CN109384828A - Antimicrobial agent active material mould alkali ether A and preparation and use - Google Patents

Antimicrobial agent active material mould alkali ether A and preparation and use Download PDF

Info

Publication number
CN109384828A
CN109384828A CN201811308753.3A CN201811308753A CN109384828A CN 109384828 A CN109384828 A CN 109384828A CN 201811308753 A CN201811308753 A CN 201811308753A CN 109384828 A CN109384828 A CN 109384828A
Authority
CN
China
Prior art keywords
mould alkali
alkali ether
ether
liquid
active material
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201811308753.3A
Other languages
Chinese (zh)
Other versions
CN109384828B (en
Inventor
张治针
宋腾飞
陈梦宣
连晓媛
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhejiang University ZJU
Original Assignee
Zhejiang University ZJU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhejiang University ZJU filed Critical Zhejiang University ZJU
Priority to CN201811308753.3A priority Critical patent/CN109384828B/en
Publication of CN109384828A publication Critical patent/CN109384828A/en
Application granted granted Critical
Publication of CN109384828B publication Critical patent/CN109384828B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07J—STEROIDS
    • C07J71/00—Steroids in which the cyclopenta(a)hydrophenanthrene skeleton is condensed with a heterocyclic ring
    • C07J71/0036—Nitrogen-containing hetero ring
    • C07J71/0057—Nitrogen and oxygen
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P33/00—Preparation of steroids
    • C12P33/20—Preparation of steroids containing heterocyclic rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07B—GENERAL METHODS OF ORGANIC CHEMISTRY; APPARATUS THEREFOR
    • C07B2200/00—Indexing scheme relating to specific properties of organic compounds
    • C07B2200/07—Optical isomers

Landscapes

  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Zoology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Oncology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Communicable Diseases (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The present invention provides a kind of antimicrobial agent active material mould alkali ether A, it is the marine natural bioactive products of a structure novel, utilize known one plant of ocean Penicillium griseofulvum bacterial strain ZZ380, it is obtained by particular separation cultural method, and the activity that the compound has the growth of strong inhibition methicillin-resistant staphylococcus aureus is demonstrated for the first time, effect is particularly significant, the present invention overcomes existing antibiotic medicine to infect drug resistant deficiency to methicillin-resistant staphylococcus aureus, the mould alkali ether A has more broad application prospect in terms of preparing drug-resistance bacteria medicine, the effective treatment that can be infected for methicillin-resistant staphylococcus aureus provides a kind of new drug molecule.The chemical structural formula of the mould alkali ether A are as follows:

Description

Antimicrobial agent active material mould alkali ether A and preparation and use
Technical field
The invention belongs to field of medicaments, are related to antimicrobial agent marine active compound mould alkali ether A (Penicipyrroether ) and the preparation of the compound and the application in terms of preparing methicillin-resistant staphylococcus aureus resistance drug A.
Background technique
Pathogenic bacteria caused by abuse of antibiotics constantly enhance the drug resistance of antibiotic, the type sum number of medicament-resistant mutation bacterial strain Amount is increasing a great difficult problem for having become and threatening human health.In the case of infection of staphylococcus aureus, claimed For methicillin-resistant staphylococcus aureus (the methicillin-resistant Staphylococcus of superbacteria Aureus, MRSA) infection proportion be up to 60%, wherein 30% case produces drug resistance to vancomycin and is in The trend risen year by year.Vancomycin is the gold mark drug for treating methicillin-resistant staphylococcus aureus infection all the time, However due to vancomycin clinically frequently using and cause MRSA constantly to enhance its drug resistance.On the other hand, microorganism There is the rate of drug resistance mutation considerably beyond the speed of human development new antibiotic, how to fight antibody-resistant bacterium especially It is that methicillin-resistant staphylococcus aureus has become global problem.
The special physicochemical environment in ocean and bio-diversity and complexity force marine microorganism to have and land The different metabolic pathway of microorganism lives and reproduces mode and adaptation mechanism, thus many land microorganisms of generation can not produce Raw chemical structure novelty and the unique metabolite of bioactivity are the important money for finding novel overriding resistance bacterial strain active material Source.
Chinese patent (application number: 2018107457853) discloses antimicrobial agent reactive compound Penicillium griseofulvum alkali bis ether A Preparation and use, which is ocean Penicillium griseofulvum (Penicillium griseofulvum ZZ380) cultivates in BMPM The metabolite generated in base, to the inhibiting effect that the growth of methicillin-resistant staphylococcus aureus has had, MIC is (most Low Mlc) it is 5.0 μ g/mL.Different culture medium (PDB) of the present invention from same bacterial strain (P.griseofulvum ZZ380) Zymocyte liquid in another isolated structure novel reactive compound mould alkali ether A (Penicipyrroether A), The compound inhibits the activity of methicillin-resistant staphylococcus aureus growth stronger, and MIC is 1.7 μ g/mL.Therefore mould alkali The application prospect that ether A has had in terms of preparing drug-resistance bacteria medicine.
Summary of the invention
The first purpose of the invention is to provide a kind of antimicrobial agent active material mould alkali ether A (Penicipyrroether A) is a kind of with the active compound mould alkali ether of methicillin-resistant staphylococcus aureus resistance A, the mould alkali ether A are a new chemical combination, chemical structural formula are as follows:
A second object of the present invention is to provide the preparation methods of the antimicrobial agent active material mould alkali ether A, lead to Following steps are crossed to be separately cultured and obtain:
(1) Penicillium griseofulvum (Penicillium griseofulvum ZZ380) is separately cultured
Big legs thickness line crab (Pachygrapsus crassipes) is taken to impregnate 10 seconds removing surfaces in 75% ethyl alcohol micro- Then biology is homogenized afterwards three times with sterile water wash, upper liquid is taken to be configured to the suspension of various concentration after centrifugation.It takes a certain amount of The uniform suspension of various concentration is distributed in the culture dish containing solid medium, cultivates certain time at room temperature Afterwards, different bacterium colonies is transferred to respectively in another culture dish containing solid medium, continues culture one at room temperature It fixes time.It is standby that well-grown single bacterium colony (ZZ380) is finally inoculated into the 4 DEG C of refrigerators preservations of slant medium culture postposition With.
The big legs thickness line crab (Pachygrapsus crassipes) is from the rock at Zhejiang Mount Putuo seabeach seam It obtains；The concentration of the suspension is 1 × 10-3~1 × 10-1(it is centrifuged resulting supernatant liquid after taking 1mL to be homogenized, 9mL is added Sterile water, being made into volumetric concentration is 10-1Sample suspension, by again dilution obtain volumetric concentration be 10-2With 10-3Sample it is outstanding Supernatant liquid)；The sampling amount of the sample suspension is 100~300 μ L；Solid medium contained by the culture dish is potato (PDA, dehydrated potato powder 6g, glucose 20g, agar 20g, have agar glucose purchased from Hangzhou microorganism reagent by 0.1 gram of chloramphenicol Limit company) culture medium；The slant medium is PDA.
The room temperature condition are as follows: cultivation temperature is 22~28 DEG C, and incubation time is 5~15 days.
(2) strain idenfication of Penicillium griseofulvum (Penicillium griseofulvum ZZ380)
Above-mentioned steps (1) are separately cultured the ITS rDNA sequence that bacterial strain ZZ380 obtained is generally used with current laboratory Column analysis method identifies its type, is determined as Penicillium griseofulvum, and classification naming is Penicillium griseofulvum ZZ380, By China typical culture collection center-Wuhan center preservation, deposit number: CCTCC M 2018344, preservation day: 2018.6.4；Preservation address: the Chinese Wuhan Wuhan University.
(3) preparation of Penicillium griseofulvum (Penicillium griseofulvum ZZ380) zymocyte liquid
The strain of Penicillium griseofulvum (Penicillium griseofulvum ZZ380) is inoculated into containing a certain amount of bacterium In the big conical flask of kind of culture medium, by the culture solution containing ZZ380 strain, shaken cultivation is after a certain period of time at room temperature Obtain strain liquid.Finally strain liquid is transferred in the big conical flask containing a certain amount of fluid nutrient medium, specific temperature is stood Culture after a certain period of time, obtains the zymocyte liquid containing active material mould alkali ether A.
The bacterium culture medium and liquid fermentation medium be Potato-dextrose meat soup (PDB, potato 100g, Glucose 10g, sea salt 35g, water 1L) fluid nutrient medium, the dosage is 250mL；The big triangle culture bottle is 500mL；The cultivation temperature is 28 DEG C；The incubation time is 30 days.
(4) extraction separation and purification of mould alkali ether A
It is divided into fermentation mycelium and fermentation liquid two parts after the zymocyte liquid centrifugation of bacterial strain ZZ380.Mycelium is mentioned with methanol Methanolic extract is obtained, fermentation liquid is extracted with ethyl acetate to obtain acetic acid ethyl ester extract.By methanolic extract and acetic acid second Ester extract merges to obtain total extract.Total extract first uses octadecylsilane chemically bonded silica (ODS) column chromatography for separation, respectively It is eluted with 40%, 60%, 80% and 100% methanol, obtains component I~IV, component IV uses preparative high performance liquid chromatography again Instrument isolates and purifies, and obtains pure compound mould alkali ether A.
The ODS dosage of the column chromatography and the sample size ratio of upper prop are 30~50g:1.0g；The efficient liquid phase point It is from condition: Shimadzu LC-20AP high performance liquid chromatograph, Fuji C18CT-30 chromatographic column (280 × 30mm, 10 μm), first alcohol and water For mobile phase (91/9, volume ratio), Detection wavelength 210nm, flow velocity 15.0mL/min.
(5) Structural Identification of mould alkali ether A
The structure of mould alkali ether A is ultraviolet spectra, the peacekeeping ID NMR speetna, high resolution mass spectrum data according to it And the methods of Advances in crystal X-ray diffraction is combined and is determined.
Third object of the present invention is to provide the antimicrobial agent active material mould alkali ether A to inhibit resistance to first in preparation Application in the drug of oxygen XiLin staphylococcus aureus growth, the mould alkali ether A are inhibiting methicillin-resistant staphylococcus Effect highly significant in staphylococcic growth can form drug with pharmaceutically acceptable carrier, for treating resistance to methoxy west Woods infection of staphylococcus aureus.
In short, the present invention utilizes known one plant of ocean Penicillium griseofulvum bacterial strain ZZ380, by particular separation cultural method, The marine natural bioactive products mould alkali ether A an of structure novel is obtained, and demonstrates the compound for the first time with strong inhibition The activity of methicillin-resistant staphylococcus aureus growth, effect is particularly significant, can be methicillin-resistant staphylococcus aureus Effective treatment of infection provides a kind of new drug molecule, overcomes existing antibiotic medicine to methicillin-resistant staphylococcus grape ball Bacterium infects drug resistant deficiency, and the mould alkali ether A has more broad application prospect in terms of preparing drug-resistance bacteria medicine.
Detailed description of the invention
Fig. 1 is the bacterium colony figure of Penicillium griseofulvum (Penicillium griseofulvum ZZ380).
Fig. 2 is the ultraviolet spectrogram of mould alkali ether A (Penicipyrroether A).
Fig. 3 is the high resolution mass spectrum of mould alkali ether A (Penicipyrroether A).
Fig. 4~6 are the hydrogen spectrums of mould alkali ether A (Penicipyrroether A).
Fig. 7~9 are the carbon spectrums of mould alkali ether A (Penicipyrroether A).
Figure 10 is mould alkali ether A (Penicipyrrodiether A)1H-1H COSY spectrum
Figure 11 is the hsqc spectrum of mould alkali ether A (Penicipyrroether A)
Figure 12 is the HMBC spectrum of mould alkali ether A (Penicipyrroether A).
Figure 13 is the Advances in crystal X-ray diffraction structure chart of mould alkali ether A (Penicipyrroether A).
Figure 14 is mould alkali ether A (Penicipyrroether A)1H-1H COSY and HMBC accompanying drawings.
Specific embodiment
Below in conjunction with drawings and examples, present invention is further described in detail.It is real but the present invention is not restricted to these Apply example.
1. Penicillium griseofulvum of embodiment (Penicillium griseofulvum ZZ380's) is separately cultured
The big legs thickness line crab (Pachygrapsus crassipes) (20.1 grams) for taking weighing, impregnates in 75% ethyl alcohol 10 seconds removing surface microorganisms, are then homogenized afterwards three times with sterile water wash, take supernatant liquid to be configured to volumetric concentration after centrifugation It is 1 × 10-1、1×10-2、1×10-3Sample solution (be centrifuged resulting supernatant liquid after taking 1mL to be homogenized, it is sterile that 9mL be added Water, being made into volumetric concentration is 10-1Sample solution, and by again dilution obtain volumetric concentration be 10-2With 10-3Sample solution). The 200 μ L of sample solution of each concentration is taken to evenly spread to containing potato dextrose agar (PDA, dehydrated potato powder 6g, glucose 20g, agar 20g, 0.1 gram of chloramphenicol, be purchased from Hangzhou microorganism reagent Co., Ltd) solid medium culture dish in, 28 After being cultivated 5 days under the conditions of DEG C, different bacterium colonies is transferred to respectively in another culture dish containing PDA solid medium, 28 Continue culture 5 days under the conditions of DEG C.Well-grown single bacterium colony (ZZ380) is finally inoculated into the training of PDA solid slope culture medium After supporting, it is placed in 4 DEG C of refrigerators and saves backup.
The strain idenfication of 2. Penicillium griseofulvum of embodiment (Penicillium griseofulvum ZZ380)
The type of obtained bacterial strain ZZ380 is identified using ITS rDNA sequence analysis method.
2.1 experiment reagents and instrument
PCR reagent: PrimeSTAR Max DNAPolymerase (TaKaRa), primer (Invitrogen synthesis), primer Sequence is:
Marker:DL2000
Laboratory apparatus: centrifuge, electrophoresis apparatus, PCR instrument, ABI 3730XL sequenator.
2.2 experimental procedure
2.2.1 fungal genomic DNA extracts
Using Ezup pillar fungal genomic DNA extraction agent box (raw work), liquid nitrogen grinding first is carried out to fungi using preceding.
2.2.2 fungal genomic DNA concentration and quality testing
DNA concentration and quality testing are carried out using Nanodrop ultramicrospectrophotometer.
2.2.3 PCR amplification
A.PCR reaction system
B.PCR reaction condition
98℃2min
72℃10min
10℃∞
C. electrophoresis detection
1% agarose gel electrophoresis 150v, 22min
Applied sample amount: 4 μ l, Loading buffer, 24 μ l of μ l, Marker
D. it is sequenced: cutting glue purification sequencing
E. result is analyzed: splicing sequence.
2.3 experimental result
Spliced sequence are as follows:
CTTCCGTAGGGGGACCTGCGGAAGGATCATTACCGAGTGCGGGCCCCTCGGGGCCCAACCTCCCACCCG TGTTGCCCGAACCTATGTTGCCTCGGCGGGCCCCGCGCCCGCCGACGGCCCCCCTGAACGCTGTCTGAAGTTGCAGT CTGAGACCTATAACGAAATTAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGA AATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTC CGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCCCCCCGCCGGG GGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCACCCGCTCTAGTAGG CCCGGCCGGCGCCAGCCGACCCCCAACCTTTAATTATCTCAGGTTGACCTCGGATCAGAGTCAGGGATACCCGCTGA ACTTAAGCATATCAATAAGCGGAGGAA
ITS rDNA sequence achieved above compared with the NCBI GenBank database of U.S. NIH, the result shows that: bacterium The ITS rDNA sequence of strain ZZ380 and the ITS rDNA sequence of the Penicilliumgriseofulvum in the library GenBank have 99% similitude (accession number: KF811439.1).Therefore, present invention marine bacteria strain ZZ380 obtained is set to Penicillium griseofulvum (Penicillium griseofulvumZZ380) (attached drawing 1).Penicillium griseofulvum (Penicillium GriseofulvumZZ380 bacterial strain) is by China typical culture collection center-Wuhan center preservation, deposit number: CCTCC M 2018344, preservation day: 2018.6.4, preservation address: the Chinese Wuhan Wuhan University.
The preparation of 3. Penicillium griseofulvum of embodiment (Penicillium griseofulvumZZ380) zymocyte liquid
Penicillium griseofulvum (Penicillium griseofulvum ZZ380) in picking PDA solid slope culture medium, connects Kind, which arrives, contains 250mL Potato-dextrose meat soup (PDB, potato 100g, glucose 10g, sea salt 35g, water 1L) Liquid Culture In the 500mL conical flask of base.Culture solution containing ZZ380 strain is rotated to (180rpm) shaking culture 3 under the conditions of 28 DEG C Strain liquid is obtained after it.5mL strain liquid is transferred in the 500mL conical flask of the PDB containing 250mL, under the conditions of 28 DEG C Stationary culture 30 days, obtain the zymocyte liquid containing active material mould alkali ether A.
The extraction separation and purification of 4. mould alkali ether A (Penicipyrroether A) of embodiment
(55.0 liters) centrifugations of zymocyte liquid that experiment 3 obtains are obtained into mycelium and bacterium solution.Mycelium extracts three with methanol Secondary to obtain methanolic extract, bacterium solution is extracted with ethyl acetate to obtain acetic acid ethyl ester extract, and merging obtains total extract (23.0g). Total extract ODS (900g) column chromatography for separation, respectively with methanol and water mixed solvent (40/60,60/40,80/20,100/0, body Product ratio) elution, component I~IV is always obtained.Wherein component IV (0.19g) separates (instrument with semipreparative high performance liquid chromatography instrument Device: Shimadzu LC-20AP；Chromatographic column: Fuji C18CT-30,280×30mm,10μm；Mobile phase: methanol/water system, volume ratio 91/ 9；Detection wavelength: 210nm, flow velocity: 15.0mL/min), obtain compound mould alkali ether A (16.1mg, retention time 41.0min)。
The Structural Identification of 5. mould alkali ether A (Penicipyrroether A) of embodiment
Mould alkali ether A: colourless bulk crystals；Molecular formula C32H41NO5；Ultraviolet light Compose (attached drawing 2) UV (MeOH) λmax(logε)202(4.20),229(3.66),278(2.67)nm；High resolution mass spectrum (HRESIMS) (attached drawing 3) is m/z [M+H]+520.3063 (calculated value C32H42NO5, 520.3063) and [M+Na]+542.2877 (calculated values C32H41NNaO5,542.2882).Pass through mould alkali ether A's1H spectrum (attached drawing 4~6),13C spectrum (attached drawing 7~9),1H-1H COSY spectrum (attached drawing 10), hsqc spectrum (attached drawing 11), HMBC spectrum (attached drawing 12) and X-ray single crystal diffraction (attached drawing 13), have determined mould alkali ether A Structure, be a noval chemical compound,13C and1H NMR Assignments are shown in Table one.It1H-1H COSY is related to HMBC Schematic diagram is shown in attached drawing 14.
Table one, mould alkali ether A13C and1H NMR data (solvent: deuterated pyridine)
aIllustrate: δH7.22 signal and the signal overlap of deuterated solvent pyridine.
The antibacterial activity of 6. mould alkali ether A (Penicipyrroether A) of embodiment
Using nutrient broth dilution method, measures mould alkali ether A and inhibit methicillin-resistant staphylococcus aureus (MRSA) raw Long effect, and the Penicillium griseofulvum alkali bis ether A (penicipyrrodiether of CN201810745785.3 offer is provided simultaneously A antibacterial activity), concrete operations are as follows:
Methicillin-resistant staphylococcus aureus (MRSA) is inoculated in nutrient agar (Nutrient Agar, NA, Hangzhou Microorganism reagent Co., Ltd) on plate, after being placed in 37 DEG C of constant incubator cultures for 24 hours, picking single colonie is inoculated in nutrient meat Soup culture medium (Nutrient Broth, NB, Hangzhou microorganism reagent Co., Ltd), 37 DEG C of constant temperature oscillation (180rpm) cultures 10h obtains bacterium solution.Using NB culture medium as reference, the OD value of bacterium solution is detected under 550nm wavelength, is controlled in 0.08~0.1 model In enclosing.
Two samples are configured to a certain concentration with dimethyl sulfoxide respectively, and (1mg/mL, can be suitable according to default detectable concentration When adjustment) mother liquor, be added in 96 orifice plates after 0.22 μm of sterile organic filter filtration sterilization, a certain amount of NB training be then added Base and the 2 above-mentioned bacterium solutions of μ L are supported, the 200 μ L of final volume in each hole, bacterial concentration 10 are made6CFU/mL, sample concentration are Default detectable concentration.Using dimethyl sulfoxide and gentamicin as negative and positive control drug, 37 DEG C of constant temperature stationary cultures 12h。
The culture not become cloudy and in hole that administration concentration is minimum is inoculated in NA plate, 37 DEG C of constant temperature stand training 12h is supported, if growing without visible colonies, then the corresponding concentration in this hole is the minimum bactericidal concentration (MBC) of the sample, there are visible colonies Growth, then the corresponding administration concentration in this hole is the minimum inhibitory concentration (MIC) of the sample.
Experimental result shows that mould alkali ether A can significantly inhibit the life of methicillin-resistant staphylococcus aureus (MRSA) Long, MIC value is 1.7 μ g/mL (3.28 μM), and the Penicillium griseofulvum alkali active MIC of bis ether A antimicrobial agent is 5.0 μ g/mL (7.02μM).Experimental result illustrates that the inhibiting effect that mould alkali ether A has had the growth of drug-fast bacteria MRSA, activity are obvious strong It is more close with the MIC value (1.47 μM) of positive control drug gentamicin in Penicillium griseofulvum alkali bis ether A.Experimental result illustrates blueness Mould alkali ether A has better inhibiting effect to the growth of drug-fast bacteria MRSA, has in terms of preparing antimicrobial agent MRSA infection medicine There is better application prospect.
In short, present invention separation from ocean Penicillium griseofulvum (Penicillium griseofulvumZZ380) identifies The reactive compound mould alkali ether A of one new methicillin-resistant staphylococcus aureus resistance.The present invention provides mould alkali ether A Preparation method, have found mould alkali ether A significantly inhibit methicillin-resistant staphylococcus aureus growth activity.Due to mould Alkali ether A has good methicillin-resistant staphylococcus aureus resistance activity, so mould alkali ether A treats resistance to methoxy west in preparation There is application prospect in terms of the drug of woods infection of staphylococcus aureus.
Sequence table
<110>Zhejiang University
<120>antimicrobial agent active material mould alkali ether A and preparation and use
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213>artificial sequence (Unknown)
<400> 1
cttggtcatt tagaggaagt aa 22
<210> 2
<211> 20
<212> DNA
<213>artificial sequence (Unknown)
<400> 2
gctgcgttct tcatcgatgc 20
<210> 3
<211> 558
<212> DNA
<213>Penicillium griseofulvum (Penicillium griseofulvum ZZ380)
<400> 3
cttccgtagg gggacctgcg gaaggatcat taccgagtgc gggcccctcg gggcccaacc 60
tcccacccgt gttgcccgaa cctatgttgc ctcggcgggc cccgcgcccg ccgacggccc 120
ccctgaacgc tgtctgaagt tgcagtctga gacctataac gaaattagtt aaaactttca 180
acaacggatc tcttggttcc ggcatcgatg aagaacgcag cgaaatgcga taactaatgt 240
gaattgcaga attcagtgaa tcatcgagtc tttgaacgca cattgcgccc tctggtattc 300
cggagggcat gcctgtccga gcgtcattgc tgccctcaag cccggcttgt gtgttgggcc 360
ccgtcccccc cgccgggggg acgggcccga aaggcagcgg cggcaccgcg tccggtcctc 420
gagcgtatgg ggcttcgtca cccgctctag taggcccggc cggcgccagc cgacccccaa 480
cctttaatta tctcaggttg acctcggatc agagtcaggg atacccgctg aacttaagca 540
tatcaataag cggaggaa 558

Claims (5)

1. a kind of antimicrobial agent active material mould alkali ether A, the chemical structural formula of the mould alkali ether A are as follows:
2. the preparation method of antimicrobial agent active material mould alkali ether A described in claim 1, which is characterized in that pass through following step It is rapid to obtain:
(1) Penicillium griseofulvum is separately cultured
Big legs thickness line crab (Pachygrapsus crassipes) is taken to impregnate 10 seconds removing surface microorganisms in 75% ethyl alcohol, Then it is homogenized afterwards three times with sterile water wash, takes upper liquid to be configured to the suspension of various concentration after centrifugation, take various concentration Uniform suspension is distributed in the culture dish containing solid medium, and after cultivating at room temperature, different bacterium colonies is distinguished It is transferred in another culture dish containing solid medium, continues to cultivate at room temperature, it finally will be well-grown single Colony inoculation is saved backup to 4 DEG C of refrigerators of slant medium culture postposition；Solid medium is potato dextrose agar, room temperature Condition are as follows: 22~28 DEG C of temperature, incubation time is 5~15 days；
(2) strain idenfication of Penicillium griseofulvum
Above-mentioned steps (1) are separately cultured the ITS rDNA sequence analysis method that bacterial strain obtained is generally used with current laboratory It identifies its type, is determined as Penicillium griseofulvum, classification naming is Penicillium griseofulvum ZZ380, by Chinese allusion quotation Type culture collection-Wuhan center preservation, deposit number: CCTCC M 2018344, preservation day: 2018.6.4；Preservation Location: the Chinese Wuhan Wuhan University；
(3) preparation of Penicillium griseofulvum zymocyte liquid
The strain of Penicillium griseofulvum is inoculated into the big conical flask containing bacterium culture medium, by the culture containing ZZ380 strain Liquid obtains strain liquid after shaken cultivation at room temperature, and strain liquid is finally transferred to the big conical flask containing fluid nutrient medium In, after specific temperature stationary culture, obtain the zymocyte liquid containing active material mould alkali ether A；
(4) extraction separation and purification of mould alkali ether A
It is divided into fermentation mycelium and fermentation liquid two parts after the zymocyte liquid centrifugation of bacterial strain ZZ380, mycelium is extracted with methanol To methanolic extract, fermentation liquid is extracted with ethyl acetate to obtain acetic acid ethyl ester extract, and methanolic extract and ethyl acetate are extracted Take object to merge to obtain total extract, total extract first uses octadecylsilane chemically bonded silica column chromatography for separation, respectively with 40%, 60%, 80% and 100% methanol elution, obtains component I~IV, and component IV uses the separation of preparative high performance liquid chromatography instrument pure again Change, obtains pure compound mould alkali ether A；
(5) Structural Identification of mould alkali ether A
The structure of mould alkali ether A be according to its ultraviolet spectra, a peacekeeping ID NMR speetna, high resolution mass spectrum data and The methods of Advances in crystal X-ray diffraction is combined and is determined.
3. the preparation method of antimicrobial agent active material mould alkali ether A according to claim 2, which is characterized in that step (3) The bacterium culture medium and fluid nutrient medium is Potato-dextrose meat soup fluid nutrient medium, and the dosage is 250mL；Specific temperature is 28 DEG C, and incubation time is 30 days.
4. the preparation method of antimicrobial agent active material mould alkali ether A according to claim 2, which is characterized in that step (4) The dosage of the column chromatography and the sample size ratio of upper prop are 30~50g:1.0g；The efficient liquid phase separation condition is: island Saliva LC-20AP high performance liquid chromatograph, Fuji C18280 × 30mm of CT-30 chromatographic column, 10 μm, first alcohol and water is mobile phase volume Than 91/9, Detection wavelength 210nm, flow velocity 15.0mL/min.
5. antimicrobial agent active material mould alkali ether A according to claim 1 inhibits methicillin-resistant staphylococcus in preparation Application in the drug of aureus growth.
CN201811308753.3A 2018-11-05 2018-11-05 Penicillium alkali ether A as active matter of medicine-resistant bacteria and its prepn and use Active CN109384828B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201811308753.3A CN109384828B (en) 2018-11-05 2018-11-05 Penicillium alkali ether A as active matter of medicine-resistant bacteria and its prepn and use

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201811308753.3A CN109384828B (en) 2018-11-05 2018-11-05 Penicillium alkali ether A as active matter of medicine-resistant bacteria and its prepn and use

Publications (2)

Publication Number Publication Date
CN109384828A true CN109384828A (en) 2019-02-26
CN109384828B CN109384828B (en) 2020-04-10

Family

ID=65428451

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201811308753.3A Active CN109384828B (en) 2018-11-05 2018-11-05 Penicillium alkali ether A as active matter of medicine-resistant bacteria and its prepn and use

Country Status (1)

Country Link
CN (1) CN109384828B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110218759A (en) * 2019-05-13 2019-09-10 浙江大学 The preparation and use of anticol matter tumor activity substance mould alkali ether A

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103255061A (en) * 2012-02-15 2013-08-21 中国医学科学院医药生物技术研究所 Penicillium griseofulvum, antibacterial active compound generated thereby and application

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103255061A (en) * 2012-02-15 2013-08-21 中国医学科学院医药生物技术研究所 Penicillium griseofulvum, antibacterial active compound generated thereby and application

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
徐燕等: "海洋真菌灰黄青霉Penicillium griseofulvum次级代谢产物中一个新的内酯醛结构", 《天然产物研究与开发》 *
朱育菁等: "灰黄霉素的研究进展", 《厦门大学学报（自然科学版）》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110218759A (en) * 2019-05-13 2019-09-10 浙江大学 The preparation and use of anticol matter tumor activity substance mould alkali ether A
CN110218759B (en) * 2019-05-13 2020-12-15 浙江大学 Preparation and application of anti-glioma active substance penicillium alkali ether A

Also Published As

Publication number Publication date
CN109384828B (en) 2020-04-10

Similar Documents

Publication Publication Date Title
Selvameenal et al. Antibiotic pigment from desert soil actinomycetes; biological activity, purification and chemical screening
Jing et al. Newly isolated Streptomyces sp. JBS5-6 as a potential biocontrol agent to control banana Fusarium wilt: genome sequencing and secondary metabolite cluster profiles
CN104403987B (en) Yew cell strain and its application with the DAB characteristics of high yield 10
Rosa et al. Coniochaeta ligniaria: antifungal activity of the cryptic endophytic fungus associated with autotrophic tissue cultures of the medicinal plant Smallanthus sonchifolius (Asteraceae)
CN106434372B (en) Application of coral-derived fungus aspergillus terreus strain C21-10
CN103740606B (en) Plant raw streptomycete and produce antibiotic promise and irrigate method and the application of nest mycin
CN108300677B (en) One plant of streptomyces albus and its preparing the application in microbialpreservatives
Quezada et al. Diverse cone-snail species harbor closely related Streptomyces species with conserved chemical and genetic profiles, including polycyclic tetramic acid macrolactams
CN105670968B (en) A kind of marine natural anticol matter tumor activity substance and preparation and use
CN110511228A (en) A kind of Penicillium griseofulvum alkali bis ether A and preparation and use
CN109384828A (en) Antimicrobial agent active material mould alkali ether A and preparation and use
CN104109642B (en) Serratia marcescens, and screening method and application thereof
CN106047751B (en) Separation method and the application of one plant of quasi- promise Cattell actinomyces and its active metabolite
CN111747955B (en) Marine anti-glioma active substance isobaric carboline alkali A, preparation and application thereof
CN108441427B (en) Arthriospora fungi and pyridone alkaloid compound produced by same
CN114380782A (en) Compound, preparation method and application of bactericide in preventing and treating rubber anthracnose
CN105112322A (en) Grisic quinone A, grisic quinone B, and preparation method and medical application of grisic quinone A and grisic quinone B
CN102898412B (en) Anti-tumor and anti-bacterial dodecacyclo lactone compounds and use thereof
CN108486011B (en) Terphenyl compound, preparation method and application thereof
CN106167517B (en) Anticol matter tumor activity substance strepto- depsipeptides P11B and preparation and application
CN108503534A (en) The extracting method of P-hydroxybenzoic acid and application
CN107739740A (en) A kind of preparation method and application of the Lasiodiplodins compounds in marine fungi source
CN102993188A (en) Fradimycin B as well as preparation method and application thereof
CN110872266B (en) Marine penicillium sesquiterpene lactone antitumor active substance and preparation and application thereof
CN108660169A (en) A method of fermentation prepares spine spore bacteriums antibiotic

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant