CN109423468B

CN109423468B - Method for increasing yield of compound and derivative thereof in aromatic amino acid biosynthesis pathway

Info

Publication number: CN109423468B
Application number: CN201710735429.9A
Authority: CN
Inventors: 娄春波; 陶勇; 赵会伟; 季翔宇; 张莎莎; 毛贤军
Original assignee: Institute of Microbiology of CAS
Current assignee: Institute of Microbiology of CAS
Priority date: 2017-08-24
Filing date: 2017-08-24
Publication date: 2022-12-20
Anticipated expiration: 2037-08-24
Also published as: CN109423468A

Abstract

The invention relates to a method for improving the yield of compounds and derivatives thereof in an aromatic amino acid biosynthesis pathway. Specifically, the genetic engineering method is used for weakening or blocking the oxidation stage of the pentose phosphate pathway of engineering bacteria and enhancing the carbon metabolic flow of the shikimic acid pathway and the aromatic amino acid pathway.

Description

Method for increasing yield of compound and derivative thereof in aromatic amino acid biosynthesis pathway

Technical Field

The invention relates to the field of microbial fermentation engineering. More specifically, the invention improves the aromatic amino acid biosynthesis pathway of engineering bacteria, enhances carbon metabolic flow of shikimic acid pathway, and improves the yield of intermediate products, end products and derivatives of the aromatic amino acid biosynthesis pathway.

Background

Natural aromatic amino acids include L-tryptophan, L-phenylalanine, and L-tyrosine. In organisms, aromatic amino acids are usually synthesized via the shikimic acid pathway. As shown in FIG. 1, phosphoenolpyruvate (PEP) and erythrose-4-phosphate (E4P) are firstly condensed to generate 3-deoxy-D-arabinoheptulosonate-7-phosphate (DAHP), and then shikimic acid and chorismate are generated through catalysis. Then, L-phenylalanine, L-tyrosine or L-tryptophan is produced through a different pathway. In the shikimic acid pathway, one of the important metabolic precursors for the production of aromatic amino acids is chorismic acid. Not only is the branched acid involved in the synthesis of aromatic amino acids, it is also a precursor in the synthetic pathway of important organic acids (e.g., salicylic acid and myfuroic acid) or phenylpropanoids (e.g., hydroxycinnamic acids, coumarins, flavonoids, and stilbenes).

In the field of microbial fermentation engineering, various methods have been reported to improve the fermentation process. For example, amino acid fermentation yields are increased by adjusting agitation and oxygen supply, optimizing medium composition, regulating sugar concentration or product concentration in the fermentation broth in real time, or by weakening competitive pathways or reducing intermediate feedback inhibition with traditional mutagenesis screening methods (DE 102008040352A1 and CA2663711 A1). However, due to the long biosynthesis route of aromatic amino acids, the number of control steps, the complexity of the control network and the number of possible critical nodes is large, and the yield of amino acids can only be increased to a limited extent by conventional process modifications (Ikeda M, app. Microbiol. Biotechnol.2006, 69.

Genetic engineering and metabolic engineering methods developed in the last two decades enable the directed optimal design of the self amino acid synthesis pathway of bacteria, remove pathway bottlenecks or metabolic feedback, and adjust the carbon center metabolic pathway to increase the precursor supply; in addition, the method can also enhance the transport of aromatic amino acid out of cells to reduce the accumulation of products in the cells, thereby improving the fermentation yield.

It has been suggested in the art that improvements in the common pathway for aromatic amino acid synthesis can lead to increased production of various compounds or derivatives in the aromatic amino acid synthesis pathway by enhancing carbon metabolic flux through the shikimic acid pathway to increase production of chorismate. For example, ikeda M et al overexpress tktA in C.glutamicum producing tryptophan, increasing the supply of E4P (Ikead M, production of tryptophan by Corynebacterium Glutamicum with the modified fungal phosphate pathway, 1999). Berry A proposed that aroG and TrpEDCBA genes, which removed feedback inhibition, were overexpressed in E.coli, resulting in a glucose saccharic acid conversion rate of over 22% (Berry A, enhancing production of aromatic compounds in Escherichia coli by metabolic engineering, 1996).

However, key precursors of the aromatic amino acid synthetic pathway, PEP and E4P, etc., are from different metabolic pathways: PEP is from the glycolysis (EMP) pathway, while E4P is from the pentose phosphate (PPP, also known as HMP) pathway. Therefore, not only needs to enhance the production of these precursors from different metabolic streams, but also needs to perform flow balancing for the regulation of shikimic acid pathways (CN 104388330A). There remains a further need in the art for optimization of shikimate pathways.

Disclosure of Invention

The invention provides a method for improving the yield of compounds and derivatives in an aromatic amino acid synthesis pathway by modifying an enzyme catalyzing irreversible reaction in an oxidation stage of a pentose phosphate pathway, weakening or blocking the oxidation stage of the pentose phosphate pathway, reducing carbon loss caused by decarboxylation, and increasing carbon center metabolic flux, so that the carbon metabolic flux of shikimic acid is improved.

In a first aspect, the present invention provides a method for increasing production of compounds and derivatives thereof in the aromatic amino acid biosynthetic pathway in a bacterium, said method comprising modifying said bacterium such that expression levels and/or activity of enzymes catalyzing irreversible reactions at the oxidative stage of the pentose phosphate pathway in said bacterium are reduced.

In a second aspect, the present invention provides the use of a bacterium in the fermentative production of a compound in the biosynthetic pathway of aromatic amino acids and derivatives thereof, wherein the bacterium has a reduced expression level and/or activity of an enzyme catalyzing the irreversible reaction at the oxidation stage of the pentose phosphate pathway.

In an embodiment of the invention, the enzyme catalyzing the irreversible reaction in the oxidative stage of the pentose phosphate pathway is glucose-6-phosphate dehydrogenase and/or glucose-6-phosphate dehydrogenase; the compound in the aromatic amino acid biosynthetic pathway and the derivative thereof are selected from any one of the group consisting of: shikimic acid, chorismic acid, anthranilic acid, indole, 5-hydroxytryptophan, violacein, prephenate, L-phenylalanine, phenethyl alcohol, L-dopa, L-tyrosine, cinnamic acid, coumaric acid, caffeic acid, ferulic acid, coumarin, flavonoid, salicylic acid and myfuroic acid.

Drawings

FIG. 1 is a schematic diagram of the key steps of the bacterial aromatic amino acid synthesis pathway. Wherein the double arrow indicates a reversible reaction and the dotted line indicates a multi-step reaction. DAHP: 3-deoxy-D-arabinoheptulosonate-7-phosphate; pts (pts) is as follows: a gene encoding a phosphoenolpyruvate-sugar phosphotransferase system; zwf: a gene encoding glucose-6-phosphate dehydrogenase; gnd: a gene encoding 6-phosphogluconate dehydrogenase; tkt: a gene encoding transketolase; rpe: a gene encoding ribulose-5-phosphate epimerase; rpi: a gene encoding ribose-5-phosphate isomerase; ppsA: a gene encoding phosphoenolpyruvate synthase; prs: a gene encoding phosphoribosyl-pyrophosphate synthetase A; aroG: a gene encoding DAHP synthase.

FIG. 2 shows the relative yields, relative yields and biomass of L-tryptophan produced by fermentation of the TS102, TS52, TS41 and TS49 strains under shake flask conditions according to example 2 of the present invention.

FIG. 3 shows the relative yields, relative yields and biomass of L-tryptophan produced by fermentation of the TS102, TS401 and TS412 strains under shake flask conditions according to example 3 of the present invention.

In FIGS. 2 and 3, the relative yield and relative yield were calculated based on the TS102 strain as 100%.

FIG. 4 shows the yield of shikimic acid produced by fermentation of strain TS557 and TS558 according to example 4 of the present invention.

Detailed Description

As described above, the present invention takes modification of the oxidation stage of the pentose phosphate pathway as an entry point to reduce or block the oxidation stage of the pentose phosphate pathway in an aromatic amino acid-fermenting strain by reducing the expression level and/or activity of an enzyme catalyzing an irreversible reaction in the oxidation stage of the pentose phosphate pathway, thereby reducing carbon loss due to decarboxylation and increasing carbon-center metabolic flux. In a preferred embodiment, the efficiency of production of compounds and derivatives in the aromatic amino acid synthesis pathway is greatly improved by rebalancing the carbon-center metabolic flux, increasing precursor supply, reconfiguring the coenzyme metabolic pathway and/or removing feedback inhibition in addition to carbon loss by decarboxylation. In the present invention, the modification of the synthetic pathway of aromatic amino acids may include one or more of the following: blocking or weakening of the oxidative phase of the pentose phosphate pathway, strengthening of the non-oxidative phase of the pentose phosphate pathway, reconstitution of the NADPH cycle and engineering of the phosphoenolpyruvate-sugar phosphotransferase system.

Blocking or weakening of the oxidation stage of the pentose phosphate pathway

As shown in FIG. 1, the pentose phosphate pathway is a glucose oxidation bypass and can be divided into two stages, oxidation and non-oxidation. In the oxidation phase, glucose 6-phosphate is dehydrogenated to produce gluconolactone 6-phosphate and hydrolyzed to gluconic 6-phosphate catalyzed by glucose 6-phosphate dehydrogenase (G6 PD), and gluconic 6-phosphate is dehydrogenated again and spontaneously decarboxylated to produce ribulose 5-phosphate (also referred to as ribulose 5-phosphate) catalyzed by gluconic 6-phosphate dehydrogenase (6 GPD). Ribulose-5-phosphate is isomerized to ribose-5-phosphate. Oxidation of the pentose phosphate stage to produce 2 molecules of NADPH and 1 molecule of CO ₂ . The rate-limiting enzyme in this step is glucose-6-phosphate dehydrogenase. Blocking the process of ribulose-5-phosphate production from glucose-6-phosphate can be achieved by blocking G6 PD. In addition, since the 6-phosphogluconate dehydrogenase-catalyzed reaction is also irreversible, by blocking either G6PD or 6PGD, both can be achievedBlocking the process of ribulose-5-phosphate production from glucose-6-phosphate. Glucose-6-phosphate dehydrogenase is also known in the art as glucose-6-phosphate dehydrogenase.

Modifications of the zwf gene encoding glucose-6-phosphate dehydrogenase have been proposed in the art to increase the production of aromatic amino acids. For example, CN 101029310B discloses increasing the precursor supply by enhancing the expression of the zwf gene, thereby increasing the production of L-amino acids, including L-tryptophan. However, this method does not mention improvement of the yield of L-amino acid by reduction of carbon loss.

In an embodiment of the invention, carbon loss due to carbon dioxide release is reduced by reducing the expression level and/or activity of glucose-6-phosphate dehydrogenase (EC 1.1.1.49) and/or glucose-6-phosphate dehydrogenase (EC 1.1.1.44) in the bacterium.

Taking L-tryptophan as an example, the total reaction of glucose to generate L-tryptophan through EMP and PPP is as follows:

2.5 XD-glucose +2 XH ₃ N<＝>L-Tryptophan +4CO ₂ (ii) a The theoretical saccharic acid conversion of glucose in this pathway is 204.2/(2.5 × 180) =45.4%.

The total reaction of glucose to L-tryptophan without PPP is:

2 XD-glucose +2 XH ₃ N<＝>L-Tryptophan + CO ₂ (ii) a The theoretical saccharic acid conversion of glucose in this pathway is 204.2/(2 × 180) =56.7%.

It can be seen that the theoretical saccharic acid conversion of glucose can be increased from 45.4% to 56.7% after blocking or weakening the oxidation phase of the pentose phosphate pathway, as calculated from the theoretical yield of the synthetic pathway.

Methods for reducing the expression or activity of a gene are known in the art, for example by deleting the gene in whole or in part from the genome of the gene, inserting a non-functional fragment at one or more sites, or altering the activity of the protein by replacing one or more sites such that the fragment does not encode the protein or the activity of the encoded protein is reduced; the promoter region may also be modified, the half-life of the protein may be shortened by adding a degradation tag, and the like. Reduced expression of the relevant genes can also be achieved by altering the composition of the medium and the culture conditions. The expression or activity of G6PD and/or 6GDP may be reduced by any means as described above, for example by knocking out a part of the zwf and/or gnd genes (e.g. a part of the coding region and/or a part of the promoter region) on the genome.

Enhancement of the non-oxidative stage of the pentose phosphate pathway

As described above, reducing the expression level and/or activity of G6PD and/or 6GDP can reduce carbon loss. However, blockade of the oxidation stage of the pentose phosphate pathway may lead to a reduction in pentose phosphate pathway intermediates including erythrose 4-phosphate (E4P) and ribose 5-phosphate. Erythrose 4-phosphate is a precursor of the chorismate pathway together with phosphoenolpyruvate (PEP). Furthermore, ribose 5-phosphate is involved in the downstream production of 5-phosphoribosyl-1-pyrophosphate (PRPP). PRPP can react with phthalic acid to form phosphoribosyl anthranilic acid, indole glycerophosphate is formed through rearrangement, decarboxylation and cyclization, 3-glyceraldehyde phosphate is firstly removed under the catalysis of tryptophan synthetase to generate indole, and finally the indole and serine are condensed to generate tryptophan and 5-hydroxytryptophan. The supplementation of erythrose 4-phosphate and ribose 5-phosphate can be achieved by adjusting the culture medium. In a preferred embodiment, the reduction in erythrose 4-phosphate and ribose 5-phosphate due to the blockage of the oxidative stage of the pentose phosphate pathway is complemented by a step in the pentose phosphate pathway that is reinforced by a non-oxidative stage.

As shown in FIG. 1, the non-oxidative stage of the pentose phosphate pathway essentially enters the glycolytic pathway by rearranging a series of groups, converting ribulose-5-phosphate to fructose-6-phosphate and glyceraldehyde-3-phosphate. To increase the concentration of erythrose 4-phosphate and ribose 5-phosphate, the intermediates of the glycolysis pathway can be promoted into the non-oxidative stage of the pentose phosphate pathway by increasing the expression or activity of one or more of the following enzymes: transketolase (E.coli endogenously expresses two transketolases, transketolase A and transketolase B, respectively; C.glutamicum endogenously expresses only one transketolase), ribulose-5-phosphate epimerase, ribose-5-phosphate isomerase (E.coli endogenously expresses ribose-5-phosphate isomerase A and ribose-5-phosphate isomerase B, C.glutamicum endogenously expresses only one ribose-5-phosphate isomerase) and phosphoribosyl pyrophosphate synthetase A.

Methods for increasing the expression or activity of a gene are known in the art, for example, increasing the copy number of the gene on a plasmid or genome, modifying the promoter region (e.g., replacing the promoter with a strong promoter), extending the life of the mRNA, reducing enzymatic breakdown, and the like. Increased expression of the relevant gene can also be obtained by altering the composition of the medium and the culture conditions. For E.coli, the expression of tktA, tktB, rpe, rpiA, rpiB and/or prs may be increased by any of the methods described above. Preferably, tktA, tktB, rpe, rpiA, rpiB and/or prs are overexpressed. In C.glutamicum, the expression of tkt, rpe, rpi and/or prs may be increased by any of the methods described above. Preferably, tkt, rpe, rpi and/or prs are overexpressed. Without wishing to be bound by theory, it is also possible to express foreign genes mentioned above (for example the tktA, tktB, rpe, rpiA, rpiB and/or prs genes of C.glutamicum or the genes mentioned above of C.glutamicum) in order to increase the expression of the relevant proteins.

Reconstitution of coenzyme NADPH cycle

As described above, the pentose phosphate oxidation phase produces 2 molecules of NADPH and 1 molecule of CO ₂ . Blocking this phase results in the pentose phosphate pathway no longer producing NADPH, which may result in insufficient reducing power in the cell. Thus, it is contemplated that NADP +/NADPH equilibrium can be achieved by facilitating the conversion of NADH to NADPH to complement the reducing power. The reducing power can be supplied from the outside by adjusting the medium. In a preferred embodiment, the NADP +/NADPH balance is reconstituted by promoting the conversion of NADH to NADPH. For example, in E.coli, the conversion of NADH to NADPH is promoted by enhancing the expression or activity of NAD (P) H transhydrogenase A and/or NAD (P) H transhydrogenase B. The increase in the ratio of NADP +/NADPH, or even the product of NADP +, caused by the blockade of the oxidative phase of the pentose phosphate pathway, can be eliminated by overexpressing pntA and/or pntB on a plasmid or on a genomeAnd (6) accumulating. In C.glutamicum, the conversion of NADH to NADPH can be promoted by the exogenous expression of NAD (P) H transhydrogenase A and/or NAD (P) H transhydrogenase B of E.coli. The increase in the NADP/NADPH ratio and even the accumulation of NADP due to the blockage of the oxidative phase of the pentose phosphate pathway can be eliminated by overexpressing pntA and/or pntB on the plasmid or genome.

Modification of phosphoenolpyruvate-sugar phosphotransferase system

It is known in the art that wild-type E.coli transports and phosphorylates glucose using the phosphoenolpyruvate-sugar phosphotransferase system (PTS system for short). The PTS system requires 1 mole of phosphoenolpyruvate (PEP) for 1 mole of glucose transport. When E.coli is grown in a restrictive medium with glucose as the carbon source, the PTS system consumes about 50% of PEP for glucose transport and phosphorylation, directly affecting the synthesis of downstream PEP-precursor products and derivatives in the aromatic amino acid synthetic pathway. PTS system deficient E.coli can transport glucose into cells by the combined action of Galactose/hydrogen ion cotransporter (D-Galactose/H + symporter, galP, also known as Galactose permease) and Glucokinase (GLk). Therefore, in a preferred embodiment, the supply of PEP as a precursor can be further increased by making the expression level and/or activity of the enzyme of the PTS system decreased and enhancing the galactose transport pathway (CN 105543154A).

Thus, in a further preferred embodiment, the supply of PEP precursor can be further increased by engineering the PTS. Preferably, the proteins of the PTS system are selected from one or more of the proteins encoded by the following genes: ptsH, ptsI, crr or ptsG, preferably ptsG. Preferably, the protein of the galactose transport pathway is selected from one or more of the following proteins: galactose permease or glucokinase, preferably both galactose permease and glucokinase expression levels and/or activities are increased. Preferably, galP and glK are overexpressed simultaneously.

Relieving feedback inhibition of intermediate product

As previously mentioned, the fieldIt is known that chorismate can be accumulated in cells by relieving feedback inhibition of DAHP synthase and chorismate mutase, thereby increasing the yield of downstream products of the aromatic amino acid synthesis pathway. For example, the genomic AroF, aroG and/or TrpEDCBA operon can be knocked out or inactivated and the mutant enzyme AroF insensitive to negative feedback is expressed ^fbr Or AroG ^fbr And/or TrpE ^fbr DCBA to relieve feedback inhibition (us 5,939,295a). In embodiments where shikimic acid is the end product, feedback inhibition can also be relieved by knockout of aroL (e.coli aroL gene knockout and its effect on shikimic acid synthesis, proceedings of the second order (nature science), vol.2007, vol.46, vol.3).

In addition, for the L-tryptophan synthesis branch, indole, which is a precursor of the L-tryptophan synthesis branch, can be accumulated by enhancing the expression level or activity of 3-phosphoglycerate dehydrogenase (Ileda M, 2006).

With respect to the enzymes in the above-mentioned bacterial aromatic amino acid synthesis pathway and genes encoding the enzymes, the enzymes and their encoding genes in various model and engineered bacteria have been studied and characterized in the art. Tables 1 and 2 show the NCBI accession numbers of the corresponding protein and gene sequences of the enzymes to which the invention is primarily directed in Escherichia coli and Corynebacterium glutamicum, respectively. The skilled person will be able to obtain the sequences of the above proteins and genes based on the numbers in the table.

TABLE 1

TABLE 2

In various embodiments of the present invention, the aromatic amino acid-producing escherichia coli of the present invention may have one or more of the following characteristics:

a reduced level of expression and/or activity of glucose-6-phosphate dehydrogenase and/or glucose-6-phosphate dehydrogenase;

enhanced expression level and/or activity of one or more enzymes of the non-oxidative stage of the pentose phosphate pathway selected from the group consisting of transketolase a, transketolase B, ribulose-5-phosphate epimerase, ribose-5-phosphate isomerase a, ribose-5-phosphate isomerase B, and phosphoribosyl pyrophosphate synthetase a;

an increased expression level and/or activity of NAD (P) H transhydrogenase A and/or NAD (P) H transhydrogenase B;

a decrease in the expression level and/or activity of a PTS system protein and an increase in the expression level and/or activity of one or more glucose transporters that are not PEP substrates;

expression of the mutant enzyme AroF ^fbr Or AroG ^fbr And/or TrpE ^fbr DCBA, and AroF, aroG and/or TrpEDCBA operons are knocked out or inactivated; and

the expression level and/or activity of 3-phosphoglycerate dehydrogenase is increased.

In a more preferred embodiment, the bacterium of the present invention may be Escherichia coli TS412, which is classified and named Escherichia coli, deposited in the China general microbiological culture Collection center (address: beijing, NO. 3 of Xilu No. 1 of Chaozhong, the national institute of sciences, microbiology), CGMCC No. 14047, and the date of deposition is 2017, 4 months and 19 days.

In various embodiments of the present invention, the Corynebacterium glutamicum producing aromatic amino acids and derivatives thereof of the present invention may have one or more of the following characteristics:

a reduced expression level and/or activity of a glucose-6-phosphate dehydrogenase and/or a glucose-6-phosphate dehydrogenase;

enhanced expression levels and/or activity of one or more enzymes of the non-oxidative stage of the pentose phosphate pathway selected from the group consisting of transketolase, ribulose-5-phosphate epimerase, ribose-5-phosphate isomerase, and phosphoribosyl pyrophosphate synthetase a;

expressing pntA and/or pntB of Escherichia coli;

expression of the mutant enzyme AroF ^fbr Or AroG ^fbr And/or TrpE ^fbr DCBA, and AroF, aroG and/or TrpEDCBA operon is knocked out or inactivated; and an increased level of expression and/or activity of 3-phosphoglycerate dehydrogenase.

In some embodiments, the bacterium of the invention is used for the fermentative production of shikimic acid. Preferably, the expression and/or activity of shikimate kinase I (encoded by aroK) and/or shikimate kinase II (encoded by aroL) is reduced in the bacterium.

It is known in the art that the shikimic acid pathway is a common upstream pathway for the production of aromatic amino acids (L-tryptophan, L-tyrosine and L-phenylalanine), derivatives thereof (e.g. violacein, 5-hydroxytryptophan, cinnamic acid (its precursor is phenylalanine)), as well as some organic acids, phenylpropanoids (phenylpropanoids), etc.; wherein the organic acid comprises salicylic acid and mucofuroic acid (also known as mucofuroic acid); the phenylpropanoids include hydroxylated cinnamic acids (e.g., coumaric acid, ferulic acid, caffeic acid, and caffeic acid derivatives rosemary acid, chlorogenic acid, quinic acid, and shikimate), coumarins (including biscoumarin, 4-hydroxycoumarin, 7-hydroxycoumarin, 6, 7-dihydroxycoumarin), flavonoids (including flavones, flavanones, isoflavones, flavonols, and flavanols, including soy isoflavones, naringenin, pinocembrin, and eriodictyol, etc.), and stilbenes (i.e., symmetrical benzodiazepine analogs, including quinophthalol). Since shikimic acid is a precursor of the above-mentioned compounds, enhancement of the pathway of shikimic acid can improve the fermentation yield of the above-mentioned compounds (progress in research on biosynthesis of aromatic amino acids and derivatives thereof, biological technical report, 2017, 33 (1): 24-34, engineering Escherichia coli to over produced amino acids and derived compounds, rodrigz et al, microbial cells 2014, 13. The technical scheme of the invention is to adjust the common path of the synthetic routes of the aromatic amino acid, so that the strain can be used for producing any compound by fermentation. In addition, various strains have been reported in the art for the fermentative production of each of the above compounds. It is anticipated by the person skilled in the art that the improvements of the common pathway shikimic acid pathway of the present invention can be combined with existing improvements to each of the synthetic arms to achieve improvements in the fermentation process for specific compounds therein. Definition of

Definition of

The term "shikimic acid pathway" (shikimic acid pathway), also known as Chorismate pathway (Chorismate pathway), as used herein is a 7-step metabolic pathway common to bacteria, fungi, algae, some protozoan parasites and plants when synthesizing folate and aromatic amino acids (phenylalanine, tyrosine and tryptophan). The starting materials of the pathway are phosphoenolpyruvate and erythrose-4-phosphate, and the final product is a branched acid; the 7 enzymes catalyzing the shikimic acid pathway are respectively DAHP synthase, 3-dehydrocolchicine synthase, 3-dehydroquinic acid dehydratase, shikimic acid dehydrogenase, shikimic acid kinase, EPSP synthase and chorismate synthase. Chorismic acids are precursors to aromatic amino acids, indoles and their derivatives, salicylic acid, and various alkaloids.

Although the present examples are primarily achieved using Escherichia coli (also known as Escherichia coli), as described above, the biosynthesis of aromatic amino acids in almost all engineered bacteria, and even in many eukaryotes such as ascomycetes (ascomycetes), apicomplexans (apomicplexans) and plants, utilizes a very similar pathway, first the condensation of phosphoenolpyruvate (PEP) and erythrose-4-phosphate (E4P) to 3-deoxy D-arabinoheptulosonate-7-phosphate (DAHP), followed by the catalytic production of chorismate (Rodriguez et al, microbial Cell factors 2014, 13. Therefore, the principles of the present invention are equally applicable to fermentation engineering bacteria known in the art, in particular Corynebacterium glutamicum, brevibacterium lactofermentum (Brevibacterium lactofermentum), brevibacterium flavum (Brevibacterium flavum), corynebacterium acetoacidophilum (Corynebacterium acetoacidophilum) and Corynebacterium efficiens. Escherichia coli of the present invention may be any Escherichia coli strain, including but not limited to K12, W3110, BW25113, MG1655, BL21 (DE 3), JM109, DH5a, DH10B, C600, ER2925, HB101, JM110, S17-1, T1R, TOP10, W, XL1-blue, SURE, RR1, LE392, MC1061, IJ1126, AG1, and AB1157.

As used herein, all terms "reduce/decrease", "inhibit" or "block" generally refer to a decrease in a statistically significant amount relative to a control strain that has not been genetically modified. However, for the avoidance of doubt, "reduce", "inhibit" or "block" generally means a reduction of at least 10% compared to a control that has not been engineered, and may include, for example: at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99% less than a control, and including the complete absence of a given entity or parameter relative to a control (e.g., a mutated enzyme can be completely inactivated, or in the case of a gene knockout, the enzyme is not expressed at all).

As used herein, all terms "increase", "enhancing", "activation" or "overexpression" generally refer to an increase in a statistically significant amount relative to a control strain that has not been genetically modified; for the avoidance of doubt, the terms "increase", "enhancement", "activation" or "overexpression" are generally an increase of at least 10% relative to a control strain which has not been genetically modified, for example: an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including a 100% increase as compared to a control strain that has not been genetically modified, or any increase between 10% and 100% as compared to a control; or at least about 2-fold, or at least about 3-fold, or at least about 4-fold, or at least about 5-fold, or at least about 10-fold, or any increase from 2-fold to more than 10-fold as compared to a control. In particular, enhanced expression includes expression of the corresponding foreign protein in the host bacterium.

Embodiments of the aspects described herein may be illustrated by the following numbered paragraphs:

1. a method for increasing production of compounds in the aromatic amino acid biosynthetic pathway and derivatives thereof in a bacterium, said method comprising modifying said bacterium such that expression level and/or activity of an enzyme catalyzing an irreversible reaction at the oxidative stage of the pentose phosphate pathway in said bacterium is reduced; wherein the enzyme catalyzing the irreversible reaction in the oxidation stage of the pentose phosphate pathway is glucose-6-phosphate dehydrogenase and/or glucose-6-phosphate dehydrogenase; wherein the compound in the aromatic amino acid biosynthetic pathway and the derivative thereof are selected from any one of the group consisting of: shikimic acid, chorismic acid, anthranilic acid, indole, 5-hydroxytryptophan, violacein, prephenate, L-phenylalanine, phenethyl alcohol, L-dopa, L-tyrosine, cinnamic acid, coumaric acid, caffeic acid, ferulic acid, coumarin, flavonoid, salicylic acid and myfuroic acid.

2. The method of paragraph 1 wherein said coumarin is selected from the group consisting of bishydroxycoumarin, 4-hydroxycoumarin, 7-hydroxycoumarin, and 6, 7-dihydroxycoumarin; the flavonoid is selected from the group consisting of flavones, flavanones, isoflavones, flavonols and flavanols, more preferably soy isoflavones, naringenin, pinocembrin and eriodictyol; said stilbenes are selected from the group consisting of resveratrol.

3. The method of paragraph 1 or 2, wherein the method further comprises: knocking out or inactivating the zwf gene in the bacterium such that the expression level and/or activity of glucose-6-phosphate dehydrogenase in the bacterium is reduced; preferably, the promoter of the zwf gene is engineered such that the zwf gene in the bacterium is inactivated.

4. The method of any of paragraphs 1-3, wherein the method further comprises: knocking out or inactivating the gnd gene in the bacterium such that the expression level and/or activity of 6-phosphogluconate dehydrogenase in the bacterium is reduced; preferably, the promoter of the gnd gene is modified so that the gnd gene in the bacterium is inactivated.

5. The method of any of paragraphs 1-4, wherein said bacteria are selected from the group consisting of: escherichia coli, corynebacterium glutamicum, brevibacterium lactofermentum, brevibacterium flavum, corynebacterium acetoacidophilum, and Corynebacterium efficiens.

6. The method of paragraph 5 wherein the bacterium is E.coli.

7. The method of paragraph 6, the method further comprising: genetically modifying the bacterium such that the expression level and/or activity of one or more enzymes of the non-oxidative stage of the pentose phosphate pathway in the bacterium is increased, wherein the enzymes of the non-oxidative stage of the pentose phosphate pathway are selected from the group consisting of transketolase A, transketolase B, ribulose-5-phosphate epimerase, ribose-5-phosphate isomerase A, ribose-5-phosphate isomerase B and phosphoribosyl pyrophosphate synthetase A; preferably, the level of expression and/or activity of one or more enzymes of the non-oxidative stage of the pentose phosphate pathway in said bacterium is enhanced by overexpression of one or more of the following genes: tktA, tktB, rpe, rpiA, rpiB, and prs.

8. The method of paragraphs 6 or 7, further comprising: genetically modifying the bacterium such that the level of expression and/or activity of NAD (P) H transhydrogenase A and/or NAD (P) H transhydrogenase B in the bacterium is enhanced, preferably by over-expressing pntA and/or pntB genes such that the level of expression and/or activity of NAD (P) H transhydrogenase A and/or NAD (P) H transhydrogenase B in the bacterium is enhanced.

9. The method of any of paragraphs 6-8, further comprising: genetically modifying the bacterium such that expression levels and/or activity of a PTS system protein in the bacterium are reduced and expression levels and/or activity of one or more glucose transporters of a non-PEP substrate are increased; preferably, the glucose transporter of the non-PEP substrate is a galactose permease and/or glucokinase; more preferably, one or more of the following genes are knocked out or inactivated so that the expression level and/or activity of the PTS system protein in the bacterium is reduced: ptsH, ptsI, crr or ptsG; more preferably, the ptsG gene is knocked out or inactivated such that the expression level and/or activity of PTS system proteins in said bacterium is reduced.

10. The method of paragraph 9, wherein one or more of the following genes are overexpressed such that the expression level and/or activity of one or more glucose transporters that are not substrates for PEP is increased: galP and glK; preferably, galP and glK are overexpressed simultaneously.

11. The method of any of paragraphs 6-10, further comprising: genetically modifying the bacterium such that the bacterium expresses the mutant enzyme AroF ^fbr Or AroG ^fbr And/or TrpE ^fbr DCBA, and knock-out or inactivation of AroF, aroG and/or TrpEDCBA operons of said bacterium.

12. The method of any of paragraphs 6-11, wherein the compound in the aromatic amino acid biosynthetic pathway is indole, 5-hydroxytryptophan, or violacein, the method further comprising: genetically modifying the bacterium such that the expression level and/or activity of 3-phosphoglycerate dehydrogenase is increased in the bacterium; preferably, serA is overexpressed by the bacterium, such that the expression level and/or activity of 3-phosphoglycerate dehydrogenase is increased in the bacterium.

13. The method of any of paragraphs 6-11, wherein the compound in the aromatic amino acid biosynthetic pathway is shikimic acid, the method further comprising: genetically modifying the bacterium such that expression and/or activity of shikimate kinase I and/or shikimate kinase II is reduced in the bacterium; preferably, the aroK and/or aroL genes in said bacterium are knocked out or inactivated such that the expression level and/or activity of shikimate kinase I and/or shikimate kinase II in said bacterium is reduced.

14. The method of paragraph 5 wherein the bacterium is Corynebacterium glutamicum.

15. The method of paragraph 14, the method further comprising: genetically modifying the bacterium such that the expression level and/or activity of one or more enzymes of the non-oxidative stage of the pentose phosphate pathway in the bacterium is enhanced, wherein the enzymes of the non-oxidative stage of the pentose phosphate pathway are selected from the group consisting of transketolase, ribulose-5-phosphate epimerase, ribose-5-phosphate isomerase, and phosphoribosyl pyrophosphate synthetase a; preferably, the expression level and/or activity of one or more enzymes of the non-oxidative stage of the pentose phosphate pathway in said bacterium is enhanced by overexpression of one or more of the following genes: tkt, rpe, rpi, and prs.

16. The method of paragraph 14 or 15, further comprising: genetically modifying the bacterium such that the bacterium expresses NAD (P) H transhydrogenase A and/or NAD (P) H transhydrogenase B of E.coli; preferably, the pntA and/or pntB genes of E.coli are transferred into the bacterium so that the bacterium expresses NAD (P) H transhydrogenase A and/or NAD (P) H transhydrogenase B of E.coli.

17. The method of any of paragraphs 14-16, further comprising: genetically modifying the bacterium such that expression levels and/or activity of a PTS system protein in the bacterium are reduced and expression levels and/or activity of one or more glucose transporters of a non-PEP substrate are increased; preferably, the glucose transporter of the non-PEP substrate is a galactose permease and/or glucokinase; preferably, one or more of the following genes are knocked out or inactivated so that the expression level and/or activity of the PTS system protein in the bacterium is reduced: ptsH, ptsI, crr or ptsG; more preferably, the ptsG gene is knocked out or inactivated such that the expression level and/or activity of the PTS system protein in the bacterium is decreased.

18. The method of paragraph 17, wherein one or more of the following genes are overexpressed such that the expression level and/or activity of one or more glucose transporters that are not substrates for PEP is increased: galP and glK; preferably, galP and glK are overexpressed simultaneously.

19. The method of any of paragraphs 14-18, further comprising: subjecting the bacteria to a substrateThe bacterium is modified so as to express the mutant enzyme AroF ^fbr Or AroG ^fbr And/or TrpE ^fbr DCBA, and knock-out or inactivation of AroF, aroG and/or TrpEDCBA operons of said bacterium.

20. The method of any one of paragraphs 14-19 wherein the compound in the aromatic amino acid biosynthetic pathway is shikimic acid, the method further comprising genetically modifying the bacterium such that expression and/or activity of shikimate kinase I and/or shikimate kinase II is reduced in the bacterium; preferably, aroK and/or aroL genes in said bacterium are knocked out or inactivated such that the expression level and/or activity of shikimate kinase I and/or shikimate kinase II in said bacterium is reduced.

21. The method of any of paragraphs 14-19, wherein the compound in the aromatic amino acid biosynthetic pathway is indole, 5-hydroxytryptophan, or violacein, the method further comprising: genetically modifying the bacterium such that the level of expression and/or activity of 3-phosphoglycerate dehydrogenase is increased in the bacterium; preferably, the bacterium is allowed to overexpress serA, such that the level of expression and/or activity of 3-phosphoglycerate dehydrogenase in the bacterium is increased.

22. Use of a bacterium in the fermentative production of a compound in the biosynthetic pathway of aromatic amino acids and derivatives thereof, wherein the bacterium has reduced expression levels and/or activity of an enzyme catalyzing the irreversible reaction at the oxidation stage of the pentose phosphate pathway; wherein the enzyme catalyzing the irreversible reaction in the oxidation stage of the pentose phosphate pathway is glucose-6-phosphate dehydrogenase and/or glucose-6-phosphate dehydrogenase; wherein the compound in the aromatic amino acid biosynthetic pathway and the derivative thereof are selected from any one of the group consisting of: shikimic acid, chorismic acid, anthranilic acid, indole, 5-hydroxytryptophan, violacein, prephenate, L-phenylalanine, phenethyl alcohol, L-dopa, L-tyrosine, cinnamic acid, coumaric acid, caffeic acid, ferulic acid, coumarin, flavonoid, salicylic acid and myfuroic acid.

23. The use of paragraph 22 wherein the coumarin is selected from the group consisting of dicoumarol, 4-hydroxycoumarin, 7-hydroxycoumarin and 6, 7-dihydroxycoumarin; said flavonoid is selected from the group consisting of flavones, flavanones, isoflavones, flavonols and flavanols, more preferably soy isoflavones, naringenin, pinocembrin and eriodictyol; said stilbenes are selected from the group consisting of resveratrol.

24. The use of paragraph 22 or 23 wherein the zwf gene in the bacterium is knocked out or inactivated such that the level of expression and/or activity of glucose-6-phosphate dehydrogenase in the bacterium is reduced; preferably, the promoter of the zwf gene in the bacterium is engineered such that the zwf gene in the bacterium is inactivated.

25. The use of any of paragraphs 22-24, wherein the gnd gene in the bacterium is knocked out or inactivated such that the expression level and/or activity of 6-phosphogluconate dehydrogenase is reduced in the bacterium; preferably, the promoter of the gnd gene in the bacterium is engineered so that the gnd gene in the bacterium is inactivated.

26. The use of any of paragraphs 22-25, wherein the bacterium is selected from the group consisting of: escherichia coli, corynebacterium glutamicum, brevibacterium lactofermentum, brevibacterium flavum, corynebacterium acetoacidophilum, and Corynebacterium efficiens.

27. The use of paragraph 26 wherein the bacterium is E.coli.

28. The use of paragraph 27, wherein the expression level and/or activity of one or more enzymes of the non-oxidative stage of the pentose phosphate pathway in said bacterium is enhanced, wherein the enzymes of the non-oxidative stage of the pentose phosphate pathway are selected from the group consisting of transketolase A, transketolase B, ribulose-5-phosphate epimerase, ribose-5-phosphate isomerase A, ribose-5-phosphate isomerase B, and phosphoribosyl pyrophosphate synthetase A; preferably, the bacterium overexpresses one or more of the following genes: tktA, tktB, rpe, rpiA, rpiB, and prs.

29. The use of paragraph 27 or 28 wherein the expression level and/or activity of NAD (P) H transhydrogenase a and/or NAD (P) H transhydrogenase B in the bacterium is enhanced, preferably the bacterium overexpresses the pntA and/or pntB genes.

30. The use of any one of paragraphs 27-29, wherein the expression level and/or activity of a PTS system protein is decreased and the expression level and/or activity of one or more glucose transporters that are not PEP substrates is increased in the bacterium; preferably, the glucose transporter of the non-PEP substrate is a galactose permease and/or glucokinase; more preferably, one or more of the following genes in said bacterium are knocked out or inactivated, whereby the expression level and/or activity of PTS system proteins in said bacterium is reduced: ptsH, ptsI, crr or ptsG; more preferably, the ptsG gene is knocked out or inactivated in said bacterium.

31. The use of paragraph 30 wherein said bacterium overexpresses galP and/or glK; preferably, the bacterium overexpresses both galP and glK.

32. The use of any of paragraphs 27-31, wherein the bacterium expresses the mutant enzyme AroF ^fbr Or AroG ^fbr And/or TrpE ^fbr DCBA, and the AroF, aroG and/or TrpEDCBA operon is knocked out or inactivated.

33. The use of any of paragraphs 27-32, wherein the compound in the aromatic amino acid biosynthetic pathway is indole, 5-hydroxytryptophan or violacein, wherein the expression level and/or activity of 3-phosphoglycerate dehydrogenase is increased in said bacterium; preferably, the bacterium overexpresses serA.

34. The use of paragraph 27, wherein said bacterium is the Escherichia coli TS412 strain deposited in the China general microbiological culture Collection center with the accession number CGMCC No.:14047 and a preservation date of 2017, 4 and 19 months.

35. The use of any of paragraphs 27-32 wherein the compound in the aromatic amino acid biosynthetic pathway is shikimic acid, wherein the expression and/or activity of shikimate kinase I and/or shikimate kinase II is reduced in the bacterium; preferably, the aroK and/or aroL genes in said bacterium are knocked out or inactivated.

36. The use of paragraph 27 wherein the bacterium is Corynebacterium glutamicum.

37. The use of paragraph 36 wherein the expression level and/or activity of one or more enzymes of the non-oxidative stage of the pentose phosphate pathway in said bacterium is enhanced, wherein the enzymes of the non-oxidative stage of the pentose phosphate pathway are selected from the group consisting of transketolase, ribulose-5-phosphate epimerase, ribose-5-phosphate isomerase, and phosphoribosyl pyrophosphate synthetase a; preferably, the bacterium overexpresses one or more of the following genes: tkt, rpe, rpi, and prs.

38. The use of paragraphs 36 or 37 wherein the bacterium expresses e.coli NAD (P) H transhydrogenase a and/or NAD (P) H transhydrogenase B; preferably, the bacterium expresses the pntA and/or pntB genes of E.coli.

39. The use of any one of paragraphs 36-38, wherein the expression level and/or activity of a PTS system protein is decreased and the expression level and/or activity of one or more glucose transporters that are not PEP substrates is increased in the bacterium; preferably, the glucose transporter of the non-PEP substrate is a galactose permease and/or glucokinase; preferably, one or more of the following genes in the bacterium is knocked out or inactivated such that the expression level and/or activity of the PTS system protein in the bacterium is reduced: ptsH, ptsI, crr or ptsG; more preferably, the ptsG gene is knocked out or inactivated in the bacterium.

40. The use of paragraph 39 wherein one or more of the following genes are overexpressed such that the expression level and/or activity of one or more glucose transporters that are not substrates for PEP is increased: galP and glK; preferably, galP and glK are overexpressed simultaneously.

41. The use of any of paragraphs 36-40 wherein the bacterium expresses the mutant enzyme AroF ^fbr Or AroG ^fbr And/or TrpE ^fbr DCBA, and the AroF, aroG and/or TrpEDCBA operon of said bacterium is knocked out or inactivated.

42. The use of any one of paragraphs 36-41, wherein the compound in the aromatic amino acid biosynthetic pathway is shikimic acid, wherein the expression and/or activity of shikimate kinase I and/or shikimate kinase II is reduced in the bacterium; preferably, the aroK and/or aroL genes in said bacterium are knocked out or inactivated.

43. The use of any one of paragraphs 36-41, wherein the compound in the aromatic amino acid biosynthetic pathway is indole, 5-hydroxytryptophan or violacein, wherein the expression level and/or activity of 3-phosphoglycerate dehydrogenase is increased in said bacterium; preferably, the bacterium overexpresses serA.

44. An escherichia coli bacterium for producing shikimic acid wherein the bacterium has a reduced expression level and/or activity of a 6-phosphoglucose dehydrogenase or a 6-phosphogluconate dehydrogenase and wherein shikimate kinase I and/or shikimate kinase II is knocked out or inactivated in the bacterium.

45. The bacterium of paragraph 44, wherein the zwf gene in said bacterium is knocked out or inactivated such that the level of expression and/or activity of glucose-6-phosphate dehydrogenase in said bacterium is reduced; preferably, the promoter of the zwf gene in the bacterium is engineered such that the zwf gene in the bacterium is inactivated.

46. The bacterium of paragraphs 44 or 45 wherein the gnd gene in said bacterium has been knocked out or inactivated such that the expression level and/or activity of 6-phosphogluconate dehydrogenase is reduced in said bacterium; preferably, the promoter of the gnd gene in the bacterium is engineered so that the gnd gene in the bacterium is inactivated.

47. The bacterium of any one of paragraphs 44-46, wherein the expression level and/or activity of one or more enzymes of the non-oxidative stage of the pentose phosphate pathway in said bacterium is enhanced, wherein the enzymes of the non-oxidative stage of the pentose phosphate pathway are selected from the group consisting of transketolase A, transketolase B, ribulose-5-phosphate epimerase, ribose-5-phosphate isomerase A, ribose-5-phosphate isomerase B, and phosphoribosyl pyrophosphate synthetase A; preferably, the bacterium overexpresses one or more of the following genes: tktA, tktB, rpe, rpiA, rpiB, and prs.

48. The bacterium of any one of paragraphs 44-47, wherein the expression level and/or activity of NAD (P) H transhydrogenase A and/or NAD (P) H transhydrogenase B is enhanced in said bacterium, preferably said bacterium overexpresses the pntA and/or pntB genes.

49. The bacterium of any one of paragraphs 44-48, wherein the expression level and/or activity of PTS system proteins is decreased and the expression level and/or activity of one or more glucose transporters of a non-PEP substrate is increased in the bacterium; preferably, the glucose transporter of the non-PEP substrate is a galactose permease and/or glucokinase; more preferably, one or more of the following genes are knocked out or inactivated in the bacterium, whereby the expression level and/or activity of PTS system proteins in the bacterium is reduced: ptsH, ptsI, crr or ptsG; more preferably, the ptsG gene is knocked out or inactivated in said bacterium.

50. The bacterium of paragraph 49 wherein said bacterium overexpresses galP and/or glK; preferably, the bacterium overexpresses both galP and glK.

51. The bacterium of any one of paragraphs 44-50, wherein said bacterium expresses the mutant enzyme AroF ^fbr Or AroG ^fbr And/or TrpE ^fbr DCBA, and the AroF, aroG and/or TrpEDCBA operon is knocked out or inactivated.

Examples

Reagents and culture media

All reagents were from Fisher Scientific unless otherwise indicated.

Luria-Bertani (LB) liquid medium:

peptone 10g/L;

NaCl 10g/L；

5g/L of yeast powder.

Adjusting pH to 7.0, and autoclaving at 121 deg.C for 20min.

LB solid medium: the same formula as LB liquid culture medium, 2wt% agar powder was added.

Kanamycin (Acros): dissolved in LB medium to a final concentration of 50. Mu.g/ml.

Spectinomycin (Acros): dissolved in LB medium to a final concentration of 50. Mu.g/ml.

Chloramphenicol (Acros): dissolved in LB medium to a final concentration of 34. Mu.g/ml.

Ampicillin (Acros): dissolved in LB medium to a final concentration of 100. Mu.g/ml.

Isopropyl-. Beta. -D-1-thiogalactoside (IPTG) (USB Corporation) was stored at a 1M stock concentration and at a final concentration of 100. Mu.M.

Seed culture medium:

adjusting pH to 7.2, filtering and sterilizing.

Shake flask fermentation medium:

adjusting pH to 7.0, filtering and sterilizing.

The seed culture medium is added with 10g/L glucose. The fermentation medium was supplemented with 20g/L glucose.

Shikimic acid fermentation medium

Shikimic acid conversion buffer

The pH values of the shikimic acid fermentation culture medium and the shikimic acid conversion buffer solution are both 7.2, the constant volume is 1000mL, and the filtration is carried out.

The primers used in the examples are SEQ ID No.:1-SEQ ID No.:54.

EXAMPLE 1 construction of the Strain

The names and genotype characteristics of the strains constructed in the present example are shown in Table 3.

TABLE 3

The strain TS102 was constructed according to the method described in patent application WO198701130A1 and Mascarenhas et al (Mascarenhas D, ashworth DJ, chen CS, deletion of pgi organisms tryptophan biosynthesis in a genetic engineered strain of Escherichia coli, appl Environ Microbiol,1991, 57 (10): 2995-2999), i.e.the genes tnaA, serA and trpR on the genome of the W3110 wild-type strain were knocked out. The starting strain used was E.coli wild-type W3110 (U.S. Pat. No. 5,939,295A). The plasmid used was p5LRPS2, described in U.S. Pat. No. 5,939,295A, of pBR322 origin, containing serA, aroG ^fbr And TrpE ^fbr DCBA gene fragment.

Construction of TS05 Strain

The TS102 strain is used as a starting strain, a ptsG sequence is replaced by a glK gene sequence, and then galR is knocked out to obtain a TS05 strain.

( 1) The ptsG fragment on the genome of the TS102 strain was replaced with the J23119-glk fragment (NCBI GeneID:945651 )

Use of primers SEQ ID No.:1 and SEQ ID No.:2, expression vector pS95s-glK with glK ^[1] And (3) amplifying by using the template to obtain a P119-glk-TrrnB fragment. P119-glk-TrrnB fragment was inserted into pSLM vector using Gibson homologous recombination ^[1] Between NotI/NheI cleavage sites. Use of primers SEQ ID No.:3 and SEQ ID No.:4 amplifying the obtained vector to obtain a J23119-glk fragment.

1-60bp of the J23119-glk fragment is an upstream homology arm and corresponds to-60 to-1 of the ptsG translation initiation site; the 61-218bp of the fragment is 119 promoter; 237-1203bp is the sequence of the glK Gene (Gene ID: 946858); 1396-1552bp is a terminator trrnB;1956-2750bp of kanamycin coding sequence; 3014-3073bp are downstream homology arms, corresponding to ptsG translation initiation sites +1414 to +1473.

The J23119-glk fragment was electro-transformed into arabinose-induced TS102 (containing pKD46 plasmid) strain and positive clones were screened on LB plate containing kanamycin. pKD46 vector is derived from Datsenko, KA, BL Wanner 2000. One-step inactivation of chromosomal genes in Escherichia coli K-1 using PCR products.Proc. Natl.Acad.Sci.U.S.A.97 (12): 6640-5. Access number: AY048746.

After homologous recombination, the ptsG sequence between the upstream and downstream homology arms was replaced with J23119-glK, and the genome carries the glK gene and a sequence encoding kanamycin. Transfer into recombinase plasmid pScre ^[1] Kanamycin resistance was eliminated.

(2) Knock-out galR (NCBI Gene ID: 947314)

Use of primers SEQ ID No.:5 and SEQ ID No.: and 6, amplifying by taking the pSLM vector as a template to obtain a homologous arm targeting DNA fragment. The homology arm targeting DNA fragment 1-63bp is an upstream homology arm corresponding to-60 to +3 bits of galR translation initiation site; the 458-1252bp is a kanamycin coding sequence; positions 1516-1578 are downstream homology arms, corresponding to galR translation start sites +1033 to +1092.

The homology arm targeting DNA fragment was electrically transformed into the strain (containing pKD46 plasmid) constructed in step (1) induced with arabinose, and positive clones were selected on LB plate containing kanamycin.

Construction of TS52 and TS401 strains

Using TS05 and TS102 as starting strains, the zwf gene on the genome was knocked out by the following method, respectively, to obtain TS52 and TS401 strains.

Escherichia coli MG1655 strain (CGSC #: 6300) genome was used as a template, and primers were used as set forth in SEQ ID No.: 7 and SEQ ID No.: 8. SEQ ID No.:9 and SEQ ID No.:10 carrying out PCR, and carrying out fusion PCR after obtaining a homologous arm U and a homologous arm R by amplification to obtain a targeting fragment. The 1bp-488bp of the targeting segment is upstream-506 to-19 bp of the zwf gene translation initiation site; 489bp-986bp are the zwf gene translation initiation sites +1479 to +1976bp.

Recombination technology using CRISPR/Cas9 mediation ^[2] The pCas plasmids were transferred into the TS05 and TS102 strains, respectively ^[2] . For is toThe transformed strain was diluted 100 times at 0 ℃ and inoculated with 10mM arabinose shaken, and when O.D.600 reached about 0.5, the strain was centrifuged at 4000rpm at 4 ℃ and washed with 10% glycerol 4 times to prepare competent cells.

The sequence CGCAGGAAATCAATGATCAG (SEQ ID No.: 55) was selected on the zwf gene to construct the targeted sgRNA. By ptarget ^[2] As template, primer pairs SEQ ID No.:49 and SEQ ID No.:50, performing inverse PCR, and performing self-ligation by using a Gibson Assembly method; the corresponding sgRNA plasmid was obtained. The sgRNA and the targeting fragment were electroporated into an arabinose-induced strain containing pCas plasmid, and positive clones were screened on spectinomycin and kanamycin double-antibody plates.

Construction of TS412 Strain

TS401 is used as a starting strain, and a serA sequence is replaced by a pntAB gene sequence to obtain a TS412 strain. Among them, pntAB (NCBI Gene ID:946628 and NCBI Gene ID: 946144) is pntA and pntB which share one promoter.

Taking the genome of the Escherichia coli MG1655 strain as a template, and respectively taking primer pairs of SEQ ID No.:16 and SEQ ID No.: 17. SEQ ID No.:14 and SEQ ID No.:15 and SEQ ID No.:11 and SEQ ID No.:12, carrying out PCR, amplifying to obtain an upstream homologous arm, a downstream homologous arm and a pntAB fragment, and carrying out fusion PCR on the three fragments to obtain a targeting fragment. 1bp-498bp of the targeting fragment is from +844bp to +1341bp of the translation initiation site of the serA (NCBI Gene ID: 945258) Gene; 499bp-536bp of promoter J101 (cagttacagctagctagctcagtccagtcctaggtatatatgctagc, SEQ ID NO: 56); 541 bp-3507 bp are the pntAB gene translation initiation site from-39 bp to +2932bp; the 3508bp-3951bp is from +1582bp to +2025bp of serA gene translation initiation site;

the sequence TGCGTTGTTTATTTAAT (SEQ ID NO.: 57) was selected on the serA gene to construct the targeted sgRNA. By ptarget ^[2] As template, primer pairs SEQ ID No.:48 and SEQ ID No.:50, carrying out inverse PCR, and carrying out self-ligation by using a Gibson Assembly method to obtain a corresponding sgRNA plasmid. The sgRNA and the targeting fragment were co-electroporated into arabinose-induced TS401, and positive clones were screened on spectinomycin and kanamycin double-antibody plates.

Construction of TS41 and TS49 strains

TS52 is used as a starting strain, and tktA, rpe, rpiA and prs are overexpressed to obtain TS41 and TS49 strains.

(1) Plasmids TP2, TP4, TP5 and TP7 were constructed.

(1) In pgRNA-bacteria ^[3] As template, primer pairs SEQ ID No.:18 and SEQ ID No.:19, PCR was performed to obtain plasmid backbone 1.

(2) Using the escherichia coli MG1655 genome as a template and using a primer pair of SEQ ID No.:20 and SEQ ID No.: 21. p100-prs (NCBI refseq ID of prs: NP-415725.1.

(3) Using the escherichia coli MG1655 genome as a template and using a primer pair of SEQ ID No.:22 and SEQ ID No.: 23. the prs coding fragment was amplified (NCBI refseq ID: NP-415725.1).

(4) Using the escherichia coli MG1655 genome as a template and using a primer pair of SEQ ID No.:24 and SEQ ID No.: 25. the rpiA coding fragment was amplified (NCBI refseq ID: NP-417389.1).

(5) Plasmid PSB1C3 (http:// parts.item.org/Part: pSB1C 3) was used as template with the primer pair SEQ ID No.: 26 and SEQ ID No.: <xnotran> 27 , 1 ( : ccaggcatcaaataaaacgaaa ggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttct gcgtttata, SEQ ID NO.: 59). </xnotran>

The fragments obtained in the above steps (1) to (5) were mixed and ligated by Gibson Assembly to obtain plasmid TP2.

(6) Using the escherichia coli MG1655 genome as a template and using a primer pair of SEQ ID No.:28 and SEQ ID No.: 29. amplifying P106-prs (NCBI refseq ID of prs: NP-415725.1; promoter P106 sequence tttacggctcagtccattaggtgcctagc, SEQ ID NO: 60)

The fragments obtained in the above steps (1) and (3) to (6) were mixed and ligated by Gibson Assembly to obtain plasmid TP4.

(7) In pgRNA-bacteria ^[3] As template, primer pair SEQ ID No.:30 and SEQ ID No.:31, PCR was performed to obtain plasmid backbone 2.

(8) Using the escherichia coli MG1655 genome as a template and using a primer pair of SEQ ID No.:32 and SEQ ID No.:33, J119-TKTA is amplified (NCBI refseq ID of tktA is WP _000098614.1, the sequence of J119 promoter is ttgacagctagccatcagcctagtatatgcctagc, SEQ ID NO: 61)

(9) Using the escherichia coli MG1655 genome as a template and using a primer pair of SEQ ID No.:34 and SEQ ID No.: 35. the rpe fragment was amplified (NCBI refseq ID: NP-417845.1).

R using primer pair SEQ ID No.:36 and SEQ ID No.:37 overlapping and amplifying to obtain a terminator 2 (CTCGGTACCAATTCCAGAAAAGAGGCTCCCCGAAAGGGGGCCTTTTTTCGTTTTTG GTCC, SEQ ID NO: 62).

The fragments obtained in step (7) to r (above) were mixed and ligated by Gibson Assembly to obtain plasmid TP5.

In pgRNA-bacteria ^[3] As template, primer pair SEQ ID No.:38 and SEQ ID No.:30 to obtain a plasmid skeleton 3.

Using the genome of escherichia coli MG1655 as a template and a primer set of SEQ ID No.:39 and SEQ ID No.: 33J 107-TKTA (J107 sequence: tttacggctagccagccctaggtattatgctagc, SEQ ID No.: 63) was amplified.

The steps are as follows

The obtained fragments were mixed and ligated by Gibson Assembly to obtain plasmid TP7.

Plasmids TP2 and TP4 were double digested with restriction enzymes EagI and XmaI, respectively. Plasmids TP5 and TP7 were double digested with restriction enzymes EagI and NgoMIV, respectively. And connecting the TP2 enzyme-cleaved fragment with the TP5 enzyme-cleaved fragment to obtain a plasmid TP8. And connecting the TP4 enzyme-cleaved fragment with the TP7 enzyme-cleaved fragment to obtain a plasmid TP16. Plasmids TP8 (with P100_ prs _ rpiA-J119_ tktA _ rpe fragment) and TP16 (with P106_ prs _ rpiA-J107_ tktA _ rpe fragment) were digested with restriction enzymes EagI and sbfI, respectively. Primer pair SEQ ID No.:53 and SEQ ID No.:54 and carrying out PCR amplification by taking the POSIP-KO plasmid (ACS synth. Biol.,2013,2 (9), pp 537-541) as a template to obtain the linearized POSIP-KO plasmid. The linearized TP8 or TP16 fragment was ligated to the linearized POSIP-KO plasmid by a Gibson Assembly, respectively. The ligation products were transformed, revived at 37 ℃ and screened for kanamycin resistance. Under the mediation of POSIP-KO plasmid, TP8 or TP16 fragments are integrated into the genome. The clone with the genome integrated with the TP8 fragment was designated TS41. The clone of the genome into which the TP16 fragment had been integrated was designated TS49.

Construction of TS557 and TS558 strains

The aroK and aroL genes on the genome were knocked out by the following methods using TS102 and TS52 as starting strains, respectively, to obtain TS557 and TS558 strains.

(1) Knock-out aroK

Escherichia coli MG1655 strain (CGSC #: 6300) genome was used as a template, and primers were used as set forth in SEQ ID No.: 40 and SEQ ID No.: 41. SEQ ID No.:42 and SEQ ID No.:43 and carrying out PCR, and carrying out fusion PCR after obtaining a homologous arm U and a homologous arm R by amplification to obtain a targeting fragment. The 1bp-461bp of the targeting segment is upstream-458 bp to +3bp of the translation initiation site of the aroK gene; 462bp-982bp are translation initiation sites of aroK genes from +469bp to +989bp.

Recombination technology mediated by CRISPR/Cas9 ^[2] The pCas plasmids were transferred into the TS05 and TS102 strains, respectively ^[2] . The transformed strain was diluted 100 times at 0 ℃ and inoculated with 10mM arabinose shaken, and when O.D.600 reached about 0.5, the strain was centrifuged at 4000rpm at 4 ℃ and washed with 10% glycerol 4 times to prepare competent cells.

The sequence ATCTTTTCTGGTTGGGCCTAT (SEQ ID No.: 64) was selected on the aroK gene to construct a targeting sgRNA. By ptarget ^[2] As template, primer pairs SEQ ID No.:51 and SEQ ID No.:50, carrying out inverse PCR, and self-linking by utilizing a Gibson Assembly method to obtain corresponding sgAn RNA plasmid. The sgRNA and the targeting fragment were electroporated into an arabinose-induced strain containing the pCas plasmid, and positive clones were screened on a spectinomycin and kanamycin double-antibody plate.

(2) Knockout of aroL

Escherichia coli MG1655 strain (CGSC #: 6300) genome was used as a template, and primers were used as set forth in SEQ ID No.: 44 and SEQ ID No.: 45. SEQ ID No.:46 and SEQ ID No.:47 carrying out PCR, and carrying out fusion PCR after obtaining the homologous arm U and the homologous arm R through amplification to obtain the targeting fragment. The 1bp-472bp of the targeting segment is from-469 bp to +3bp of the translation initiation site of aroL gene; 473bp-970bp represent translation initiation sites of aroL gene from +472bp to +969bp.

Recombination technology mediated by CRISPR/Cas9 ^[2] Separately, pCas plasmid was transferred to the aroK-knocked-out strain of the first step ^[2] . The transformed strain was inoculated by 100-fold dilution at 0 ℃ and inoculated with 10mM arabinose shaken, and when O.D.600 reached about 0.5, the strain was collected by centrifugation at 4000rpm at 4 ℃ and washed with 10% glycerol 4 times to prepare competent cells.

The sequence GTCGAAAGGGAAGAGTGGGC (SEQ ID NO: 65) was selected on the aroL gene to construct a targeting sgRNA. By ptarget ^[2] As template, primer pair SEQ ID No.:52 and SEQ ID No.:50, performing inverse PCR, and then performing self-ligation by using a Gibson Assembly method; after purifying the self-ligated fragment, in vitro transcription with T7RNA polymerase was performed using an Epicenter ASF3257 commercial kit to obtain the corresponding sgRNA. The sgRNA and the targeting fragment were electroporated into an arabinose-induced strain containing pCas plasmid, and positive clones were screened on spectinomycin and kanamycin double-antibody plates.

All constructed strains were verified by sequencing.

The experimental conditions for the above steps are as follows.

The PCR amplification system is as follows: NEB Q5 Xbuffer 10. Mu.l, dNTP (10 mM each dNTP) 1. Mu.l, forward and reverse primers (20. Mu.M) 1. Mu.l each, Q5DNA polymerase (2.5U/. Mu.l), distilled water 33.5. Mu.l, and total volume 50. Mu.l.

Gibson Assembly: each DNA fragment (total volume 5. Mu.l) was added to 15. Mu.l of Gibson reaction buffer (E2611L, NEB) and reacted at 50 ℃ for 1 hour. Subsequently, the ligated fragment was transformed into E.coli by calcium chloride method.

Conversion by calcium chloride method: mu.l of the reaction mixture (containing the ligation product) was taken, 50. Mu.l of Trans5a (Cat. NB. CD201, beijing Kogyo gold Biotech Co., ltd.) was added, ice-cooled for 30 minutes, heat-shocked at 42 ℃ for 45 seconds, and immediately placed on ice for 2 minutes. Immediately add 500. Mu.l LB medium, incubate with a shaker at 200rpm, and resuscitate for 1 hour at 37 ℃. 200. Mu.l of the culture was applied to LB plates containing the corresponding resistance. Culturing at 37 ℃ overnight, picking 3 positive single colonies, carrying out colony PCR verification, sending samples, sequencing and analyzing, and determining the positive clone as the correct result.

And (3) electric conversion: first, the host cells were prepared as competent cells, 50. Mu.l of the competent cells were placed on ice, 200ng of the DNA to be transformed was added thereto, and the cells were placed on ice for 2 minutes. Subsequently, the ice-cooled mixture was transferred to a 0.2cm Bio-Rad cuvette. A Micro-Pulser (Bio-Rad) electroporator was used with an electrode parameter of 2.5kV. After the electric shock, 900. Mu.l of LB medium was quickly transferred to a cuvette, repeatedly blown up, transferred to a test tube, and incubated at 30 ℃ for 1.5 hours at 200 rpm. 200 mul of bacterial liquid was spread on a double-antibody plate containing spectinomycin and kanamycin, cultured overnight at 37 ℃ and then single colonies were selected for PCR verification.

Example 2 determination of L-Tryptophan fermentation production efficiency of TS102, TS52, TS41 and TS49 strains

Picking each strain from the solid plate, placing the strain in a test tube containing 4mL of LB liquid culture medium, and culturing for 8-14 h at 35 ℃ and 220 rpm; inoculating the strain into a conical flask with a baffle plate containing 20mL of seed culture medium according to the inoculation amount of 1; the strain was transferred to a fermentation flask containing 500mL of shake flask fermentation medium to an initial OD 600 of 0.6-0.8, and cultured at 35 ℃ for 12h at 220 rpm.

L-tryptophan content in the medium was determined using an Eclipse XDB-C18 reverse phase chromatography column. Mobile phase a component: 20mM sodium acetate +0.2v/v% triethylamine, 85%; and the component B comprises: methanol, 15v/v%; the flow rate is 0.6mL/min; a detector: ultraviolet detector 280nm absorption peak. The L-tryptophan yield was measured as tryptophan concentration per liter of fermentation broth (concentration in g/L).

The conversion was calculated by the following method:

biomass is measured according to O.D.600 of the culture medium.

FIG. 2 shows the relative yields, relative yields (i.e., relative conversions) and biomass of L-tryptophan produced by fermentation using TS52, TS41 and TS49 strains relative to the control strain TS 102. When 20g/L glucose was added to the medium, the TS52 yield increased 34% relative to TS102, the TS41 yield increased 53% relative to TS102, and the TS49 yield increased 53% relative to TS 102. 2.05g/L tryptophan was detected in the control strain TS102 with a conversion of 9.75%.

Example 3 determination of the L-Tryptophan production efficiency by fermentation of TS102, TS401 and TS412 strains

The L-tryptophan productivity by fermentation of the TS401 and TS412 strains was determined according to the same method as in example 2, using TS102 as a control strain. The results are shown in FIG. 3. The TS401 strain has 6 percent of yield increase relative to the TS102 strain, and the TS412 strain has 23 percent of yield increase relative to the TS102 strain. 1.74g/L tryptophan was detected in the control strain TS102, with a conversion of 8.44%.

Example 4 determination of the efficiency of fermentation production of shikimic acid by the TS102, TS52, TS557 and TS558 strains

Selecting strains from a tetracycline solid medium plate, putting the strains into a test tube containing 4mL of liquid LB medium, and culturing for 8-12h; transferring 1% inoculum to shikimic acid culture medium, culturing for 10-12 hr, centrifuging at 4000rpm at 4 deg.C, collecting bacteria, and concentrating the bacteria to 25OD with shikimic acid conversion buffer solution. At 37 ℃ and 220rpm for 7 hours.

The shikimic acid content in the medium was determined using a 87H ion exchange column. The mobile phase is 6mM sulfuric acid; a detector: ultraviolet detector 210nm absorption peak, parallax shading detector. The column temperature was 55 ℃. The yield of shikimic acid was measured as shikimic acid concentration per liter of fermentation broth (concentration in g/L).

FIG. 4 shows the yield of shikimic acid in the broth of each strain after 12h of cultivation.

Shikimate kinase catalyzes the irreversible reaction of the synthesis of chorismate from shikimate. The knockout of aroK and aroJ allows the shikimic acid produced by the strain to accumulate without being converted into downstream products, thus facilitating the observation of the effect of the method of the invention (in particular the reconstitution of the pentose phosphate pathway) on the shikimic acid pathway. As can be seen from FIG. 4, the knock-out of zwf and the intensification of the non-oxidative phase of the pentose phosphate pathway lead to a strongly enhanced accumulation of shikimic acid. It will be appreciated that the method of the invention allows for enhanced carbon metabolism of shikimic acid (and also of chorismate downstream) and therefore the yield of aromatic amino acids and derivatives thereof can be increased by the method of the invention.

Reference to the literature

[1]WANG Yao,XU Yang,CHEN Nan,XU Xin-Yi,LIU Wei-Feng,TAO Yong.Novel efficient strategy forλ-Red-mediated gene knock-out/in in Escherichiacoli using SCLM system[J]. Microbiology China,2015,42(4):699-711.

[2]Appl.Environ.Microbiol.April 2015vol.81no.7 2506-2514.

[3]Cell.2013Feb 28；152(5):1173–1183.

Sequence listing

<110> institute of microbiology of Chinese academy of sciences

<120> method for increasing production of compound and derivative thereof in biosynthetic pathway of aromatic amino acid

<160> 65

<170> SIPOSequenceListing 1.0

<210> 1

<211> 51

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

acgttaaggg attttgggcg gccgcggcat gccacagcta acaccacgtc g 51

<210> 2

<211> 51

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atgctatacc aagttatgaa gctagcaggc ccagtctttc gactgagcct t 51

<210> 3

<211> 80

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ccccccttgc cacgcgtgag aacgtaaaaa aagcacccat actcaggagc actctcaatt 60

gcatgccaca gctaacacca 80

<210> 4

<211> 80

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

agccatctgg ctgccttagt ctccccaacg tcttacggat tagtggttac ggatgtactc 60

gacggatccc tgcagactag 80

<210> 5

<211> 83

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ccaacgggcg ttttccgtaa cactgaaaga atgtaagcgt ttacccacta aggtattttc 60

atgataactt ggtatagcat aca 83

<210> 6

<211> 83

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

cggttgattc gccgtcgcca gaccatcgaa gaattactgg cgctggaatt gctttaactg 60

cgggacggat ccctgcagac tag 83

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

tgcgacagaa acgattcacc 20

<210> 8

<211> 35

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

aggataagcg cagaactaac ccggtactta agcca 35

<210> 9

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

taagtaccgg gttagttctg cgcttatcct ttatggtt 38

<210> 10

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

tctggatagt gttcataagg ctg 23

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

tgtgaattcg acaacgtcct 20

<210> 12

<211> 59

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

tgctagcatt atacctagga ctgagctagc tgtaaactgt ctggagcaga ctcgcaaag 59

<210> 13

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

acgttccgca agtttttgc 19

<210> 14

<211> 59

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

ctagctcagt cctaggtata atgctagcac gtaaccatca tcaataaaac cgatggaag 59

<210> 15

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

ttacagagct ttcaggattg catc 24

<210> 16

<211> 51

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

agcgtggatg caatcctgaa agctctgtaa aatcaacgat gtcaatcagg g 51

<210> 17

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

cccagccact catagaacaa c 21

<210> 18

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

cggccgagat ctttagaatt ccagaaatca tcctta 36

<210> 19

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

ggatccttac tcgagtctag actgcagg 28

<210> 20

<211> 59

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

ttctggaatt ctaaagatct cggccgttga cggctagctc agtcctaggt acagtgcta 59

<210> 21

<211> 59

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

tgagaagaac ctcaggcatg cgtccattgg tggaaactgc tagcactgta cctaggact 59

<210> 22

<211> 57

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

caatggacgc atgcctgagg ttcttctcat gcctgatatg aagctttttg ctggtaa 57

<210> 23

<211> 50

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

tggtatgaaa tttcacacgc attagtgttc gaacatggca gagatcgatt 50

<210> 24

<211> 50

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

ccatgttcga acactaatgc gtgtgaaatt tcataccaca ggcgaaacga 50

<210> 25

<211> 50

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

gttttatttg atgcctggct catttcacaa tggttttgac accgtcaggt 50

<210> 26

<211> 50

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

aaccattgtg aaatgagcca ggcatcaaat aaaacgaaag gctcagtcga 50

<210> 27

<211> 48

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

agactcgagt aaggatcccg ggtataaacg cagaaaggcc cacccgaa 48

<210> 28

<211> 59

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

ttctggaatt ctaaagatct cggccgttta cggctagctc agtcctaggt atagtgcta 59

<210> 29

<211> 59

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 29

gagaagaacc tcaggcatgc gtccattggt ggaaactgct agcactatac ctaggactg 59

<210> 30

<211> 55

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 30

ggcctttttt cgttttggtc ctgcaggatc cttactcgag tctagactgc aggct 55

<210> 31

<211> 59

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 31

taggactgag ctagctgtca aggccggcca tcggccgaga tctttagaat tccagaaat 59

<210> 32

<211> 59

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 32

ttgacagcta gctcagtcct aggtataatg ctagcagagg gcgtgccctt catcatccg 59

<210> 33

<211> 52

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 33

tttcatccgc ttctccttga gaattatttt ttcgcgggtg attacagcag tt 52

<210> 34

<211> 54

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 34

taatcacccg cgaaaaaata attctcaagg agaagcggat gaaacagtat ttga 54

<210> 35

<211> 51

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 35

ttctggaatt tggtaccgag ttattcatga cttacctttg ccagttcact g 51

<210> 36

<211> 59

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 36

gcaaaggtaa gtcatgaata actcggtacc aaattccaga aaagaggcct cccgaaagg 59

<210> 37

<211> 59

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 37

gtaaggatcc tgcaggacca aaacgaaaaa aggcccccct ttcgggaggc ctcttttct 59

<210> 38

<211> 59

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 38

tagggctgag ctagccgtaa aggccggcca tcggccgaga tctttagaat tccagaaat 59

<210> 39

<211> 59

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 39

tttacggcta gctcagccct aggtattatg ctagcagagg gcgtgccctt catcatccg 59

<210> 40

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 40

agatgaacga cgcgagttag 20

<210> 41

<211> 54

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 41

ggtttgcaac cactttagcg ctttgcattt tttcggtact actaagacta ttcg 54

<210> 42

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 42

caaagcgcta aagtggttgc a 21

<210> 43

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 43

ggaatcgacc tgcgacagta a 21

<210> 44

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 44

ataacgaaat tgtccggcag tg 22

<210> 45

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 45

catcgtgggt tttccccaat 20

<210> 46

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 46

ctattgggga aaacccacga tgagccaggt gatttctgaa attc 44

<210> 47

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 47

ccactgctga cacttacttg t 21

<210> 48

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 48

ggtataatac tagttgcgtt gtgtttattt aatgttttag agctagaaat agcaagtt 58

<210> 49

<211> 59

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 49

ggtataatac tagtcgcagg aaatcaatga tcaggtttta gagctagaaa tagcaagtt 59

<210> 50

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 50

actagtatta tacctaggac tgagcta 27

<210> 51

<211> 59

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 51

ggtataatac tagtatcttt ctggttgggc ctatgtttta gagctagaaa tagcaagtt 59

<210> 52

<211> 59

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 52

ggtataatac tagtgtcgaa agggaagagt gggcgtttta gagctagaaa tagcaagtt 59

<210> 53

<211> 59

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 53

agacaataac cctgataaat gcttcaataa taggatcccc gggtaccgag ctcgaattc 59

<210> 54

<211> 59

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 54

gaaagggggg ccttttttcg ttttggtcct gcatactagt agcggccgct gcaggcatg 59

<210> 55

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 55

cgcaggaaat caatgatcag 20

<210> 56

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 56

cagtttacag ctagctcagt cctaggtata atgctagc 38

<210> 57

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 57

tgcgttgtgt ttatttaat 19

<210> 58

<211> 35

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 58

ttgacggcta gctcagtcct aggtacagtg ctagc 35

<210> 59

<211> 129

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 59

ccaggcatca aataaaacga aaggctcagt cgaaagactg ggcctttcgt tttatctgtt 60

gtttgtcggt gaacgctctc tactagagtc acactggctc accttcgggt gggcctttct 120

gcgtttata 129

<210> 60

<211> 35

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 60

tttacggcta gctcagtcct aggtatagtg ctagc 35

<210> 61

<211> 35

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 61

ttgacagcta gctcagtcct aggtataatg ctagc 35

<210> 62

<211> 61

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 62

ctcggtacca aattccagaa aagaggcctc ccgaaagggg ggcctttttt cgttttggtc 60

c 61

<210> 63

<211> 35

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 63

tttacggcta gctcagccct aggtattatg ctagc 35

<210> 64

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 64

atctttctgg ttgggcctat 20

<210> 65

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 65

gtcgaaaggg aagagtgggc 20

Claims

1. A method for increasing the production of compounds and derivatives thereof in the aromatic amino acid biosynthetic pathway in a bacterium, said method comprising modifying said bacterium such that the expression level and/or activity of enzymes in said bacterium that catalyse an irreversible reaction during the oxidative stage of the pentose phosphate pathway is reduced and/or the expression and/or activity of shikimate kinase I and shikimate kinase II is reduced;

wherein the enzyme catalyzing irreversible reaction in the oxidation stage of the pentose phosphate pathway is glucose-6-phosphate dehydrogenase;

wherein the compound in the biosynthesis pathway of the aromatic amino acid and the derivative thereof are 5-hydroxytryptophan; wherein, the starting strain of the bacteria is Escherichia coli W3110, and the modification of the bacteria comprises the following steps: knock-out of the Gene on the E.coli W3110 genometnaA、serA、trpRAndzwf(ii) a And optionally, the modification to the bacterium further comprises any one of:

(1) Overexpression was described by NCBI Gene ID:946628 showpntAAnd with NCBI Gene ID:946144 showpntB，

(2) Shown as NCBI Gene ID:946858glKGene replacement was with NCBI GeneID:945651 showptsGGene knock-out is shown by NCBI Gene ID:947314galRA gene, or

(3) Shown as NCBI Gene ID:946858glKGene replacement was performed with NCBI GeneID:945651 showptsGGene knock-out is shown by NCBI Gene ID:947314galRGenes, and overexpression expressed as NCBI Gene ID:947420 showstktAWith NCBI Gene ID:947407 showrpiA、With NCBI Gene ID:947896 showsrpeAnd with NCBI Gene ID:945772 showprs；

Or the compound in the aromatic amino acid biosynthesis pathway and the derivative thereof are shikimic acid, wherein the starting strain of the bacterium is escherichia coli W3110, and the modifying the bacterium comprises: knock-out of the Gene on the E.coli W3110 genometnaA、serA、trpRAndzwf(ii) a And shown with NCBI Gene ID:946858glKGene replacement was performed with NCBI GeneID:945651 showptsGGene knock-out is shown by NCBI Gene ID:947314galRA gene.

2. Use of a bacterium for the fermentative production of a compound in the biosynthetic pathway of aromatic amino acids and derivatives thereof, wherein the enzyme catalyzing the irreversible reaction during the oxidative phase of the pentose phosphate pathway in said bacterium has a reduced expression level and/or activity and/or the expression and/or activity of shikimate kinase I and shikimate kinase II in said bacterium is reduced; wherein the enzyme catalyzing irreversible reaction in the oxidation stage of the pentose phosphate pathway is glucose-6-phosphate dehydrogenase;

wherein the compound in the biosynthesis pathway of the aromatic amino acid and the derivative thereof are 5-hydroxytryptophan; wherein, the starting strain of the bacterium is Escherichia coli W3110, and the bacterium is modified as follows: knock-out of the Gene on the E.coli W3110 genometnaA、serA、trpRAndzwf(ii) a And optionally, further subjecting the bacterium to any one of the following modifications:

(1) Overexpression was described by NCBI Gene ID:946628 showspntAAnd with NCBI Gene ID:946144 showpntB，

(2) Shown by NCBI Gene ID:946858glKGene replacement was performed with NCBI GeneID:945651 showptsGGene knock-out is shown by NCBI Gene ID:947314galRA gene, or

(3) Shown by NCBI Gene ID:946858glKGene replacement was performed with NCBI GeneID:945651 showptsGGene knock-out is shown by NCBI Gene ID:947314galRGenes, and overexpression expressed as NCBI Gene ID:947420 showtktAThe expression of NCBI Gene ID:947407 showrpiA、With NCBI Gene ID:947896 showsrpeAnd with NCBI Gene ID:945772 showprs；

Or the compound in the aromatic amino acid biosynthesis pathway and the derivative thereof are shikimic acid, wherein the starting strain of the bacterium is escherichia coli W3110, and the bacterium is modified by the following steps: knock-out of the Gene on the E.coli W3110 genometnaA、serA、trpRAndzwf(ii) a And shown with NCBI Gene ID:946858glKGene replacement was performed with NCBI GeneID:945651 showptsGGene deletion and knock-out of NCBI Gene ID:947314galRA gene.

3. The use according to claim 2, wherein the bacterium is Escherichia coli TS412 deposited in China general microbiological culture Collection center (CGMCC) with a collection number of CGMCC No.:14047.

4. a bacterium, wherein said bacterium has a reduced expression level and/or activity of glucose-6-phosphate dehydrogenase and/or wherein shikimate kinase I and shikimate kinase II are knocked out or inactivated;

wherein, the starting strain of the bacterium is Escherichia coli W3110, and the bacterium comprises the following modifications: knock-out of the Gene on the E.coli W3110 genometnaA、serA、trpRAndzwf(ii) a And

optionally, the bacterium further comprises any one of the following modifications:

(1) Overexpression in NCBI Gene ID:946628 showspntAAnd with NCBI Gene ID:946144 showpntBThe gene(s) is (are),

(3) Shown as NCBI Gene ID:946858glKGene replacement was performed with NCBI GeneID:945651 showptsGGene knock-out is shown by NCBI Gene ID:947314galRGenes, and overexpression expressed as NCBI Gene ID:947420 showtktAThe expression of NCBI Gene ID:947407 showrpiA、With NCBI Gene ID:947896 showsrpeAnd with NCBI Gene ID:945772 showprs。