatttg gggaaaa 17
The ＞ 3 of ＜ 210
The ＞ 19 of ＜ 211
The ＞ DNA of ＜ 212
The ＞ MIR166a-R of ＜ 213
The ＞ 3 of ＜ 400
gatccaacat gaatagagc 19
The ＞ 4 of ＜ 210
The ＞ 23 of ＜ 211
The ＞ DNA of ＜ 212
The ＞ MIR168a-R of ＜ 213
The ＞ 4 of ＜ 400
tccctgctca caaaccaata aag 23
The ＞ 5 of ＜ 210
The ＞ 18 of ＜ 211
The ＞ DNA of ＜ 212
The ＞ MIR168b-R of ＜ 213
The ＞ 5 of ＜ 400
tgtcggtgtc agccaatc 18
The ＞ 6 of ＜ 210
The ＞ 17 of ＜ 211
The ＞ DNA of ＜ 212
The ＞ MIR169h-R of ＜ 213
The ＞ 6 of ＜ 400
acgcaggcaa gtcatcc 17
The ＞ 7 of ＜ 210
The ＞ 17 of ＜ 211
The ＞ DNA of ＜ 212
The ＞ MIR169j-R of ＜ 213
The ＞ 7 of ＜ 400
gatcaggcaa gtcatcc 17
The ＞ 8 of ＜ 210
The ＞ 19 of ＜ 211
The ＞ DNA of ＜ 212
The ＞ MIR390b-R of ＜ 213
The ＞ 8 of ＜ 400
atacaaaaca tacagcact 19
The ＞ 9 of ＜ 210
The ＞ 23 of ＜ 211
The ＞ DNA of ＜ 212
The ＞ MIR394b-R of ＜ 213
The ＞ 9 of ＜ 400
caccgtagat acgtacactt att 23
The ＞ 10 of ＜ 210
The ＞ 17 of ＜ 211
The ＞ DNA of ＜ 212
The ＞ MIR398b-R of ＜ 213
The ＞ 10 of ＜ 400
gtaacaatga cgtagcg 17
The ＞ 11 of ＜ 210
The ＞ 17 of ＜ 211
The ＞ DNA of ＜ 212
The ＞ MIR398c-R of ＜ 213
The ＞ 11 of ＜ 400
gtaacaatga cgtagcg 17
The ＞ 12 of ＜ 210
The ＞ 50 of ＜ 211
The ＞ DNA of ＜ 212
The ＞ 2nd PCR Forward primer of ＜ 213
The ＞ 12 of ＜ 400
aatgatacgg cgaccaccga gatctacacg ttcagagttc tacagtccga 50
The ＞ 13 of ＜ 210
The ＞ 80 of ＜ 211
The ＞ DNA of ＜ 212
The ＞ MIR158b-R-2nd of ＜ 213
The ＞ 13 of ＜ 400
caagcagaag acggcatacg agatcgtgat gtgactggag ttccttggca cccgagaatt 60
ccatctacat ttggggaaaa 80
The ＞ 14 of ＜ 210
The ＞ 82 of ＜ 211
The ＞ DNA of ＜ 212
The ＞ MIR166a-R-2nd of ＜ 213
The ＞ 14 of ＜ 400
caagcagaag acggcatacg agatcgtgat gtgactggag ttccttggca cccgagaatt 60
ccagatccaa catgaataga gc 82
The ＞ 15 of ＜ 210
The ＞ 86 of ＜ 211
The ＞ DNA of ＜ 212
The ＞ MIR168a-R-2nd of ＜ 213
The ＞ 15 of ＜ 400
caagcagaag acggcatacg agatcgtgat gtgactggag ttccttggca cccgagaatt 60
ccatccctgc tcacaaacca ataaag 86
The ＞ 16 of ＜ 210
The ＞ 81 of ＜ 211
The ＞ DNA of ＜ 212
The ＞ MIR168b-R of ＜ 213
The ＞ 16 of ＜ 400
caagcagaag acggcatacg agatcgtgat gtgactggag ttccttggca cccgagaatt 60
ccatgtcggt gtcagccaat c 81
The ＞ 17 of ＜ 210
The ＞ 80 of ＜ 211
The ＞ DNA of ＜ 212
The ＞ MIR169h-R-2nd of ＜ 213
The ＞ 17 of ＜ 400
caagcagaag acggcatacg agatcgtgat gtgactggag ttccttggca cccgagaatt 60
ccaacgcagg caagtcatcc 80
The ＞ 18 of ＜ 210
The ＞ 80 of ＜ 211
The ＞ DNA of ＜ 212
The ＞ MIR169j-R-2nd of ＜ 213
The ＞ 18 of ＜ 400
caagcagaag acggcatacg agatcgtgat gtgactggag ttccttggca cccgagaatt 60
ccagatcagg caagtcatcc 80
The ＞ 19 of ＜ 210
The ＞ 82 of ＜ 211
The ＞ DNA of ＜ 212
The ＞ MIR390b-R-2nd of ＜ 213
The ＞ 19 of ＜ 400
caagcagaag acggcatacg agatcgtgat gtgactggag ttccttggca cccgagaatt 60
ccaatacaaa acatacagca ct 82
The ＞ 20 of ＜ 210
The ＞ 86 of ＜ 211
The ＞ DNA of ＜ 212
The ＞ MIR394b-R-2nd of ＜ 213
The ＞ 20 of ＜ 400
caagcagaag acggcatacg agatcgtgat gtgactggag ttccttggca cccgagaatt 60
ccacaccgta gatacgtaca cttatt 86
The ＞ 21 of ＜ 210
The ＞ 80 of ＜ 211
The ＞ DNA of ＜ 212
The ＞ MIR398b-R-2nd of ＜ 213
The ＞ 21 of ＜ 400
caagcagaag acggcatacg agatcgtgat gtgactggag ttccttggca cccgagaatt 60
ccagtaacaa tgacgtagcg 80
The ＞ 22 of ＜ 210
The ＞ 80 of ＜ 211
The ＞ DNA of ＜ 212
The ＞ MIR398c-R-2nd of ＜ 213
The ＞ 22 of ＜ 400
caagcagaag acggcatacg agatcgtgat gtgactggag ttccttggca cccgagaatt 60
ccagtaacaa tgacgtagcg 80

Claims (3)

1. the method that one kind builds the RACE-seq of pre-miRNA 5 ' libraries in plant, including it is as follows：
(1) extraction of plant total serum IgE；
(2) preparation of RNA：The plant total serum IgE for being extracted is separated using SDS-PAGE, between 50bp-400bp RNA carries out gel extraction；
It is characterized in that：
(3) connect：The length of the RNA for having reclaimed concentrates on 50bp-400bp, by ligase RNA 3 ' terminal specificities Addition joint；
(4) reverse transcription：Using reverse transcription reagent box, the RNA to having added good joint carries out reverse transcription, and reverse transcription is into cDNA；
(5) annulation：Using cyclic kit, the successful cDNA of reverse transcription is joined end to end, become circlewise；
(6) PCR reactions：Ring-type cDNA after cyclization and first round primer are entered into performing PCR reaction, then is taken turns with second with PCR primer Primer carries out the second wheel PCR reactions, comes this makes it possible to amplify：Primer amplifies the miRNA for coming.
2. the method that one kind according to claim 1 builds pre-miRNA5 ' RACE-seq libraries in plant, its feature exists In, the first round primer described in step 6, upper primer as shown in sequence table SEQ ID No.1, lower primer such as sequence table SEQ ID Shown in No.2-SEQ ID No.11.
3. the method that one kind according to claim 1 builds pre-miRNA5 ' RACE-seq libraries in plant, its feature exists In, described in step 6 second wheel primer, upper primer as shown in sequence table SEQ ID No.12, lower primer such as sequence table SEQ ID Shown in No.13-SEQ ID No.22.
CN201710051850.8A 2017-01-20 2017-01-20 The method that one kind builds pre miRNA5 ' RACE seq libraries in plant Pending CN106811461A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710051850.8A CN106811461A (en) 2017-01-20 2017-01-20 The method that one kind builds pre miRNA5 ' RACE seq libraries in plant

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710051850.8A CN106811461A (en) 2017-01-20 2017-01-20 The method that one kind builds pre miRNA5 ' RACE seq libraries in plant

Publications (1)

Publication Number Publication Date
CN106811461A true CN106811461A (en) 2017-06-09

Family

ID=59112190

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710051850.8A Pending CN106811461A (en) 2017-01-20 2017-01-20 The method that one kind builds pre miRNA5 ' RACE seq libraries in plant

Country Status (1)

Country Link
CN (1) CN106811461A (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107385516A (en) * 2017-07-20 2017-11-24 深圳大学 The method in the RACE seq libraries of pri miRNA 3 ' in one kind structure plant
CN107829145A (en) * 2017-10-20 2018-03-23 重庆天科雅生物科技有限公司 A kind of method for building mouse TCRalphaCDR3 areas library
CN108103173A (en) * 2017-11-10 2018-06-01 中山大学 A kind of method for building mouse miRNA sequencing libraries and carrying out high-flux sequence
CN116042770A (en) * 2022-11-01 2023-05-02 苏州京脉生物科技有限公司 Method and kit for preparing miRNA library in urine and quantifying expression

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150087556A1 (en) * 2013-09-20 2015-03-26 University Of Massachusetts COMPOSITIONS AND METHODS FOR MAKING cDNA LIBRARIES FROM SMALL RNAs

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150087556A1 (en) * 2013-09-20 2015-03-26 University Of Massachusetts COMPOSITIONS AND METHODS FOR MAKING cDNA LIBRARIES FROM SMALL RNAs

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
LIU XUHANG等: "A MicroRNA Precursor Surveillance System in Quality Control of MicroRNA Synthesis", 《MOLECULAR CELL》 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107385516A (en) * 2017-07-20 2017-11-24 深圳大学 The method in the RACE seq libraries of pri miRNA 3 ' in one kind structure plant
CN107829145A (en) * 2017-10-20 2018-03-23 重庆天科雅生物科技有限公司 A kind of method for building mouse TCRalphaCDR3 areas library
CN108103173A (en) * 2017-11-10 2018-06-01 中山大学 A kind of method for building mouse miRNA sequencing libraries and carrying out high-flux sequence
CN108103173B (en) * 2017-11-10 2021-04-27 中山大学 Method for constructing mouse miRNA sequencing library for high-throughput sequencing
CN116042770A (en) * 2022-11-01 2023-05-02 苏州京脉生物科技有限公司 Method and kit for preparing miRNA library in urine and quantifying expression
CN116042770B (en) * 2022-11-01 2023-12-01 苏州京脉生物科技有限公司 Method and kit for preparing miRNA library in urine and quantifying expression

Similar Documents

Publication Publication Date Title
CN106757380A (en) A kind of method for building pre miRNA3`RACE seq libraries in plant
CN106811461A (en) The method that one kind builds pre miRNA5 ' RACE seq libraries in plant
WO2018103025A1 (en) Method for constructing single cell sequencing library and use thereof
CN102485979A (en) Formalin-fixed paraffin-embedded (FFPE) sample nucleic acid library
CN101812494B (en) Long PCR walking kit and using method and application thereof
CN105002569A (en) Transcriptome library and construction method thereof
CN106868005A (en) A kind of anchor primer and amplification method for efficient Rapid amplification of cDNA ends
CN105695577A (en) High-throughput sequencing method for methylated CpG island in trace DNA
CN106591289A (en) Method for capturing interacted DNA fragments in tissue nuclear genome
CN113249437A (en) Library construction method for sRNA sequencing
CN109706226B (en) Method for rapidly detecting miRNA based on asymmetric PCR and LAMP cyclic amplification reaction
CN112585279A (en) RNA library building method and kit
CN107385516A (en) The method in the RACE seq libraries of pri miRNA 3 ' in one kind structure plant
CN1763223B (en) miRNA detection method
CN116904568A (en) Method for removing ribosomal RNA in RNA-seq
CN101705295A (en) Detection method of turbot FF0901 microsatellite marker by utilizing specific primers
CN114410741B (en) Simple RNA library construction method
WO2023065615A1 (en) Probe for blocking ribosome rna or globulin rna in rna library construction process, and use thereof
CN113862394B (en) RPA detection method for tomato infertility virus
CN105368800B (en) A kind of thermal starting Taq DNA polymerase and preparation method thereof
CN110551841B (en) SSR primer group developed based on eggplant transcriptome sequencing data and application thereof
CN113718343A (en) Rapid RNA library building method and kit
CN116926210B (en) Specific COI (chip on insulator) primers and application thereof in rapid identification of rana spinosa
CN110225979B (en) Rolling circle amplification-based genome target region enrichment method and application thereof
CN101948828B (en) Trace animal cell genomic DNA template preparation solution and corresponding DNA template preparation method

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
WD01 Invention patent application deemed withdrawn after publication
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20170609