CN107829145A - A kind of method for building mouse TCRalphaCDR3 areas library - Google Patents
A kind of method for building mouse TCRalphaCDR3 areas library Download PDFInfo
- Publication number
- CN107829145A CN107829145A CN201710984518.7A CN201710984518A CN107829145A CN 107829145 A CN107829145 A CN 107829145A CN 201710984518 A CN201710984518 A CN 201710984518A CN 107829145 A CN107829145 A CN 107829145A
- Authority
- CN
- China
- Prior art keywords
- seq
- tcr alpha
- sequence
- primer
- cdr3 areas
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1093—General methods of preparing gene libraries, not provided for in other subgroups
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
- C40B50/06—Biochemical methods, e.g. using enzymes or whole viable microorganisms
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Crystallography & Structural Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Computational Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a kind of method of structure mouse TCR alpha CDR3 areas sequencing library, key step includes：(1) rat tissue or whole blood total serum IgE are extracted.(2) reverse transcription RNA is cDNA, and joint sequence is connected into long-chain cDNA ends, and the TCR alpha in CDR3 areas are included by general C-terminal primer and the amplification of joint sequence primer.(3) TCR alpha are interrupted by Tn5 transposases and is enriched with CDR3 region sequences.(4) it is sequenced by illumina high-flux sequence platforms.This method is applied to the tissue containing all kinds of T cells, and body fluid equal samples builds storehouse；Using 5 ' RACE technologies, efficiently agonic mouse TCR alpha can be expanded, overcome the template copy numbers caused by multiplexed PCR amplification and the problems such as amplification efficiency is difficult to control, and product shifts；DNA can be interrupted to connect the function of synchronously completing with joint and fast and accurately enrichment can be carried out to TCR alpha hypervariable region (CDR3 areas) using specific primer using Tn5 enzymes and build storehouse, make sequencing more targeted, facilitate data analysis, save sequencing cost.
Description
Technical field
The invention belongs to biological technical field, and in particular to a kind of efficiently zero deflection structure mouse TCR alpha CDR3
The required primer and library preparation method of area's high-throughput sequencing library.
Background technology
Lymphocyte identifies specific antigen to play immunologic function by its surface antibody.It is to the special of antigen recognizing
Property is embodied in clonal level, i.e., the lymphocyte of same clone can be identified with identical antigen receptor, identify same antigen table
Position.T cell antigen acceptor (TCR) is T cell specific recognition and the structure for combining Antigenic Peptide-MHC molecules, and φt cell receptor is different
Source dimer, it is made up of two different subunits.The acceptor of 95% T cell is made up of α subunits and β subunits, and in addition 5%
Acceptor is made up of γ subunits and δ subunits, and it changes than regular meeting because of ontogeny or disease.
TRA is the locus for encoding TCR alpha, and it includes 3 variable field (V), linkage section (J) and constant region (C) bases
Because, and V, J, C are divided into some allele again, producer restructuring in TRA locus in T cell growth course, are TCR
Alpha diversity provides molecular basis, additionally by the radom insertion and missing of the base in genetic recombination location proximate
Etc. mechanism, multifarious TCR is finally generated, to meet that body identifies the needs of diversified antigen.
TCR C areas connect the end of transmembrane region and intracellular close to cell membrane, and to be responsible for Recognition polypeptide/MHC compound in V areas
Body.The variable region of each subunit includes three highly variable complementary determining region (complementarity
Determining regions, CDR), most important CDR3 is responsible for directly being combined with the polypeptide that MHC is presented, and sequence is high
Spend variable, therefore TCR diversity is mainly determined by CDR3.With the development of high-throughput techniques, to whole T cell colony TCR's
CDR3 areas carry out large-scale parallel sequencing and have been possibly realized, and by the way that TCR alpha CDR3 areas are sequenced, can evaluate and exempt from
The parameter such as TCR alpha diversity in epidemic disease group storehouse, it can further analyze the response mechanism and process of immune system.
In view of traditional amplification CDR3 areas need multiplex PCR to be expanded, template copy numbers and expansion in amplification procedure be present
Increasing Efficiency is difficult to control, and product shifts, it is impossible to reacts the problems such as initial TCR of sample is distributed；Meanwhile a variety of primer amplification meetings
Increase mispairing and interfere, cause to expand the problems such as background is high, and repeatability is poor, ultimately resulting in sequencing result can not be truly anti-
Reflect sample situation.The present invention uses 5 ' RACE technologies preferably to avoid the amplification skew built during storehouse, can be agonic to small
Mouse TCR alpha storehouses.DNA can be interrupted using Tn5 enzymes and the function of synchronously completing and the specific primer of use are connected with joint
Fast enriching can be carried out to TCR alpha hypervariable region (CDR3 areas) and build storehouse, realized to φt cell receptor storehouse in sample
Accurate detection, by sequence label, sequencing sample number can be increased, sequencing cost is reduced, all kinds of tissues containing T cell can be applied
The φt cell receptor storehouse analysis of sample, it is significant to understanding immunologic mechanism and announcement disease development mechanism.
The content of the invention
The purpose of the present invention is to establish a kind of efficiently agonic structure mouse TCR alpha CDR3 areas high-flux sequence
The method in library.
The side in 5 ' the RACE combination Tn5 transposase technique construction mouse TCR alpha CDR3 areas libraries based on high-flux sequence
Method is carried out as follows：
1) rat tissue or whole blood total serum IgE are extracted.
2) using the RNA of step 1) extraction as template, cDNA is synthesized by primer reverse transcription of SEQ ID NO.1, in reverse transcription
SEQ ID NO.4 are connected to cDNA 3 ' ends under enzyme effect.
3) heminested PCR specific amplification TCR alpha fragments are used：Entered using SEQ ID NO.2 and SEQ ID NO.5
Row first round PCR；The second wheel PCR is carried out using SEQ ID NO.3 and SEQ ID NO.5；Wherein SEQ ID NO.5 are as general
Primer, SEQ ID NO.3 are the C-terminal sequence in TCR alpha, and carry sequence measuring joints.
4) PCR primer is taken turns using magnetic beads for purifying second；Storehouse kit progress DNA is built using Tn5 to interrupt, and uses SEQ ID
NO.6 carries out sequence measuring joints with SEQ ID NO.7 and is connected, and builds storehouse, Quality Control.
5) library is sequenced for illumina high-flux sequences platform.
Sequence table
Wherein, rG represents monodeoxy guanine (riboguanosine) in upper table SEQ ID NO.4 sequence, and+G is represented
Lock the guanine (LNA) of nucleotide modification.
Beneficial effect：
The present invention relates to a kind of 5 ' RACE combination Tn5 transposase technique construction mouse TCR alpha based on high-flux sequence
The method in CDR3 areas library.The invention discloses by 5 ' RACE technique to high-efficiency, agonic amplification mouse TCR alpha's
Full length sequence, the quick primer and library preparation method of building place need for interrupting enrichment CDR3 areas is carried out using Tn5 enzymes, is realized
Accurate detection to φt cell receptor storehouse in sample, the φt cell receptor storehouse of all kinds of tissue samples containing T cell can be applied to analyze, it is right
Understand immunologic mechanism and announcement disease development mechanism is significant.
Brief description of the drawings：
In order that the purpose of the present invention, technical scheme and beneficial effect are clearer, the present invention provides drawings described below：
Fig. 1 TCR alpha libraries figure；
Statistical results chart is sequenced in Fig. 2 TCR alpha libraries.
Embodiment
Embodiment
Below in conjunction with embodiment, the present invention is described in further detail：
The side in 5 ' the RACE combination Tn5 transposase technique construction mouse TCR alpha CDR3 areas libraries based on high-flux sequence
Method, comprise the following steps：
Total serum IgE in step 1 extraction rat tissue
Total serum IgE in rat tissue/whole blood is extracted using Trizol methods (Roche, Tripure Isolation Reagent)
Extracting method, comprise the following steps：Homogenised tissue/whole blood is blown and beaten after adding Trizol, is stored at room temperature 5min, is directly extracted
RNA is put into -80 DEG C of refrigerators and frozen, and adds 200ul chloroforms/ml Trizol, overturns and mixes 30s, and room temperature places 3min.4 DEG C,
12000g centrifuges 15min.Upper strata aqueous phase is drawn as far as possible to manage to another EP, is careful not to be drawn onto intermediate layer.By 0.5ml isopropyls
Alcohol/ml Trizol add isopropanol, overturn and mix, and room temperature places 10min.4 DEG C, 12000g centrifugations 10min.By 1ml75% second
Alcohol/ml Trizol add the ethanol that volume ratio is 75%, and gentle concussion, suspend precipitation.4 DEG C, 8000g centrifugations 5min.Suck
Supernatant.Room temperature dries 5-10min.With suitable volumes RNA is dissolved without RNase water.
The RNA extracted is shown using nanodrop one ultramicron ultraviolet specrophotometer measure concentration, testing result
Show, OD260/280 is between 1.8-2.0.The RNA extracted is utilized into agarose gel electrophoresis test strip integrality.Detection
As a result show, 28S and 18S bands are obvious, and 5S band unobvious, 28S/18S is 2.0 or so.
Above-mentioned testing result shows that the 1 RNA mass extracted meets requirement for construction data base, and storehouse is continued after can be used in.2 reverse
Record and template switch：
The total serum IgE sample that step 1 is obtained carries out reverse transcription using SmartScribe Reverse Transcriptase
It is inverse, system specific as follows:Total serum IgE 0.2-2ng, concentration be 10uM reverse transcriptase primer C1 (5 '-
CATGTCCAGCACAGTTTTGTCAGT-3 ', (SEQ ID NO.1)) 1ul, no RNase water is added to 12ul, of short duration centrifugation,
72 degree of incubation 3min in PCR instrument, rapidly 5min on ice.5X first strand buffer 4ul, dNTPs 2ul are added,
DTT 0.5ul, RNA Inhibitor 0.5ul, SmartScribe Reverse Transcriptase 2ul, concentration are
10uM TSO (5 '-ACACTCTTTCCCTACACGACGCrGrG+G-3 ', (SEQ ID NO.4)) 1ul, adds water to 20ul, short
Temporarily centrifuge, 42 DEG C are incubated 90min, 70 DEG C of 10min, 4 DEG C of holdings in PCR instrument.
3 first round PCR react:
KAPA HiFi HotStart ReadyMix (2X are used using the product obtained by step 2；KAPA
Biosystems, KK2601) carry out nest-type PRC the first round PCR amplification, by following system prepare 1st PCR systems： 2X
KAPA HiFi HotStart ReadyMix 12.5ul, concentration are 1uM SP (5 '-ACACTCTTTCCCTACACGACGC-
3 ', (SEQ ID NO.5)) 0.5ul, concentration is 10uM C2 (5 '-GCACATTGATTTGGGAGTC-3 ', (SEQ ID
NO.2)) 0.5ul, cDNA 1ul, moisturizing to 25ul, PCR reaction conditions are：98 DEG C of pre-degeneration 3mi n；98 DEG C denaturation 20s, 67
DEG C annealing 15s, 72 DEG C extension 6mi n, circulate 15 times；72 DEG C of extension 5mi n.
4 second wheel PCR reactions:
KAPA HiFi HotStart ReadyMix (2X are used using the product obtained by step 3；KAPA
Biosystems, KK2601) carry out nest-type PRC second wheel PCR amplification, by following system prepare 2nd PCR systems：2X
KAPA HiFi HotStart ReadyMix 25ul, concentration are 10uM SP (5 '-ACACTCTTTCCCTACACGACGC-
3 ', (SEQ ID NO.5)) 2ul, C3 that concentration is 10uM (5 '-
GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTTTAACTGGTACACAGCAGGT- 3 ', (SEQ ID NO.3)) 2ul,
First round PCR primer 2ul, moisturizing to 50ul, PCR reaction conditions are：98 DEG C of pre-degeneration 3min；98 DEG C of denaturation 20s, 67 DEG C are moved back
Fiery 15s, 72 DEG C of extension 6min, is circulated 20 times；72 DEG C of extension 5min.
5 Tn5 enzymes build storehouse：
After above-mentioned steps 4PCR reactions terminate, DNA purifying, specific step are carried out using AMPure XP magnetic beads
It is rapid as follows：Magnetic bead is taken out from refrigerator, recovered to room temperature.Prepare the ethanol that fresh volume ratio is 80%.Draw 50ul
Beads is added in 50ul 2nd PCR primers, is well mixed, and is incubated at room temperature 5min.It is placed in magnetic frame up to liquid and becomes clarification
(about 2min), supernatant is absorbed with pipettor.Freshly prepd 80% ethanol of 200ul is added in sample, 30s on magnetic frame, inhaled
Except supernatant.Repeat previous step.About 10min is air-dried on magnetic frame, EP pipes are removed from magnetic frame, adds 30ul water elution magnetic beads
On DNA, room temperature 2min.EP pipes are become into clarification (about 2min) from magnetic frame up to liquid, supernatant to another EP pipes is drawn and produces
The PCR primer of purifying.
PCR primer after purification is used TruePrep DNA Library PrepKit V2for Illumina's
Tn5 enzymes are carried out building storehouse, and DNA is quantified using the fluorescence photometers of Qubit 2.0, are taken 1ng products to carry out Tn5 transposases and are built storehouse.Tool
Gymnastics is made to carry out by kit specification：5 × TTBL of thaw at RT, it is standby after mixing of turning upside down；Confirm whether 5 × TS is in
Room temperature, and flick tube wall and confirm whether there is precipitation；If any precipitation, simultaneously vortex oscillation fully mixes for 37 DEG C of heating, and precipitation can dissolve.
Reaction system is formulated as follows in PCR pipe：5 × TTBL 4ul, 1ng DNA, TTE Mix V1 5ul, moisturizing to 20ul, gently
20 times are blown and beaten to mix to abundant.It is placed in PCR instrument, 55 degree of 10min；10 degree, keep.Add immediately into product after the completion of reaction
Enter 5ul 5x TS, gently piping and druming is abundant, room temperature 5min.Following component is added in above-mentioned system：5 × TAB10ul, PPM
5ul, TAE 1ul, concentration are 10uM IP5
(5’-AATGATACGGCGACCACCGAGATCTACAC[ACGTCCTG]TCGTCGGCA
GCGTCAGATGTGTATAAGAGACAG-3 ', (SEQ ID NO.6)) 5ul, concentration is 10uM IP7
(5’-CAAGCAGAAGACGGCATACGAGAT[TCGCCTTA]GTGACTGGAGTTCA
GACGTGTGCTCTTCCGATCT-3 ', (SEQ ID NO.7)) 5ul, cumulative volume 50ul.Reaction condition is：105 DEG C, heat lid；72
DEG C, 3min；98 DEG C, 30s；98 DEG C, 15s, 60 DEG C, 30s, 72 DEG C, 3min, 10-15 circulation；72 DEG C, 5min；4 DEG C, keep.
Wherein [ACGTCCTG] and [TCGCCTTA] is sequence label, including but not limited to illumia sequencing label
Sequence, the sequence in [] can be the 8bp that can distinguish different samples of any empirical tests short sequence.
After above-mentioned PCR reactions terminate, library fragments selection purifying is carried out using VAHTS DNA Clean Beads, specifically
Step is as follows：VAHTS DNA Clean Beads are balanced to room temperature and are fully vortexed.It is 80% to prepare fresh volume ratio
Ethanol.Take 30ul magnetic beads to be added in 50ulPCR products, fully mix, be stored at room temperature 5min.Magnetic frame up to liquid is placed in become
Clarify (about 5min).Supernatant is drawn with pipettor to manage to another EP, is added 7.5ul magnetic beads and is fully mixed, is stored at room temperature 5min.
It is placed in magnetic frame up to liquid and becomes clarification (about 5min), absorbs supernatant.Freshly prepd 80% ethanol of 200ul is added to sample
In, 30s on magnetic frame, absorb supernatant.Repeat step 5.6.About 10min is air-dried on magnetic frame, EP pipes are taken from magnetic frame
Under, the DNA, room temperature 2min that add on 20ul water elution magnetic beads.EP pipes are become into clarification (about 2min) from magnetic frame up to liquid,
Draw supernatant to manage to another EP, -20 degree preserve.
After library purifying terminates, the purity and size in the analyzing biochips system detectio library of Agilent 2100, inspection are utilized
It is as shown in Figure 1 to survey result：Fragment is distributed between 300bp-550bp, average length 400bp, Insert Fragment average length
280bp.The library of gained is sequenced by the platforms of illumina Nextseq 500, passes through bioinformatic analysis high pass
Measure sequencing result.
Above is embodiment is merely to illustrate description of the invention and non-limiting, it is formal and thin based on inventive concept
The various changes made on section, without departing from claims of the present invention limited range.
Claims (8)
- A kind of 1. method for building mouse TCR alpha CDR3 areas library, it is characterised in that：(1) mouse tissue or whole blood total serum IgE are extracted；(2) using RNA as template, SEQ ID NO.1 are that primer reverse transcription synthesizes cDNA, by SEQ ID under reverse transcriptase effect NO.4 is connected to cDNA 3 ' ends；(3) heminested PCR specific amplification TCR alpha fragments are used：Carried out using SEQ ID NO.2 and SEQ ID NO.5 First round PCR；The second wheel PCR is carried out using SEQ ID NO.3 and SEQ ID NO.5；Wherein SEQ ID NO.5 draw as general Thing, SEQ ID NO.3 are the C-terminal sequence in TCR alpha, and carry sequence measuring joints；(4) PCR primer is taken turns using magnetic beads for purifying second；Storehouse kit progress DNA is built using Tn5 to interrupt, and uses SEQ ID NO.6 Sequence measuring joints are carried out with SEQ ID NO.7 to be connected, and build storehouse；(5) library is sequenced for illumina high-flux sequences platform.
