CN109384828B - Penicillium alkali ether A as active matter of medicine-resistant bacteria and its prepn and use - Google Patents

Penicillium alkali ether A as active matter of medicine-resistant bacteria and its prepn and use Download PDF

Info

Publication number
CN109384828B
CN109384828B CN201811308753.3A CN201811308753A CN109384828B CN 109384828 B CN109384828 B CN 109384828B CN 201811308753 A CN201811308753 A CN 201811308753A CN 109384828 B CN109384828 B CN 109384828B
Authority
CN
China
Prior art keywords
penicillium
culture
ether
strain
alkali
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201811308753.3A
Other languages
Chinese (zh)
Other versions
CN109384828A (en
Inventor
张治针
宋腾飞
陈梦宣
连晓媛
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhejiang University ZJU
Original Assignee
Zhejiang University ZJU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhejiang University ZJU filed Critical Zhejiang University ZJU
Priority to CN201811308753.3A priority Critical patent/CN109384828B/en
Publication of CN109384828A publication Critical patent/CN109384828A/en
Application granted granted Critical
Publication of CN109384828B publication Critical patent/CN109384828B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07J—STEROIDS
    • C07J71/00—Steroids in which the cyclopenta(a)hydrophenanthrene skeleton is condensed with a heterocyclic ring
    • C07J71/0036—Nitrogen-containing hetero ring
    • C07J71/0057—Nitrogen and oxygen
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P33/00—Preparation of steroids
    • C12P33/20—Preparation of steroids containing heterocyclic rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07B—GENERAL METHODS OF ORGANIC CHEMISTRY; APPARATUS THEREFOR
    • C07B2200/00—Indexing scheme relating to specific properties of organic compounds
    • C07B2200/07—Optical isomers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Oncology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Communicable Diseases (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention provides an active substance penicillium alkali ether A for resisting drug-resistant bacteria, which is a marine natural active substance with a novel structure, and is obtained by utilizing a known marine penicillium griseum strain ZZ380 through a specific separation culture method, and the compound is proved to have strong activity for inhibiting the growth of methicillin-resistant staphylococcus aureus for the first time, and the effect is particularly obvious. The chemical structural formula of the penicillium alkali ether A is as follows:

Description

Penicillium alkali ether A as active matter of medicine-resistant bacteria and its prepn and use
Technical Field
The invention belongs to the field of medicines, and relates to a penicillium alkali ether A (PenicipyrroetherA) as an anti-drug-resistant bacterium marine active compound, a preparation method of the compound and application of the compound in preparation of a methicillin-resistant staphylococcus aureus medicament.
Background
The drug resistance of pathogenic bacteria caused by antibiotic abuse to antibiotics is continuously enhanced, and the continuous increase of the variety and the number of drug-resistant mutant strains become a great problem threatening the health of human beings. In the case of staphylococcus aureus infections, methicillin-resistant staphylococcus aureus (MRSA), known as a superbacteria, has been infected in a proportion of up to 60%, with 30% of cases developing resistance to vancomycin and showing an increasing trend year by year. Vancomycin is a gold-labeled drug for treating methicillin-resistant staphylococcus aureus infection all the time, but because of the frequent clinical use of vancomycin, the drug resistance of MRSA is continuously enhanced. On the other hand, the rate of emergence of resistant varieties of microorganisms has far exceeded the rate of development of new antibiotics in humans, and how to combat resistant strains, especially methicillin-resistant staphylococcus aureus, has become a worldwide problem.
The special physical and chemical environment of the sea and the biological diversity and complexity force the marine microorganisms to have different metabolic pathways, survival and reproduction modes and adaptation mechanisms from those of the terrestrial microorganisms, so that a plurality of metabolites which are novel in chemical structure and unique in biological activity and cannot be produced by the terrestrial microorganisms are generated and are important resources for finding active substances of novel drug-resistant strains.
Chinese patent (application number: 2018107457853) discloses preparation and application of a drug-resistant bacteria resistant active compound, namely Penicillium griseofulvum alkali diether A, wherein the compound is a metabolite of marine Penicillium griseofulvum ZZ380 in a BMPM culture medium, has a good inhibition effect on the growth of methicillin-resistant staphylococcus aureus, and the MIC (minimum inhibitory concentration) of the compound is 5.0 mug/mL. The invention separates another active compound penicillium alkali ether A (Penicipyrroether A) with a novel structure from fermentation bacteria liquid of different culture mediums (PDB) of the same strain (P.griseofulvum ZZ380), the compound has stronger activity for inhibiting the growth of methicillin-resistant staphylococcus aureus, and the MIC of the compound is 1.7 mug/mL. Therefore, the penicillium alkali ether A has good application prospect in the preparation of the drug-resistant bacteria resistant drugs.
Disclosure of Invention
The invention aims to provide a penicillium alkali ether A (Penicipyrroether A) which is an active substance against drug-resistant bacteria and is a compound penicillium alkali ether A with the activity against methicillin-resistant staphylococcus aureus, wherein the penicillium alkali ether A is a novel compound and has the chemical structural formula as follows:
Figure BDA0001854414560000021
the second object of the present invention is to provide a process for producing the penicillium alkali ether a as an active substance against drug-resistant bacteria, which comprises the following steps:
(1) isolated culture of Penicillium griseofulvum ZZ380
Soaking thick-leg crab (Pachygrapsus crassipes) in 75% ethanol for 10 s to remove surface microorganisms, washing with sterile water for three times, homogenizing, centrifuging, and collecting supernatant to obtain suspension with different concentrations. Taking a certain amount of suspensions with different concentrations to be uniformly dispersed in a culture dish containing a solid culture medium, culturing for a certain time at room temperature, respectively transferring different bacterial colonies to another culture dish containing the solid culture medium, and continuously culturing for a certain time at room temperature. Finally, inoculating the well-grown single colony (ZZ380) to a slant culture medium for culture, and then storing the culture in a refrigerator at 4 ℃ for later use.
The thick-leg crabs (Pachygrapsus crassipes) are obtained from rock seams of the beach of Putuo mountain of Zhejiang; the concentration of the suspension is 1 x 10-3～1×10-1(1 mL of supernatant obtained by homogenizing and centrifuging was added with 9mL of sterile water to prepare a 10 vol.% concentrate-1Diluting the sample suspension one by one to obtain a volume concentration of 10-2And 10-3The sample suspension of (a); the sampling amount of the sample suspension is 100-300 mu L; the solid culture medium contained in the culture dish is potato dextrose agar (PDA, 6g of potato powder, 20g of glucose, 20g of agar, 0.1 g of chloramphenicol, purchased from Hangzhou microbial agent Co., Ltd.) culture medium; the slant culture medium is PDA.
The room temperature condition is as follows: the culture temperature is 22-28 ℃, and the culture time is 5-15 days.
(2) Identification of Penicillium griseofulvum ZZ380 strain
The strain ZZ380 obtained by separation and culture in the step (1) is identified by an ITS rDNA sequence analysis method commonly used in the current laboratory, is determined to be Penicillium griseofulvum ZZ380 and is classified and named as Penicillium griseofulvum ZZ380, and is preserved by China center for type culture Collection-Wuhan center with the preservation number of CCTCC M2018344 and the preservation date: 2018.6.4, respectively; and (4) storage address: wuhan, Wuhan university.
(3) Preparation of Penicillium griseofulvum ZZ380 fermentation broth
Inoculating strain of Penicillium griseofulvum ZZ380 into a large triangular flask containing a certain amount of strain culture medium, and performing shake culture on a culture solution containing ZZ380 strain at room temperature for a certain time to obtain a strain solution. And finally transferring the strain liquid into a large triangular flask containing a certain amount of liquid culture medium, and performing static culture at a specific temperature for a certain time to obtain the zymogen liquid containing the active substance penicillium alkali ether A.
The strain culture medium and the liquid fermentation culture medium are both potato-glucose broth (PDB, 100g of potatoes, 10g of glucose, 35g of sea salt and 1L of water) liquid culture medium, and the dosage is 250 mL; the volume of the large triangular culture bottle is 500 mL; the culture temperature is 28 ℃; the culture time is 30 days.
(4) Extraction, separation and purification of penicillium alkali ether A
The zymocyte liquid of the strain ZZ380 is separated into a fermentation mycelium and a fermentation liquid after centrifugation. The mycelium was extracted with methanol to obtain a methanol extract, and the fermentation broth was extracted with ethyl acetate to obtain an ethyl acetate extract. The methanol extract and the ethyl acetate extract were combined to obtain the total extract. Separating the total extract by octadecylsilane chemically bonded silica (ODS) column chromatography, eluting with 40%, 60%, 80% and 100% methanol respectively to obtain components I-IV, and separating and purifying component IV by preparative high performance liquid chromatography to obtain pure compound penicillium alkali ether A.
The ratio of the ODS dosage of column chromatography to the sample amount of the upper column is 30-50 g:1.0 g; the high performance liquid phase separation conditions are Shimadzu LC-20AP high performance liquid chromatograph, Fuji C18CT-30 column (280X 30mm,10 μm), methanol and water as mobile phase (91/9, volume ratio), detection wavelength 210nm, flow rate 15.0 mL/min.
(5) Structural identification of penicillium alkali ether A
The structure of the penicillium alkali ether A is determined by combining methods such as ultraviolet spectrum, one-dimensional and two-dimensional nuclear magnetic resonance spectrum, high-resolution mass spectrum data, single crystal X-ray diffraction and the like.
The third purpose of the invention is to provide the application of the penicillium alkali ether A in the preparation of the medicines for inhibiting the growth of the methicillin-resistant staphylococcus aureus, the penicillium alkali ether A has a very obvious effect in inhibiting the growth of the methicillin-resistant staphylococcus aureus, can form a medicine with a pharmaceutically acceptable carrier, and is used for treating the methicillin-resistant staphylococcus aureus infection.
In a word, the invention utilizes a known marine penicillium griseum strain ZZ380 to obtain a marine natural active substance penicillium alkali ether A with a novel structure through a specific separation culture method, and proves that the compound has strong activity of inhibiting the growth of methicillin-resistant staphylococcus aureus for the first time, has a particularly remarkable effect, can provide a new drug molecule for the effective treatment of methicillin-resistant staphylococcus aureus infection, overcomes the defect of drug resistance of the existing antibiotic drug to methicillin-resistant staphylococcus aureus infection, and has wider application prospect in the aspect of preparing the drug-resistant bacteria resistant drug.
Drawings
FIG. 1 is a colony map of Penicillium griseofulvum ZZ 380.
FIG. 2 is a UV spectrum of Penicillium alkali ether A (Penicipyrroether A).
FIG. 3 shows a high resolution mass spectrum of Penicillium alkali ether A (Penicipyrroether A).
FIGS. 4 to 6 show the hydrogen spectra of Penicillium alkali ether A (Penicipyrroether A).
FIGS. 7 to 9 show the carbon spectra of Penicillium alkali ether A (Penicipyrroether A).
FIG. 10 shows the preparation of penicillium base ether A (Penicipyrrodiether A)1H-1H COSY spectrum
FIG. 11 is the HSQC spectra of Penicillium alkali ether A (Penicipyrroether A)
FIG. 12 is an HMBC spectrum of penicillium base ether A (Penicipyrroether A).
FIG. 13 is a single crystal X-ray diffraction pattern of Penicillium alkali ether A (Penicipyrroether A).
FIG. 14 is a drawing of Penicillium base Ether A (Penicipyrroether A)1H-1Schematic relating to H COSY and HMBC.
DETAILED DESCRIPTION OF EMBODIMENT (S) OF INVENTION
The invention is described in further detail below with reference to the figures and examples. However, the present invention is not limited to these examples.
Example 1 isolation and cultivation of Penicillium griseofulvum ZZ380
Weighing thick-leg crab (Pachygrapus crassifolia) (20.1 g), soaking in 75% ethanol for 10 s to remove surface microorganisms, washing with sterile water for three times, homogenizing, centrifuging, and collecting supernatant to obtain a volume concentration of 1 × 10-1、1×10-2、1×10-3The sample solution (1 mL of the supernatant obtained by homogenizing and centrifuging, 9mL of sterile water was added to the homogenate to prepare a 10 vol.% solution-1And diluting the sample solution by times to obtain a volume concentration of 10-2And 10-3The sample solution of (a). 200 mul of each concentration of sample solution was uniformly dispersed in a petri dish containing a solid medium of potato dextrose agar (PDA, potato starch 6g, glucose 20g, agar 20g, chloramphenicol 0.1 g, available from hangzhou microbial agents, ltd.), and after 5 days of culture at 28 ℃, different colonies were transferred to another petri dish containing a solid medium of PDA, respectively, and further cultured for 5 days at 28 ℃. Finally, inoculating the single colony (ZZ380) with good growth to a PDA solid slant culture medium for culture, and storing in a refrigerator at 4 ℃ for later use.
Example 2 identification of the species Penicillium griseofulvum ZZ380
The species of the obtained strain ZZ380 was identified using ITS rDNA sequence analysis.
2.1 Experimental reagents and instruments
PCR reagents PrimeSTAR Max DNApolymerase (TaKaRa), primers (synthesized by Invitrogen) with the following sequences:
Figure BDA0001854414560000041
Marker:DL2000
an experimental instrument: centrifuge, electrophoresis apparatus, PCR apparatus, ABI 3730XL sequencer.
2.2 Experimental procedures
2.2.1 fungal genomic DNA extraction
The Ezup column type fungal genome DNA extraction kit (raw) is used, and the fungi are ground by liquid nitrogen before use.
2.2.2 detection of fungal genomic DNA concentration and quality
DNA concentration and quality were determined using a Nanodrop ultramicro spectrophotometer.
2.2.3 PCR amplification
PCR reaction System
Figure BDA0001854414560000051
PCR reaction conditions
98℃2min
Figure BDA0001854414560000052
72℃10min
10℃∞
c. Electrophoretic detection
Electrophoresis on 1% agarose gel for 150v,22min
The sample Loading amount is 4 mul, the Loading buffer is 2 mul and the Marker is 4 mul
d. Sequencing, gel cutting, purifying and sequencing
e. And analyzing the result, namely the splicing sequence.
2.3 results of the experiment
The sequences after splicing are:
CTTCCGTAGGGGGACCTGCGGAAGGATCATTACCGAGTGCGGGCCCCTCGGGGCCCAACCTCCCACCCGTGTTGCCCGAACCTATGTTGCCTCGGCGGGCCCCGCGCCCGCCGACGGCCCCCCTGAACGCTGTCTGAAGTTGCAGTCTGAGACCTATAACGAAATTAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCCCCCCGCCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCACCCGCTCTAGTAGGCCCGGCCGGCGCCAGCCGACCCCCAACCTTTAATTATCTCAGGTTGACCTCGGATCAGAGTCAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA
the ITS rDNA sequence obtained above was compared with the NCBI GenBank database of NIH in the United states, and the result showed that the ITS rDNA sequence of strain ZZ380 has 99% similarity with the ITS rDNA sequence of Penicillium griseofulvum in the GenBank database (accession No.: KF 811439.1). Thus, the marine strain ZZ380 obtained according to the invention is defined as Penicillium griseofulvum ZZ380 (FIG. 1). The strain of Penicillium griseofulvum ZZ380 has been preserved by China center for type culture Collection, Wuhan center, with the preservation number of CCTCC M2018344, preservation date: 2018.6.4, deposit address: wuhan, Wuhan university.
Example 3 preparation of Penicillium griseofulvum ZZ380 Zymobacter griseofulvum
Penicillium griseofulvum ZZ380 on PDA solid slant medium was picked and inoculated into a 500mL Erlenmeyer flask containing 250mL potato-glucose broth (PDB, potato 100g, glucose 10g, sea salt 35g, water 1L) liquid medium. The culture broth containing ZZ380 strain was subjected to shaking culture at 28 ℃ for 3 days with rotation (180rpm) to obtain a strain broth. 5mL of the resulting culture broth was transferred to a 500mL Erlenmeyer flask containing 250mL of PDB, and the resulting culture broth was subjected to static culture at 28 ℃ for 30 days to obtain a fermentation broth containing the active substance penicillanine A.
Example 4 extraction, separation and purification of Penicillium alkaline Ether A (Penicipyrroether A)
The fermentation broth (55.0 l) obtained in experiment 3 was centrifuged to obtain mycelia and broth. The mycelia were extracted three times with methanol to give a methanol extract, the bacterial solution was extracted with ethyl acetate to give an ethyl acetate extract, and the total extracts (23.0g) were combined. The total extract was separated by ODS (900g) column chromatography, and eluted with mixed solvents (40/60,60/40,80/20,100/0, vol.) of methanol and water, respectively, to give fractions I to IV in total. Wherein the component IV (0.19g) is separated by semi-preparative high performance liquid chromatograph (instrument: Shimadzu LC-20 AP; chromatographic column: Fuji C)18CT-30,280 is multiplied by 30mm,10 mu m; mobile phase methanol/water system, volume ratio 91/9; the detection wavelength was 210nm, and the flow rate was 15.0mL/min), thereby obtaining penicillium alkali ether A (16.1mg, retention time 41.0 min).
Example 5 structural identification of Penicillium base Ether A (Penicipyrroether A)
Penicillium alkali ether A is colorless massive crystal; molecular formula C32H41NO5；
Figure BDA0001854414560000061
UV (MeOH) lambda spectrum (FIG. 2)max(log ε)202(4.20),229(3.66),278(2.67) nm; high resolution mass spectrum (HRESIMS) (FIG. 3) is M/z [ M + H ]]+520.3063 (calculation C)32H42NO5520.3063) and [ M + Na]+542.2877 (calculation C)32H41NNaO5,542.2882). By penicillium base ether A1H spectrum (shown in figures 4-6),13Spectrum C (shown in figures 7-9),1H-1H COSY spectrum (figure 10), HSQC spectrum (figure 11), HMBC spectrum (figure 12) and X-ray single crystal diffraction (figure 13) determine the structure of penicillium alkali ether A, and the penicillium alkali ether A is a new compound13C and1the H nuclear magnetic resonance signals are assigned in the table I. It1H-1The related schematic diagram of H COSY and HMBC is shown in figure 14.
Figure BDA0001854414560000071
TABLE 1 preparation of Penicillium base ethers A13C and1h NMR data (solvent: deuterated pyridine)
Figure BDA0001854414560000072
aDescription of the drawings: deltaHThe signal of 7.22 overlaps with that of the deuterated solvent pyridine.
Example 6 antibacterial Activity of Penicillium alkali Ether A (Penicipyrroether A)
The method comprises the following steps of measuring the effect of penicillium alkali ether A on inhibiting the growth of methicillin-resistant staphylococcus aureus (MRSA) by adopting a nutrient broth dilution method, and simultaneously measuring the antibacterial activity of penicillium griseofulensis alkali diether A (penicillium griseofulensis diether A) provided by CN201810745785.3, wherein the method comprises the following specific operations:
inoculating methicillin-resistant staphylococcus aureus (MRSA) on a Nutrient Agar (Nutrient Agar, NA, Hangzhou microbial agent Co., Ltd.) plate, placing the plate on a constant temperature incubator at 37 ℃ for culturing for 24h, picking out a single colony, inoculating the single colony on a Nutrient Broth culture medium (Nutrient Broth, NB, Hangzhou microbial agent Co., Ltd.), and culturing at 37 ℃ for 10h under constant temperature oscillation (180rpm) to obtain a bacterial liquid. And (3) detecting the OD value of the bacterial liquid at the wavelength of 550nm by taking an NB culture medium as a reference, and controlling the OD value to be within the range of 0.08-0.1.
Preparing mother liquor with a certain concentration (1mg/mL, which can be properly adjusted according to preset detection concentration) from the two samples by using dimethyl sulfoxide, filtering and sterilizing the mother liquor by using a sterile organic filter head with the thickness of 0.22 mu m, adding the mother liquor into a 96-well plate, adding a certain amount of NB culture medium and 2 mu L of the bacterial liquid, and enabling the final volume in each hole to be 200 mu L and the concentration of the bacterial liquid to be 106CFU/mL, and the sample concentration is the preset detection concentration. Dimethyl sulfoxide and gentamicin are respectively used as negative and positive control drugs, and are subjected to static culture at the constant temperature of 37 ℃ for 12 hours.
And inoculating the culture in the hole which is not turbid and has the lowest administration concentration to an NA plate, standing and culturing at the constant temperature of 37 ℃ for 12h, wherein if no visible colony grows, the corresponding concentration of the hole is the lowest bactericidal concentration (MBC) of the sample, and if the visible colony grows, the corresponding administration concentration of the hole is the lowest bacteriostatic concentration (MIC) of the sample.
The experimental results show that the penicillium alkali ether A can obviously inhibit the growth of methicillin-resistant staphylococcus aureus (MRSA), and the MIC value is 1.7 mu g/mL (3.28 mu M), while the MIC of the penicillium griseofulvin diether A for the drug-resistant activity is 5.0 mu g/mL (7.02 mu M). The experimental result shows that the penicillium alkali ether A has good inhibition effect on the growth of drug-resistant bacteria MRSA, the activity of the penicillium alkali ether A is obviously stronger than that of penicillium griseofulvin diether A, and the MIC value (1.47 mu M) of the penicillium alkali diether A is closer to that of a positive control drug gentamicin. The experimental result shows that the penicillium alkali ether A has better inhibition effect on the growth of the drug-resistant bacteria MRSA and has better application prospect in the aspect of preparing the drug for resisting the drug-resistant bacteria MRSA infection.
In conclusion, the invention identifies a new active compound Penicillium alkali ether A resisting methicillin-resistant staphylococcus aureus from marine Penicillium griseofulvum ZZ 380. The invention provides a preparation method of penicillium alkali ether A, and discovers that penicillium alkali ether A has the activity of obviously inhibiting the growth of methicillin-resistant staphylococcus aureus. As the penicillium alkali ether A has good activity of resisting methicillin-resistant staphylococcus aureus, the penicillium alkali ether A has application prospect in the aspect of preparing medicines for treating methicillin-resistant staphylococcus aureus infection.
Sequence listing
<110> Zhejiang university
<120> active substance penicillium alkali ether A for resisting drug-resistant bacteria, preparation and application thereof
<160>3
<170>SIPOSequenceListing 1.0
<210>1
<211>22
<212>DNA
<213> Artificial sequence (Unknown)
<400>1
cttggtcatt tagaggaagt aa 22
<210>2
<211>20
<212>DNA
<213> Artificial sequence (Unknown)
<400>2
gctgcgttct tcatcgatgc 20
<210>3
<211>558
<212>DNA
<213> Penicillium griseofulvum ZZ380)
<400>3
cttccgtagg gggacctgcg gaaggatcat taccgagtgc gggcccctcg gggcccaacc 60
tcccacccgt gttgcccgaa cctatgttgc ctcggcgggc cccgcgcccg ccgacggccc 120
ccctgaacgc tgtctgaagt tgcagtctga gacctataac gaaattagtt aaaactttca 180
acaacggatc tcttggttcc ggcatcgatg aagaacgcag cgaaatgcga taactaatgt 240
gaattgcaga attcagtgaa tcatcgagtc tttgaacgca cattgcgccc tctggtattc 300
cggagggcat gcctgtccga gcgtcattgc tgccctcaag cccggcttgt gtgttgggcc 360
ccgtcccccc cgccgggggg acgggcccga aaggcagcgg cggcaccgcg tccggtcctc 420
gagcgtatgg ggcttcgtca cccgctctag taggcccggc cggcgccagc cgacccccaa 480
cctttaatta tctcaggttg acctcggatc agagtcaggg atacccgctg aacttaagca 540
tatcaataag cggaggaa 558

Claims (5)

1. A penicillium alkali ether A as an active substance against drug-resistant bacteria has a chemical structural formula as follows:
Figure FDA0001854414550000011
2. the process for producing penicilline ether A as an active substance against drug-resistant bacteria according to claim 1, which comprises the steps of:
(1) isolated culture of Penicillium griseofulvum
Soaking thick-leg crabs (Pachygraps crassipes) in 75% ethanol for 10 seconds to remove surface microorganisms, then cleaning the thick-leg crabs with sterile water for three times, homogenizing, centrifuging, taking supernatant to prepare suspensions with different concentrations, taking suspensions with different concentrations to be uniformly dispersed in a culture dish containing a solid culture medium, respectively transferring different bacterial colonies to another culture dish containing the solid culture medium after culturing at room temperature, continuously culturing at room temperature, finally inoculating a single bacterial colony which grows well to the slant culture medium, and storing in a refrigerator at 4 ℃ for later use; the solid culture medium is potato glucose agar, and the room temperature conditions are as follows: the temperature is 22-28 ℃, and the culture time is 5-15 days;
(2) identification of strains of penicillium griseofulvum
The strain obtained by the separation culture in the step (1) is identified by an ITS rDNA sequence analysis method commonly used in laboratories at present, is determined to be Penicillium griseofulvum ZZ380 by classification and is preserved by China center for type culture Collection-Wuhan center with the preservation number of CCTCC M2018344 and the preservation date: 2018.6.4, respectively; and (4) storage address: wuhan, Wuhan university;
(3) preparation of Penicillium griseofulvum zymocyte liquid
Inoculating a strain of penicillium griseum into a large triangular flask containing a strain culture medium, carrying out shake culture on a culture solution containing ZZ380 strain at room temperature to obtain a strain solution, transferring the strain solution into the large triangular flask containing a liquid culture medium, and carrying out standing culture at a specific temperature to obtain a zymogen solution containing an active substance, namely penicillium alkali ether A;
(4) extraction, separation and purification of penicillium alkali ether A
Centrifuging a zymophyte liquid of the strain ZZ380, then dividing the zymophyte liquid into a fermentation mycelium part and a fermentation liquid part, extracting the mycelium part with methanol to obtain a methanol extract, extracting the fermentation liquid with ethyl acetate to obtain an ethyl acetate extract, combining the methanol extract and the ethyl acetate extract to obtain a total extract, carrying out chromatographic separation on the total extract by using an octadecylsilane chemically bonded silica gel column, eluting with 40%, 60%, 80% and 100% of methanol respectively to obtain components I-IV, and separating and purifying the component IV by using a preparative high performance liquid chromatograph to obtain a pure compound penicillium alkali ether A;
(5) structural identification of penicillium alkali ether A
The structure of the penicillium alkali ether A is determined by combining methods such as ultraviolet spectrum, one-dimensional and two-dimensional nuclear magnetic resonance spectrum, high-resolution mass spectrum data, single crystal X-ray diffraction and the like.
3. The process for preparing penicilline A as an active ingredient against drug-resistant bacteria according to claim 2, wherein said culture medium and said liquid medium in step (3) are both potato-dextrose broth liquid medium, and said amount is 250 mL; the specific temperature was 28 ℃ and the incubation time was 30 days.
4. The method for preparing penicillium alkali ether A as an active substance against drug-resistant bacteria according to claim 2, wherein the ratio of the amount of the column chromatography in the step (4) to the amount of the sample loaded on the column is 30-50 g:1.0 g; the high performance liquid phase separation conditions are Shimadzu LC-20AP high performance liquid chromatograph, Fuji C18The CT-30 chromatographic column is 280 mm multiplied by 30mm,10 mu m, the methanol and the water are in a mobile phase volume ratio of 91/9, the detection wavelength is 210nm, and the flow rate is 15.0 mL/min.
5. The use of the active substance penicillium alkali ether a against drug-resistant bacteria according to claim 1 in the manufacture of a medicament for inhibiting the growth of methicillin-resistant staphylococcus aureus.
CN201811308753.3A 2018-11-05 2018-11-05 Penicillium alkali ether A as active matter of medicine-resistant bacteria and its prepn and use Active CN109384828B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201811308753.3A CN109384828B (en) 2018-11-05 2018-11-05 Penicillium alkali ether A as active matter of medicine-resistant bacteria and its prepn and use

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201811308753.3A CN109384828B (en) 2018-11-05 2018-11-05 Penicillium alkali ether A as active matter of medicine-resistant bacteria and its prepn and use

Publications (2)

Publication Number Publication Date
CN109384828A CN109384828A (en) 2019-02-26
CN109384828B true CN109384828B (en) 2020-04-10

Family

ID=65428451

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201811308753.3A Active CN109384828B (en) 2018-11-05 2018-11-05 Penicillium alkali ether A as active matter of medicine-resistant bacteria and its prepn and use

Country Status (1)

Country Link
CN (1) CN109384828B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110218759B (en) * 2019-05-13 2020-12-15 浙江大学 Preparation and application of anti-glioma active substance penicillium alkali ether A

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103255061A (en) * 2012-02-15 2013-08-21 中国医学科学院医药生物技术研究所 Penicillium griseofulvum, antibacterial active compound generated thereby and application

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103255061A (en) * 2012-02-15 2013-08-21 中国医学科学院医药生物技术研究所 Penicillium griseofulvum, antibacterial active compound generated thereby and application

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
海洋真菌灰黄青霉Penicillium griseofulvum次级代谢产物中一个新的内酯醛结构;徐燕等;《天然产物研究与开发》;20151231;第27卷;第559-561页 *
灰黄霉素的研究进展;朱育菁等;《厦门大学学报（自然科学版）》;20100531;第49卷(第3期);第435-439页 *

Also Published As

Publication number Publication date
CN109384828A (en) 2019-02-26

Similar Documents

Publication Publication Date Title
Chen et al. Growth promotion and disease suppression ability of a Streptomyces sp. CB-75 from banana rhizosphere soil
Jing et al. Newly isolated Streptomyces sp. JBS5-6 as a potential biocontrol agent to control banana Fusarium wilt: genome sequencing and secondary metabolite cluster profiles
Sun et al. Antifungal and cytotoxic activities of the secondary metabolites from endophytic fungus Massrison sp.
Liu et al. Endophytic Streptomyces sp. Y3111 from traditional Chinese medicine produced antitubercular pluramycins
CN111979150A (en) Marine streptomyces and isolated culture method and application thereof
CN106434372B (en) Application of coral-derived fungus aspergillus terreus strain C21-10
CN104450580B (en) Preparation method and application of actinomycin D
Ma et al. Antimicrobial compounds were isolated from the secondary metabolites of Gordonia, a resident of intestinal tract of Periplaneta americana
CN108913606B (en) Marine anti-drug-resistant bacterium active substance, preparation and application thereof
Wahaab et al. Bioprospecting marine actinomycetes for multidrug-resistant pathogen control from Rameswaram coastal area, Tamil Nadu, India
CN108794368B (en) Alkaloid compound with diverse antibacterial activities and preparation method and application thereof
CN109384828B (en) Penicillium alkali ether A as active matter of medicine-resistant bacteria and its prepn and use
Zhou et al. Anti-mycobacterium tuberculosis active metabolites from an endophytic Streptomyces sp. YIM65484
CN109280034B (en) Benzoxazepine compound with antibacterial activity and preparation method and application thereof
WO2010115802A1 (en) New actinomycetes strain compositions and their use for the prevention and/or the control of micro organism inducing plant diseases
Sunaryanto et al. Marine Actinomycetes screening of Banten West Coast and their antibiotics purification
CN108102933B (en) Streptomyces alboflavus strain and application thereof
Bandara et al. A 3-vinyl cephem derivative, a useful intermediate in the synthesis of cepham antibiotics, from Aspergillus awamori associated with banana fruit
CN106701602B (en) Fusarium chlamydosporia and application thereof
Ming-Wei et al. Phytotoxic and antimicrobial metabolites from Paraphaeosphaeria sp. QTYC11 isolated from the gut of Pantala flavescens larvae
CN108441427B (en) Arthriospora fungi and pyridone alkaloid compound produced by same
Damayanti et al. Antiplasmodial activity, biosynthetic gene clusters diversity, and secondary metabolite constituent of selected Indonesian Streptomyces
JC et al. Production and toxicological evaluation of prodigiosin from Serratia marcescens UCP/WFCC1549 on mannitol solid medium
CN114380782A (en) Compound, preparation method and application of bactericide in preventing and treating rubber anthracnose
CN108191879A (en) One kind has antibacterial active compounds and its method for preparing purified and application

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant