CN101812494B - Long PCR walking kit and using method and application thereof - Google Patents
Long PCR walking kit and using method and application thereof Download PDFInfo
- Publication number
- CN101812494B CN101812494B CN 200910214350 CN200910214350A CN101812494B CN 101812494 B CN101812494 B CN 101812494B CN 200910214350 CN200910214350 CN 200910214350 CN 200910214350 A CN200910214350 A CN 200910214350A CN 101812494 B CN101812494 B CN 101812494B
- Authority
- CN
- China
- Prior art keywords
- reagent
- pcr
- primer
- long
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a long PCR walking kit and a using method and the application thereof. The long PCR walking kit comprises: (1) reagent A, wherein every 9.25-12.5mu L of reagent A contains 1-3 mu L of 10m mol/L dNTP, 3-4mu L of 25m mol/L MgCl2, 5mu L of 10* PCR buffer solution and 0.25-0.5mu L of Taq enzyme; (2) reagent B, 5-20 ml of ddH2O; (3) reagent C, 5-20g of agarose; (4) reagent D, 1-5mL of 6* PCR loading buffer solution; (5) reagent E, 20-100mu L of nucleic acid dye; (6) reagent F, 10-20mL of 50* electrophoretic buffer solution; and (7) 11 primers which are shown in the sequence SEQ ID NO.: 1-11, wherein the content of each primer is 10-50mu L. The long PCR walking kit is low in cost, is obviously simple and rapid compared with other amplification methods, has high efficiency, can obtain a flanking fragment which is longer than 3Kb for one time, is used for acquiring DNA flanking unknown sequence without species restriction, and can be widely used for molecular biological experiments.
Description
Technical field
The present invention relates to the clone field of known dna fragment flank unknown nucleotide sequence, be specifically related to a kind of long PCR walking kit and using method thereof and application.
Background technology
For heredity and molecular biology correlative study, obtaining known dna sequence flank unknown nucleotide sequence is a vital task that often faces.Such as: analyze the T-DNA insertion point in Functional Plant Genomics; The foreign gene of understanding the bacterial transposon insertion point and carrying; Obtain the gene of total length according to known portion gene fragment; Functional gene promoter Analysis etc.Traditional method of obtaining known dna sequence flank unknown nucleotide sequence is to build the library, then the library is screened in a large number.This method not only time-consuming, effort, cost is high, and final result depends on the quality that builds the library.Therefore, the genomic walking of PCR-based technology (the PCR step moves) becomes the interested target of people.The method that has been used at present comprises: inverse PCR, joint PCR, hot asymmetric interlaced PCR (Tail-PCR).Use although these methods have more widely in field separately, these methods all have defective separately in actual applications.Before the PCR operation, inverse PCR, joint PCR need first genome to be carried out enzyme and cut, and then connect (becoming ring or endonuclease bamhi to be connected with the joint primer in molecule), and two kinds of methods are very high to extracting genomic specification of quality.Because the not intellectual of flanking sequence need to be screened a plurality of restriction endonucleases usually, therefore has blindness; Becoming ring and joint joint efficiency in molecule is also to build the restraining factors that can be used for next step PCR step shifting formwork plate.Therefore in actually operating, an experimental program reasonable in design often can not obtain expected result, has increased on the contrary the operating time and has expended.The Tail-PCR that comes from the Semi-random primer PCR method is the method for the unknown flanking fragment that increases very widely of using in Plant Genome at present.But the Tail-PCR setting program is complicated, in order to obtain continual and steady and correct PCR product, need to repeatedly arrange procedure condition.Adopt in addition primer and the intrinsic restriction of Tail-PCR setting program itself that the degeneracy base end is arranged, all cause this method can not obtain long flank unknown fragment and product and have more false positive.Total general aforesaid method all exists complex operation, non-specific fragment is more, a hyposynchronization moves fragment short (less than 1.5Kb) defective.These defectives have all limited it and have used more widely, are the work that often faces although obtain the flank unknown nucleotide sequence.Therefore extremely be necessary to explore new simple, quick, High Efficiency PC R and go on foot shifting method, and be developed to business-like test kit, be widely used in all kinds of Molecular Biology Labs.
Summary of the invention
The object of the invention is according to the deficiencies in the prior art, and a kind of simple, fast and efficient long PCR walking kit is provided.
Another purpose of the present invention is to provide the using method of above-mentioned long PCR walking kit.
A further object of the invention is to illustrate the application of above-mentioned long PCR walking kit.
Above-mentioned purpose of the present invention is achieved by the following technical programs:
A kind of long PCR walking kit comprises: (1) reagent A: wherein, comprise dNTP (dATP, dTTP, dGTP, dCTP) 1 ~ 3 μ L of 10mmol/L in every 9.25 ~ 12.5 μ L reagent A, 25mmol/LMgCl
23 ~ 4 μ L, 10 * PCR damping fluid, 5 μ L and LA Taq enzyme 0.25 ~ 0.5 μ L; (2) reagent B:ddH
2O5 ~ 20mL; (3) reagent C: agarose 5 ~ 20g; (4) reagent D: 6 * PCR sample-loading buffer, 1 ~ 5mL; (5) reagent E: nucleic acid dye 20 ~ 100 μ L; (6) reagent F:50 * electrophoretic buffer 10 ~ 20mL; (7) primer is 11, sequence as shown in SEQ ID NO:1 ~ 11, every each 10 ~ 50 μ L.
The composition of above-mentioned 6 * PCR sample-loading buffer is: EDTA20 ~ 30mmol/L, glycerine 30 ~ 40 volume %, dimethylbenzene green grass or young crops 0.0004 ~ 0.0008g/ml and tetrabromophenol sulfonphthalein 0.0004 ~ 0.0006g/ml.
In above-mentioned 50 * electrophoretic buffer, contain Tutofusin tris 242g in every 1L 50 * electrophoretic buffer, EDTA37.2g, acetic acid 57.1mL.
The using method of the long walking kit of the present invention is comprised of two-wheeled PCR and follow-up order-checking, and concrete steps are as follows:
(1) DNA extraction, extracting method are ordinary method, genomic integrity and purity are not strict with, to the not restriction of genomic source of species;
(2) first round long PCR walking: according to the known DNA sequence dna design upstream primer P complementary with it, long 18 ~ 22bp, concentration is 1 ~ 2 μ mol/L, when reaction system is 25 μ L, add reagent A 4.2 ~ 6.25 μ L, upstream primer P0.5 ~ 1.0 μ L, DNA profiling 0.5 ~ 2.0 μ L, surplus is reagent B;
(3) first round long PCR walking amplification program: 92 ~ 94 ℃ of denaturation 2 ~ 5min, 92 ~ 94 ℃ of sex change 15 ~ 30s, 56 ~ 60 ℃ of annealing 30 ~ 60s, 68 ~ 72 ℃ are extended 3 ~ 10min, after carrying out altogether 30 circulations, reaction system are cooled to 4 ~ 12 ℃, keep 5 ~ 30min, in maintenance period, add rapidly each 0.5 ~ 1.0 μ L of primer, primer sequence is as shown in SEQ ID NO:1 ~ 10; Carry out a circulation after adding primer, this cycling program is again: 80 ~ 86 ℃ of sex change 15 ~ 40s, and 36 ~ 43 ℃ of sex change 1 ~ 3min, 68 ~ 72 ℃ are extended 3 ~ 10min, and 68 ~ 72 ℃ are extended 5 ~ 8min; Gained PCR product is got 1 μ L, adds reagent B, dilutes 10 ~ 30 times, as the second DNA profiling of taking turns long PCR;
(4) second take turns long PCR walking: design the upstream complementary with it according to known DNA sequence dna and draw Q, long 26 ~ 29bp, concentration is 10 ~ 20 μ mol/L, when reaction system is 25 μ L, add reagent A 4.2 ~ 6.25 μ L, upstream primer Q0.5 ~ 1.0 μ L, primer 0.5 ~ 1.0 μ L of sequence as shown in SEQ ID NO:11, DNA profiling 0.5 ~ 2 μ L that step (3) dilution obtains, surplus is reagent B; In PCR reaction control group, add reagent A 4.2 ~ 6.25 μ L, primer 0.5 ~ 1.0 μ L of sequence as shown in SEQ ID NO:11, DNA profiling 0.5 ~ 2 μ L that step (3) dilution obtains, surplus is reagent B;
(5) second take turns the long PCR walking amplification program: 92 ~ 94 ℃ of denaturation 2 ~ 5min, and 92 ~ 94 ℃ of sex change 15 ~ 30s, 68 ℃ of sex change are also extended 3 ~ 10min, totally 30 circulations, last 68 ℃ are extended 5 ~ 8min;
(6) the PCR step is moved the product detection: get second and take turns long PCR walking product and each 3 ~ 5 μ L of control group PCR product, add 0.5 ~ 1 μ L reagent D to mix, the loading sepharose is used as electrophoretic buffer with reagent F with 50 times of deionized water dilutions, voltage 100 ~ 140V, electrophoresis 20 ~ 40min; Ultraviolet imagery after electrophoresis finishes, in the glue sample, experimental group occur and in control group absent variable band be the positive PCR step to move fragment.
Wherein, in step (6), every 100mL sepharose contains reagent E 1 ~ 5 μ L; The described positive PCR step moves fragment and is used for the order-checking of downstream PCR product or cloning and sequencing.
The principle of above-mentioned long walking kit as shown in Figure 1, in first round PCR, long 20 ~ 22 bases of upstream primer P, with the special complementation of known array, long 39 ~ 40 bases of downstream composite primer (as shown in SEQ ID NO:1 ~ 10), its 5 ' end comprises 29 fixedly bases, and 3 ' end comprises the base (GC 〉=50%) of 6 ~ 7 Random Designs, and region intermediate is the base (NNNN) of 4 complete degeneracys.3 ' end and central region form the annealing site of a reality, its annealing temperature relatively low (38 ~ 43 ℃).At first primer P is added into reaction system, and (56 ~ 64 ℃) carry out linear specific amplification under higher annealing temperature.Then downstream composite primer (as shown in SEQ ID NO:1 ~ 10) adds cooling reactive system fast, only carries out one than the circulation of low temperature thermal oxidation.In this circulation, denaturation temperature changes 80 ~ 86 ℃ into.Under this denaturation temperature, original template DNA partly unwinds, thereby reduces the chance that the downstream composite primer is combined with primary template, is combined the chance of initiation extension with new synthetic single stranded DNA and increase it.Simultaneously, downstream composite primer concentration is much larger than primer P, therefore in the end one takes turns in PCR, and the downstream composite primer has more chance competition in conjunction with template, in unique one takes turns low rigorous annealing temperature circulation, effectively reduces the non-specific binding of primer P and template.The actual effect of playing the complementary one-tenth of the single stranded DNA double-stranded DNA that the front linear amplification is produced of last circulation of first round PCR.
After the purified and suitable dilution of first round PCR product, as the second template of taking turns PCR.Second takes turns PCR upstream primer Q and the special complementation of known array, is positioned at primer P inboard; Downstream primer (as shown in SEQ IDNO:11) is identical with 5 ' end of downstream composite primer (as shown in SEQ ID NO:1 ~ 10).Article two, primer adds reaction system simultaneously, carries out conventional long range PCR and gets final product.In second takes turns PCR, adopt high rigorous annealing temperature (68 ℃, far above first round PCR annealing temperature), the remaining a small amount of downstream composite primer of possibility and P in first round reaction, can not produce interference effect, so first round PCR product does not need independent purifying to remove primer.Second takes turns after long PCR walking finishes, and cuts glue and reclaims positive fragment, is used for direct Sequencing or cloning and sequencing, can obtain known dna sequence flank long segment unknown nucleotide sequence.
Compared with prior art, long PCR walking kit of the present invention has following beneficial effect:
(1) long PCR walking kit of the present invention is simple, quick.The present invention is not strict with genomic quality, both can adopt test kit or traditional phenol/chloroform extraction method, can use the simplest water-boiling method again; The present invention need not to build the storehouse, need not also that long enzyme consuming time is cut, connection and fixing step can directly carry out the PCR reaction;
(2) long PCR walking kit of the present invention is efficient, reliable.The present invention only needs two vice-minister PCR processes specifically required long fin section to be increased out, and non-specific fragment is few, and is many than loaded down with trivial details, the non-specific fragment of traditional operation, method that the product fragment is short is obviously efficient;
(3) cost of long PCR walking kit of the present invention reduces greatly.This test kit and using method do not need essence to carry template DNA, do not need enzyme to cut screening, connect or first round PCR product is carried out purifying yet, having forgone needs the process of the suitable restriction endonuclease of searching that plurality of enzymes cuts in the common method, therefore in actually operating, experiment expends greatly and reduces;
(4) long PCR walking kit of the present invention has a extensive future.Because the present invention adopts primer 3 ' end base random arrangement, therefore do not use the restriction of species scope, microorganism, animal, plant all can be used.The ordinary method amplified fragments is short, a hyposynchronization moves the sequence length scope that needs understanding that do not reach in actual applications, the present invention once just can obtain long fragment (greater than 3Kb), has reduced the step and has moved operation, is used for Molecular Biology Lab and can accelerates scientific research speed; Be used for commercially producing, can enhance productivity, have very wide application prospect.
Description of drawings
Fig. 1 is the schematic diagram of long PCR walking kit of the present invention;
Fig. 2 is the PCR product gel electrophorogram in embodiment 1, and wherein, A is that primer 1 (SEQ ID NO:1) participates in the band that amplification produces, and B is that primer 5 (SEQ ID NO:5) participates in the band that amplification produces;
Fig. 3 is the PCR product gel electrophorogram in embodiment 2, and wherein, A, B and C are that primer 10 (SEQID NO:10) participates in three positive bands that amplification produces.
Embodiment
Further explain the present invention below in conjunction with embodiment, but embodiment does not do any type of restriction to the present invention.
Long PCR walking is used for amplification and obtains the unknown DNA sequence dna of vibrio alginolyticus E0601 paracholera vibrios transposon valT flank.By following formulated reagent.
Test kit forms:
1) reagent A: be reaction premix system 500 μ L.Every 10.5 μ L comprise 1 μ L dNTP (dATP, dTTP, each 10mmol/L of dGTP, dCTP), 4 μ L MgCl
2(25mmol/L), 5 μ L 10 * PCR buffer, 0.5 μ LLA Taq enzyme;
2) reagent B: be 10mL ddH
2O；
3) reagent C: be agarose, 6g;
4) reagent D: 6 * PCR product sample-loading buffer 1mL, its composition is: 30mmol/L EDTA, 36% (V/V) glycerine, 0.05% (W/V) dimethylbenzene green grass or young crops, 0.05% (W/V) tetrabromophenol sulfonphthalein.
5) reagent E: be the Goldview nucleic acid dye, 40 μ L;
6) reagent F: be 50 * TAE damping fluid 10mL, every 1L contains Tutofusin tris 242g, ETDA37.2g, acetic acid 57.1mL.
7) primer series, concentration 10 μ mol/L, each 10 μ L.Sequence is as shown in SEQ ID NO:1 ~ 10;
8) primer is one, 10 μ L, and concentration 10 μ mol/L, its sequence is as shown in SEQ ID NO:11.
Operate by following program:
(1) according to known vibrio alginolyticus E0601 paracholera vibrios transposon valT partial sequence, design Auele Specific Primer VapF1 and VapF2, compound concentration is respectively 1 μ mol/L, 10 μ mol/L.Its sequence is as follows:
VapF1：GTTCTATCCGACCATAGATG(SEQ ID NO：12)；
VapF2：TGGGCTAACCTCGGATAGACAGGATTACT(SEQ ID NO：13)；
(2) template DNA extracts: the simplest water-boiling method carries out.Get incubated overnight vibrio alginolyticus E06011mL, 5000g is centrifugal, and 5min gets precipitation, adds 100 μ L ddH
2O, 100 ℃ of water-bath 10min, the centrifugal 5min of 10000g gets supernatant and is template DNA;
(3) get 10 PCR reaction tubess, add respectively DNA profiling each 1 μ L, 18.75 μ L reagent B of reagent A 4.75 μ L, 0.5 μ L primer VapF1, above-mentioned dilution, mixing;
(4) first round long PCR walking reaction conditions: 92 ℃ of denaturation 2min, 92 ℃ of sex change 15s, 58 ℃ of annealing 30s, 68 ℃ are extended 5min, carry out altogether 30 circulations; Then reaction system cools to 4 ~ 12 ℃ and keeps 10min, in the low temperature maintenance period, respectively adds rapidly each 0.5 μ L of primer series (SEQ IDNO:1 ~ 10) in the PCR reaction tubes.After primer adds, skip low temperature and keep step.Carry out a circulation, this circulation comprises again: 84 ℃ of sex change 30s, and 40 ℃ of sex change 2min, 68 ℃ are extended 5min.Last 68 ℃ are extended 8min; Get each 1 μ L of above-mentioned PCR product, add reagent B 10 μ L, become the dilution template;
(5) get 10 PCR reaction tubess, add respectively primer VapF2, primer (SEQ ID NO:11) 0.5 μ L, above-mentioned dilution template 1 μ L, reagent A 4.75 μ L, reagent B 18.25 μ L.Separately get 10 PCR reaction tubess, add primer (SEQ ID NO:11) 1 μ L, above-mentioned dilution template 1 μ L, reagent A 4.75 μ L, reagent B 18.25 μ L, be used separately as the control tube of above-mentioned each experiment tube;
(6) second take turns the long PCR walking program: 92 ℃ of denaturation 2min, and 92 ℃ of sex change 15s, 68 ℃ of sex change are also extended 5min, carry out altogether 30 circulations, and last 68 ℃ are extended 8min;
(7) get second and take turns each 5 μ L of long PCR walking product and control tube PCR product and mix with 1 μ L reagent D, loading 0.7% sepharose (every 100mL gel contains reagent E 2 μ L).Reagent F with 50 times of deionized water dilutions, is used as electrophoretic buffer.Voltage 120V, electrophoresis 30min;
(8) after electrophoresis finishes, ultraviolet imagery.In the glue sample, in all experiment tubes, the PCR product occurs and the absent variable band of corresponding control tube PCR product is the positive PCR step to move fragment.In 10 primer series of this example, primer 1 (SEQ ID NO:1) and 5 (SEQ ID NO:5) have produced respectively the approximately positive fragment of 2.0Kb, 4.0Kb of length, and contrast does not all have the band generation (to see accompanying drawing 2, A, two bands of B.Only show the result that primer 1 ~ 6 produces).To use primer 5 to produce second takes turns PCR step and moves product (being about 4.0Kb) cloning and sequencing, sequencing result proves that it is the correct extension of known array part, second takes turns long PCR walking has obtained to reach the fragment of 3820bp (sequence has been seen the Genbank database, accession number: EU787499), primer 5 and VapF2 all correctly participate in PCR produce should in.This result has confirmed reliability and the validity of method.
According to part Vibrio vulnificus 1.1758rpoB Gene Partial sequence, adopt the nearly full-length gene of long PCR walking amplification rpoB.Press following formulated reagent:
1) reagent A: reaction premix system 300 μ L.Every 11.4 μ L reagent A comprise 2 μ L dNTP (dATP, dTTP, each 10mmol/L of dGTP, dCTP), 4 μ L MgCl
2(25mmol/L), 5 μ L 10 * PCR buffer, 0.4 μ L LATaq enzyme;
2) reagent B: be 20mL ddH
2O；
3) reagent C: be agarose, 10g;
4) reagent D: 6 * PCR product sample-loading buffer 1mL, its composition is: 25mmol/L EDTA, 30% (V/V) glycerine, 0.06% (W/V) dimethylbenzene green grass or young crops, 0.04% (W/V) tetrabromophenol sulfonphthalein;
5) reagent E: be the Goldview nucleic acid dye, 30 μ L;
6) reagent F: be 50 * TAE damping fluid 30mL, every 1L contains Tutofusin tris 242g, ETDA 37.2g, acetic acid 57.1mL;
7) primer series, concentration 15 μ mol/L, each 10 μ L.Sequence is as shown in SEQ ID NO:1 ~ 10;
8) primer is one, 15 μ L, and concentration 15 μ M, its sequence is as shown in SEQ ID NO:11.
Operate by following program:
(1) according to known Vibrio vulnificus 1.1758rpoB Gene Partial sequence, design Auele Specific Primer rpoF1 and rpoF2, compound concentration is respectively 2 μ mol/L, 15 μ mol/L.Its sequence is as follows:
rpoF1：TGGTTTACTCTTATACCGAG(SEQ ID NO：14)；
rpoF2：TATACCGAGAAAAAGCGCATCCGTAAGGA(SEQ ID NO：15)；
(2) template DNA extracts: the simplest water-boiling method carries out.Get incubated overnight Vibrio vulnificus 1.17581mL, 6000g is centrifugal, and 3min gets precipitation, adds 80 μ L ddH
2O, 100 ℃ of water-bath 10min, the centrifugal 4min of 10000g gets supernatant and is template DNA;
(3) get 10 PCR reaction tubess, add respectively reagent A 5.7 μ L, 0.5 μ L primer rpoF1, above-mentioned DNA profiling each 1 μ L, 17.8 μ L reagent B, mixing;
(4) first round long PCR walking reaction conditions: 94 ℃ of denaturation 2min, 94 ℃ of sex change 15s, 60 ℃ of annealing 30s, 68 ℃ are extended 3min, carry out altogether 30 circulations; Then reaction system cools to 12 ℃ and keeps 10min, in the low temperature maintenance period, respectively adds rapidly each 0.5 μ L of primer series (SEQ IDNO:1 ~ 10) in the PCR reaction tubes.After primer adds, skip low temperature and keep step.Carry out a circulation, this circulation comprises again: 86 ℃ of sex change 30s, and 43 ℃ of sex change 2min, 68 ℃ are extended 4min.Last 68 ℃ are extended 8min;
(5) get each 1 μ L of above-mentioned PCR product, add reagent B 15 μ L, become the dilution template;
(6) get 10 PCR reaction tubess, add respectively rpoF2, primer (SEQ ID NO:11) 0.5 μ L, above-mentioned dilution template 1 μ L, reagent A 5.7 μ L, reagent B 17.3 μ L.Separately get 10 PCR reaction tubess, add primer (SEQ ID NO:11) 1 μ L, above-mentioned dilution template 1 μ L, reagent A 5.7 μ L, reagent B 17.3 μ L, be used separately as the control tube of above-mentioned each experiment tube;
(7) second take turns the long PCR walking program: 92 ℃ of denaturation 3min, and 92 ℃ of sex change 20s, 68 ℃ of sex change are also extended 3min, carry out altogether 30 circulations, and last 68 ℃ are extended 8min;
(8) get second and take turns each 3 μ L of long PCR walking product and control tube PCR product and mix with 0.5 μ L reagent D, loading 0.8% sepharose (every 100mL gel contains reagent E 2 μ L).Reagent F with 50 times of deionized water dilutions, is used as electrophoretic buffer.Voltage 100V, electrophoresis 30min;
(9) after electrophoresis finishes, ultraviolet imagery.In the glue sample, in all experiment tubes, the PCR product occurs and the absent variable band of corresponding control tube PCR product is the positive PCR step to move fragment.In 10 primer series of this example, primer 10 (SEQ ID NO:10) has produced the approximately positive fragment of 0.9Kb, 3.0Kb and 4.0Kb of length, and contrast and other primer all do not have the band generation (to see accompanying drawing 3, A, B, three bands of C only show the result that primer 10 produces).To use primer 10 to produce second takes turns PCR step and moves product (being about respectively 0.9Kb, 3.0Kb, 4.0Kb) cloning and sequencing, sequencing result proof three is the correct extension of known array part, primer 10 and VapF2 all correctly participate in PCR produce should in, and primer 10 has 3 binding sites in this example PCR expanded range.This result has confirmed reliability and the validity of method again.
A kind of long PCR walking kit and using method thereof and application sequence table SEQUENCE LISTING
＜110〉Chinese Academy of Science Nanhai Ocean Research Institute
＜120〉a kind of long PCR walking kit and using method thereof and application
<130>
<160>15
<170>PatentIn version 3.2
<210>1
<211>40
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
<222>(30)..(33)
<223>n is a，c，g，or t
<400>1
tagtcatgcc atgtcagttc tagcatctgn nnnctgctga 40
<210>2
<211>40
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
<222>(30)..(33)
<223>n is a，c，g，or t
<400>2
tagtcatgcc atgtcagttc tagcatctgn nnngacgact 40
<210>3
<211>40
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
<222>(30)..(33)
<223>n is a，c，g，or t
<400>3
tagtcatgcc atgtcagttc tagcatctgn nnncagcagt 40
<210>4
<211>40
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
<222>(30)..(33)
<223>n is a，c，g，or t
<400>4
tagtcatgcc atgtcagttc tagcatctgn nnngtcgtca 40
<210>5
<211>40
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
<222>(30)..(33)
<223>n is a，c，g，or t
<400>5
tagtcatgcc atgtcagttc tagcatctgn nnngctctca 40
<210>6
<211>40
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
<222>(30)..(33)
<223>n is a，c，g，or t
<400>6
tagtcatgcc atgtcagttc tagcatctgn nnnggatcca 40
<210>7
<211>40
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
<222>(30)..(33)
<223>n is a，c，g，or t
<400>7
tagtcatgcc atgtcagttc tagcatctgn nnnggtacca 40
<210>8
<211>40
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
<222>(30)..(33)
<223>n is a，c，g，or t
<400>8
tagtcatgcc atgtcagttc tagcatctgn nnngactcta 40
<210>9
<211>40
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
<222>(30)..(33)
<223>n is a，c，g，or t
<400>9
tagtcatgcc atgtcagttc tagcatctgn nnnacgcgta 40
<210>10
<211>40
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
<222>(30)..(33)
<223>n is a，c，g，or t
<400>10
tagtcatgcc atgtcagttc tagcatctgn nnngtgcaca 40
<210>11
<211>29
<212>DNA
＜213〉artificial sequence
<400>11
tagtcatgcc atgtcagttc tagcatctg 29
<210>12
<211>20
<212>DNA
＜213〉artificial sequence
<400>12
gttctatccg accatagatg 20
<210>13
<211>29
<212>DNA
＜213〉artificial sequence
<400>13
tgggctaacc tcggatagac aggattact 29
<210>14
<211>20
<212>DNA
＜213〉artificial sequence
<400>14
tggtttactc ttataccgag 20
<210>15
<211>29
<212>DNA
＜213〉artificial sequence
<400>15
tataccgaga aaaagcgcat ccgtaagga 29
Claims (7)
1. long PCR walking kit is characterized in that comprising: (1) reagent A: wherein, comprise the dNTP1 of 10mmol/L ~ 3 μ L in every 9.25 ~ 12.5 μ L reagent A, 25mmol/LMgCl
23 ~ 4 μ L, 10 * PCR damping fluid, 5 μ L and LA Taq enzyme 0.25 ~ 0.5 μ L; (2) reagent B:ddH
2O5 ~ 20mL; (3) reagent C: agarose 5 ~ 20g; (4) reagent D: 6 * PCR sample-loading buffer, 1 ~ 5 mL; (5) reagent E: nucleic acid dye 20 ~ 100 μ L; (6) reagent F:50 * electrophoretic buffer 10 ~ 20 mL; (7) primer is 11, sequence as shown in SEQ ID NO:1 ~ 11, every each 10 ~ 50 μ L;
Long 39 ~ 40 bases in described primer SEQ ID NO:1 ~ 10, its 5 ' end comprises 29 fixedly bases, and 3 ' end comprises the base of 6 ~ 7 Random Designs, and GC 〉=50%, region intermediate are the base NNNN of 4 complete degeneracys.
2. long PCR walking kit according to claim 1, the composition that it is characterized in that described 6 * PCR sample-loading buffer is: EDTA20 ~ 30mmol/L, glycerine 30 ~ 40 volume %, dimethylbenzene green grass or young crops 0.0004 ~ 0.0008g/ml and tetrabromophenol sulfonphthalein 0.0004 ~ 0.0006g/ml.
3. long PCR walking kit according to claim 1, is characterized in that containing Tutofusin tris 242g in every 1L 50 * electrophoretic buffer EDTA37.2g, acetic acid 57.1mL.
4. the using method of long PCR walking kit claimed in claim 3, is characterized in that described method comprises the steps:
(1) DNA extraction;
(2) first round long PCR walking: according to the known DNA sequence dna design upstream primer P complementary with it, long 18 ~ 22bp, concentration is 1 ~ 2 μ mol/L, when reaction system is 25 μ L, add reagent A 4.2 ~ 6.25 μ L, upstream primer P0.5 ~ 1.0 μ L, DNA profiling 0.5 ~ 2.0 μ L, surplus is reagent B;
(3) first round long PCR walking amplification program: 92 ~ 94 ℃ of denaturation 2 ~ 5min, 92 ~ 94 ℃ of sex change 15 ~ 30s, 56 ~ 60 ℃ of annealing 30 ~ 60s, 68 ~ 72 ℃ are extended 3 ~ 10min, after carrying out altogether 30 circulations, reaction system are cooled to 4 ~ 12 ℃, keep 5 ~ 30min, in maintenance period, add rapidly each 0.5 ~ 1.0 μ L of primer, primer sequence is as shown in SEQ ID NO:1 ~ 10; Carry out a circulation after adding primer, this cycling program is again: 80 ~ 86 ℃ of sex change 15 ~ 40s, and 36 ~ 43 ℃ of sex change 1 ~ 3min, 68 ~ 72 ℃ are extended 3 ~ 10min, and 68 ~ 72 ℃ are extended 5 ~ 8min; Gained PCR product is got 1 μ L, adds reagent B, dilutes 10 ~ 30 times, as the second DNA profiling of taking turns long PCR;
(4) second take turns long PCR walking: according to the known DNA sequence dna design upstream primer Q complementary with it, long 26 ~ 29bp, concentration is 10 ~ 20 μ mol/L, when reaction system is 25 μ L, add reagent A 4.2 ~ 6.25 μ L, upstream primer Q0.5 ~ 1.0 μ L, primer 0.5 ~ 1.0 μ L of sequence as shown in SEQ ID NO:11, DNA profiling 0.5 ~ 2 μ L that step (3) dilution obtains, surplus is reagent B; In PCR reaction control group, add reagent A 4.2 ~ 6.25 μ L, primer 0.5 ~ 1.0 μ L of sequence as shown in SEQ ID NO:11, DNA profiling 0.5 ~ 2 μ L that step (3) dilution obtains, surplus is reagent B;
(5) second take turns the long PCR walking amplification program: 92 ~ 94 ℃ of denaturation 2 ~ 5min, and 92 ~ 94 ℃ of sex change 15 ~ 30s, 68 ℃ of sex change are also extended 3 ~ 10min, totally 30 circulations, last 68 ℃ are extended 5 ~ 8min;
(6) the PCR step is moved the product detection: get second and take turns long PCR walking product and each 3 ~ 5 μ L of control group PCR product, add 0.5 ~ 1 μ L reagent D to mix, the loading sepharose is used as electrophoretic buffer with reagent F with 50 times of deionized water dilutions, voltage 100 ~ 140V, electrophoresis 20 ~ 40min; Ultraviolet imagery after electrophoresis finishes, in the glue sample, experimental group occur and in control group absent variable band be the positive PCR step to move fragment.
5. the using method of long PCR walking kit according to claim 4, is characterized in that in step (6), and every 100mL sepharose contains reagent E 1 ~ 5 μ L.
6. the using method of according to claim 4 or 5 described long PCR walking kits is characterized in that described in step (6), the positive PCR step is moved fragment and is used for the order-checking of downstream PCR product or cloning and sequencing.
7. the application of the described long PCR walking kit of any one claim in claim 1 ~ 3 is characterized in that described long PCR walking kit is used for the unknown nucleotide sequence of clone's known dna fragment flank.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200910214350 CN101812494B (en) | 2009-12-29 | 2009-12-29 | Long PCR walking kit and using method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200910214350 CN101812494B (en) | 2009-12-29 | 2009-12-29 | Long PCR walking kit and using method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101812494A CN101812494A (en) | 2010-08-25 |
| CN101812494B true CN101812494B (en) | 2013-06-19 |
Family
ID=42619861
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200910214350 Expired - Fee Related CN101812494B (en) | 2009-12-29 | 2009-12-29 | Long PCR walking kit and using method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101812494B (en) |
Families Citing this family (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102732517B (en) * | 2012-07-19 | 2013-09-04 | 光明乳业股份有限公司 | PCR (polymerase chain reaction) walking technology and kit used in same |
| CN103397028B (en) * | 2012-07-19 | 2014-12-24 | 光明乳业股份有限公司 | Semi-random primer based on PCR walking technology, and kit thereof |
| CN103397029B (en) * | 2012-07-19 | 2015-01-14 | 光明乳业股份有限公司 | PCR walking method, and primer and kit thereof |
| CN102757960B (en) * | 2012-07-30 | 2014-01-08 | 光明乳业股份有限公司 | Semi-random polymerase chain reaction (PCR) technique for amplifying unknown sequence and primer and kit used for technique |
| CN104963000B (en) * | 2014-12-15 | 2021-04-06 | 杭州贝瑞和康基因诊断技术有限公司 | Method and kit for rapidly constructing single-cell DNA sequencing library |
| CN106282173B (en) * | 2015-05-27 | 2019-07-09 | 中国农业科学院生物技术研究所 | In cloned, transgenic biology at exogenous origin gene integrator site flanking sequence method |
| CN107385065B (en) * | 2017-08-16 | 2020-07-28 | 北京东方亚美基因科技研究院有限公司 | Method for amplifying nucleic acid and use thereof |
| CN110320258B (en) * | 2019-07-04 | 2021-05-25 | 青岛科技大学 | Method for detecting nucleic acid molecules based on cyclic amplification and cation exchange |
| CN111808977B (en) * | 2020-07-23 | 2023-06-27 | 清华大学深圳国际研究生院 | Design method and detection method of specific primers of resistance genes of rifampicin antibiotics caused by SNP |
-
2009
- 2009-12-29 CN CN 200910214350 patent/CN101812494B/en not_active Expired - Fee Related
Non-Patent Citations (6)
| Title |
|---|
| Efficient amplification of multiple transposon-flanking sequences;Kwon Y M;《JOURNAL OF MICROBIOL METHODS》;20001231;第41卷;195-199 * |
| GENETIC APPLICATIONS OF AN INVERSE POLYMERSASE CHAIN REACTION;OCHMAN H;《GENETICS》;19881231;第12卷;621-623 * |
| high-efficiency thermal asymmetric interlaced PCR for amplificaton of unknown flanking sequences;liu y g;《biotechniques》;20071231;第43卷;649-656 * |
| Kwon Y M.Efficient amplification of multiple transposon-flanking sequences.《JOURNAL OF MICROBIOL METHODS》.2000,第41卷195-199. |
| liu y g.high-efficiency thermal asymmetric interlaced PCR for amplificaton of unknown flanking sequences.《biotechniques》.2007,第43卷649-656. |
| OCHMAN H.GENETIC APPLICATIONS OF AN INVERSE POLYMERSASE CHAIN REACTION.《GENETICS》.1988,第12卷621-623. |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101812494A (en) | 2010-08-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101812494B (en) | Long PCR walking kit and using method and application thereof | |
| CN105821075A (en) | Establishment method of caffeine synthetase CRISPR/Cas9 genome editing vector | |
| CN102732517B (en) | PCR (polymerase chain reaction) walking technology and kit used in same | |
| CN103725674A (en) | Method for synthesizing DNA fragments and assembling synthetic genes in Escherichia coli through one-step method | |
| CN106191214A (en) | A kind of multicolor fluorescence melting curve PCR detection method | |
| CN110951911B (en) | Tilia EST-SSR primer based on transcriptome as well as screening method and application thereof | |
| CN104178566A (en) | Multiplex fluorescence PCR (polymerase chain reaction) universal adapter for microsatellite detection, and detection method and application thereof | |
| CN104531675A (en) | Method for in-vitro synthesis and activity detection on gRNA | |
| CN108588091A (en) | A kind of okra reference gene and its application | |
| CN103397028B (en) | Semi-random primer based on PCR walking technology, and kit thereof | |
| CN111662970B (en) | Three-generation library-building sequencing method for full-length amplification of BCR immune repertoire | |
| CN106755418B (en) | Exon assembly sequencing method | |
| CN107385516A (en) | The method in the RACE seq libraries of pri miRNA 3 ' in one kind structure plant | |
| CN103397029B (en) | PCR walking method, and primer and kit thereof | |
| CN108728569A (en) | A kind of okra reference gene and its application | |
| CN113186327B (en) | Identification method of microsatellite DNA marker fingerprint of flammulina velutipes FC89 strain, construction method and application thereof | |
| CN113817803B (en) | Library construction method for small RNA carrying modification and application thereof | |
| CN107760796A (en) | A kind of SSR molecular marker primer of Rapid identification locust tree polyploid | |
| CN104450675A (en) | Method for acquiring flanking sequence from genome DNA | |
| CN112795690A (en) | Identification method of SSR (simple sequence repeat) marker fingerprint of flammulina velutipes J3931 strain as well as construction method and application of identification method | |
| CN102943100B (en) | Efficient method for synthesizing cDNA from RNA through reverse transcription | |
| CN102643933B (en) | Loop mediated isothermal amplification kit for detecting I-type duck hepatitis viruses and application thereof | |
| CN102559660A (en) | Method for preparing double-stranded deoxyribonucleic acid (DNA) molecule with protruding end | |
| CN116751842A (en) | Method for identifying insertion site of transgenic element | |
| CN117187351A (en) | 5' -flap nuclease and stem-loop aptamer structure-mediated isothermal amplification method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130619 Termination date: 20211229 |