- A kind of 2. method for building mouse TCR alpha CDR3 areas library according to claim 1, it is characterised in that：Step (1) sample is fresh or frozen tissue and whole blood sample containing T cell.
- A kind of 3. method for building mouse TCR alpha CDR3 areas library according to claim 1, it is characterised in that：Step (2) reverse transcriptase used in is SmartScribe Reverse Transcriptase, Maxima H Minus Reverse Transcriptase, Superscript IIreverse transcriptase or Superscript III reverse Transcriptase one kind；SEQ ID NO.1 are TCR alpha C-terminal specific reverse transcriptase primer；SEQ ID NO.4 are One kind is used for the anchor primer TSO of the efficient ends of rapid amplifying cDNA 5 ', including 3 birds of one section of joint sequence and 5 ' ends Purine, wherein preceding 2 guanines are monodeoxy guanine, the 3rd guanine is lock nucleotide modification guanine, and joint sequence comes Come from the sequence fragment of illumina platforms, reverse transcription condition：42 DEG C, 90min；70 DEG C, 10min.
- A kind of 4. method for building mouse TCR alpha CDR3 areas library according to claim 1, it is characterised in that：Step (3) primer SEQ ID NO.2 used in is in the primer of the end indoor design of first round PCR primer 3 ', SEQ ID NO.5 conducts Universal joint, sequence are consistent with SEQ ID NO.4 joint sequence.
- A kind of 5. method for building mouse TCR alpha CDR3 areas library according to claim 1, it is characterised in that：Step (4) magnetic bead used in is Beckman Agencourt AMPure XP magnetic beads, and product is with magnetic bead volume ratio in 0.8-1:1；Make Impurity is washed with the ethanol of volume ratio 80%.
- A kind of 6. method for building mouse TCR alpha CDR3 areas library according to claim 1, it is characterised in that：Step (4) the Tn5 enzymes used in build storehouse kit and only praise TruePrep DNA Library PrepKit V2 for for promise Illumina, wherein DNA fragmentation time are：105 DEG C, heat lid；55 DEG C, 10min；10 DEG C, terminating reaction is taken out at once.Joint Connection uses SEQ ID NO.6 and SEQ ID NO.7 primers, and reaction condition is：105 DEG C, heat lid；72 DEG C, 3min；98 DEG C, 30s；98 DEG C, 15s, 60 DEG C, 30s, 72 DEG C, 3min, 10-15 circulation；72 DEG C, 5min；4 DEG C, keep；Product purification uses VAHTS DNA Clean Beads, using 2 magnetic beads for purifying, library fragments are distributed between 300bp-550bp, average length 400bp, covering TCR alpha CDR3 areas.
- A kind of 7. method for building mouse TCR alpha CDR3 areas library according to claim 1, it is characterised in that：It is described Sequence measuring joints are the sequence measuring joints for illumina microarray datasets, and sequence label is the 8 bp length that can distinguish different samples Short sequence.
- 8. the method in mouse TCR alpha CDR3 areas library is built according to claim 1, it is characterised in that：Step (5) The middle illumina microarray datasets used include Hiseq4000, X-10, Nextseq500 platforms.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710984518.7A CN107829145A (en) | 2017-10-20 | 2017-10-20 | A kind of method for building mouse TCRalphaCDR3 areas library |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710984518.7A CN107829145A (en) | 2017-10-20 | 2017-10-20 | A kind of method for building mouse TCRalphaCDR3 areas library |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107829145A true CN107829145A (en) | 2018-03-23 |
Family
ID=61648687
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710984518.7A Pending CN107829145A (en) | 2017-10-20 | 2017-10-20 | A kind of method for building mouse TCRalphaCDR3 areas library |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107829145A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111041563A (en) * | 2019-12-31 | 2020-04-21 | 广州精科医学检验所有限公司 | Target sequence capturing and PCR (polymerase chain reaction) library building method |
| CN113684258A (en) * | 2020-05-18 | 2021-11-23 | 上海赛比曼生物科技有限公司 | Kit and method for detecting mouse-derived TCR transgene copy number |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101377021A (en) * | 2008-09-25 | 2009-03-04 | 海南大学 | Method for constructing cDNA library |
| CN106811461A (en) * | 2017-01-20 | 2017-06-09 | 深圳大学 | The method that one kind builds pre miRNA5 ' RACE seq libraries in plant |
| CN106868005A (en) * | 2017-03-17 | 2017-06-20 | 中山大学附属肿瘤医院 | A kind of anchor primer and amplification method for efficient Rapid amplification of cDNA ends |
-
2017
- 2017-10-20 CN CN201710984518.7A patent/CN107829145A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101377021A (en) * | 2008-09-25 | 2009-03-04 | 海南大学 | Method for constructing cDNA library |
| CN106811461A (en) * | 2017-01-20 | 2017-06-09 | 深圳大学 | The method that one kind builds pre miRNA5 ' RACE seq libraries in plant |
| CN106868005A (en) * | 2017-03-17 | 2017-06-20 | 中山大学附属肿瘤医院 | A kind of anchor primer and amplification method for efficient Rapid amplification of cDNA ends |
Non-Patent Citations (3)
| Title |
|---|
| FREEMAN ET AL: "Profiling the T-cell receptor beta-chain repertoire by massively parallel sequencing", 《GENOME RESEARCH》 * |
| PEIPEI LIU: "Characterization of human αβTCR repertoire and discovery of D-D fusion in TCRβ chains", 《PROTEIN CELL》 * |
| ROSATI ET AL: "Overview of methodologies for T-cell receptor repertoire analysis", 《BMC BIOTECHNOLOGY》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111041563A (en) * | 2019-12-31 | 2020-04-21 | 广州精科医学检验所有限公司 | Target sequence capturing and PCR (polymerase chain reaction) library building method |
| CN111041563B (en) * | 2019-12-31 | 2023-07-21 | 广州精科医学检验所有限公司 | Target sequence capturing and PCR library building method |
| CN113684258A (en) * | 2020-05-18 | 2021-11-23 | 上海赛比曼生物科技有限公司 | Kit and method for detecting mouse-derived TCR transgene copy number |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107893068A (en) | A kind of method for building people TCRbetaCDR3 areas library | |
| CN107747134A (en) | A kind of method for building people TCRalphaCDR3 areas library | |
| CN107217095B (en) | Multiple PCR primer set for human paternity test and detection method | |
| DK2725125T3 (en) | HIGH-THROUGHPUT METHYLING DETECTION PROCEDURE | |
| CN108368503A (en) | Method for controlled dn A fragmentations | |
| WO2013056640A1 (en) | A method for preparing a nucleic acid library, its uses and kits | |
| CN111808854B (en) | Balanced joint with molecular bar code and method for quickly constructing transcriptome library | |
| IE72468B1 (en) | Selective amplification of target polynucleotide sequences | |
| Malentacchi et al. | Influence of pre-analytical procedures on genomic DNA integrity in blood samples: the SPIDIA experience | |
| CN106755410A (en) | A kind of method for detecting T cell and B cell immune group storehouse simultaneously based on high-flux sequence | |
| CN106011230A (en) | Primer composition for detecting fragmentized DNA target area and application thereof | |
| CN109593758B (en) | Multiplex primer set and method for constructing human B cell immune repertoire based on high-throughput sequencing by using same | |
| WO2017024991A1 (en) | Swine bcr heavy-chain multiplex pcr primer and application thereof | |
| CN106957906B (en) | Primer combination and kit applied to high-throughput sequencing detection of T cell leukemia minimal residual disease | |
| CN106591477A (en) | Method of using multiple reference gene combinations to study yak embryo gene | |
| CN107829145A (en) | A kind of method for building mouse TCRalphaCDR3 areas library | |
| Kang et al. | The application of single-cell sequencing technology in the diagnosis and treatment of hepatocellular carcinoma | |
| CN106319064A (en) | Multi-PCR-primer and method for constructing human TCRA library on basis of high-throughput sequencing | |
| CN109971843B (en) | Sequencing method of single cell transcriptome | |
| JP7049103B2 (en) | Comprehensive 3'end gene expression analysis method for single cells | |
| CN106567133A (en) | Metatranscriptomics library establishment method | |
| CN107858400A (en) | A kind of method for building mouse TCRbetaCDR3 areas library | |
| CN107058484A (en) | It is a kind of to detect T cell and the primer combination in B cell immune group storehouse and kit simultaneously applied to high-flux sequence | |
| EP3325697B1 (en) | Optimized clinical sample sequencing | |
| Matteau et al. | Precise identification of genome-wide transcription start sites in bacteria by 5′-rapid amplification of cDNA ends (5′-RACE) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |