CN106701602B - Fusarium chlamydosporia and application thereof - Google Patents

Abstract

The invention discloses fusarium chlamydosporia and application thereof. The strain is preserved in China general microbiological culture Collection center, and the preservation date is as follows: the preservation number is CGMCC No.13198 at 09/12 in 2016. The strain has better inhibitory activity to plant pathogenic fungi such as cotton wilt pathogen and citrus anthracnose pathogen after fermentation and extraction, and the Minimum Inhibitory Concentration (MIC) is 4 and 8 mug/mL respectively; in addition, the American ginseng root-knot nematode killing agent has good nematode killing activity on American ginseng root-knot nematodes, and the fatality rates of 50 times and 100 times of diluents on the American ginseng root-knot nematodes are 100% and 83% respectively, so the agent has good application prospects in plant disease control.

Description

Fusarium chlamydosporia and application thereof

Technical Field

The invention belongs to the field of microbial pesticides. Specifically, the invention relates to fusarium chlamydosporia and application thereof.

Background

Various plant diseases caused by plant pathogenic fungi seriously threaten the crop production in China, and the economic loss caused each year is difficult to estimate. For example: cotton wilt germs occur in different degrees in main cotton production areas in China, the disease can be developed in the seedling stage, even the whole cotton plant is withered and died, and the yield and the quality of cotton are seriously influenced.

Plant pathogenic nematodes are also one of the commonly occurring plant diseases, mainly harm commercial crops such as tobacco, pseudo-ginseng, cotton, peanut, American ginseng and the like in China, and become one of the important factors for damaging the yield of the commercial crops. Statistically, crop losses due to phytopathogenic nematodes are as high as billions of dollars each year worldwide.

At present, the control of plant diseases mainly comprises chemical pesticide control, alternate method, resistant variety utilization and the like, and has certain limitations. Especially chemical pesticide can make plant pathogenic fungi and nematode produce resistance to drug, and its residual period is long, so that it is limited in application. The microbial pesticide can effectively overcome the defects of chemical synthetic pesticides, and has the advantages of difficult generation of pesticide resistance, good environmental compatibility, easy large-scale fermentation production and the like. As an environment-friendly pollution-free green pesticide, the pesticide has strong sustainability and increasingly obvious effect in preventing and controlling plant diseases. Therefore, the search and development of biopesticides from microorganisms has become an important direction for the development of green control of plant diseases.

Disclosure of Invention

The invention aims to provide fusarium chlamydosporia QJP1 and application thereof. The strain is easy for large-scale fermentation production, and the fermentation product has good nematicidal activity to American ginseng root-knot nematodes after extraction and separation, and has good inhibitory activity to plant pathogenic fungi such as cotton wilt pathogens and citrus anthracnose pathogens, so the strain has good development prospect.

The strain provided by the invention is Fusarium chlamydosporum (Fusarium chlamydosporum) QJP1, and is separated from saline-alkali soil collected by Suaeda salsa wetland in Qingdao city. The strain is preserved in China general microbiological culture Collection center, and the preservation date is as follows: the preservation number is CGMCC No.13198 at 09/12 in 2016.

Method for preserving Fusarium chlamydosporia strain QJP 1: and storing by adopting a PDA culture medium. PDA culture medium: 200g of potato, 20g of glucose, 12g of agar and 1000mL of distilled water, and the pH is adjusted to 7.0.

Another object of the invention is to provide a method for the fermentation of Fusarium chlamydosporia strain QJP1, characterized in that,

1) inoculating the stored Fusarium chlamydosporia strain QJP1 on the surface of PDA plate, and culturing at 26-30 deg.C for 5-10 days as large-scale fermentation culture strain;

2) then adding the above strains into fermentation medium, and performing shake culture or standing fermentation culture at 26-30 deg.C for 10-40 days to obtain fermentation liquid. The fermentation medium (same as PDB medium) is as follows: 200g of potato, 20g of glucose and 1000mL of distilled water, and the pH is adjusted to 7.0.

The fermentation product can be further extracted, and the method specifically comprises the following steps:

1) extracting with organic solvent, and distilling the extractive solution under reduced pressure to obtain extract; the organic solvent is one or more of ethyl acetate, chloroform, acetone, methanol, ethanol or n-butanol, preferably ethyl acetate;

2) performing column chromatography separation on the extract, wherein the column chromatography can adopt one or more of silica gel column chromatography, reversed phase column chromatography and macroporous adsorption resin column chromatography, and preferably silica gel column chromatography;

3) performing gradient elution by using petroleum ether-ethyl acetate, and collecting an elution component I with the gradient volume ratio of the petroleum ether to the ethyl acetate of 10:1 for preparing the microbial nematicide; the petroleum ether-ethyl acetate elution gradient is 100:1 to 1: 1;

4) then carrying out gradient elution by chloroform-methanol, and collecting an elution component II with the gradient chloroform-methanol volume ratio of 20:1 for preparing the microbial bactericide; the chloroform-methanol elution gradient is from 60:1 to 1: 1.

The invention has the advantages that: the fermentation product of the invention can be obtained by fermenting, culturing, extracting and separating the fusarium chlamydosporia strain QJP1, and has the advantages of relatively simple production process, easy large-scale fermentation production, easy degradation in environment, low toxicity to people and livestock and the like. The compound has better inhibitory activity on plant pathogenic fungi such as cotton fusarium wilt and citrus anthracnose, and the Minimum Inhibitory Concentrations (MIC) are respectively 4 and 8 mug/mL; in addition, the fermentation product has good nematicidal activity to American ginseng root-knot nematodes, and the fatality rates of 50 times and 100 times of the dilution to the American ginseng root-knot nematodes are 100% and 83% respectively, so the fermentation product has good application prospects in plant disease control.

Detailed Description

The invention will be further described with reference to specific embodiments, and the advantages and features of the invention will become apparent as the description proceeds. These examples are illustrative only and do not limit the scope of the present invention in any way. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention, and that such changes and modifications may be made without departing from the spirit and scope of the invention.

Example 1: fusarium chlamydosporia QJP1 strain separation and identification

(1) Strain isolation

The strain QJP1 is obtained by separating from soil by adopting methods such as plate dilution coating, scribing and the like. (1) Collecting a soil sample: the collection place is Suaeda glauca wetland in Bay of Qingdao city, and a 5-point sampling method is adopted. (2) A separation step: weighing 1g saline-alkali soil sample in 100mL sterile water, placing in a shaking table at 30 ℃ and shaking at 150r/min for 10min, and sequentially diluting to 10%^-2、10^-3、10^-4Concentration; respectively sucking 100 μ L of the above diluted solution, uniformly coating on LB double-antibody culture medium plate containing 3.5% sea salt, and coating three parallel layers in each gradient; after culturing at 30 ℃ for 2 days, picking microbial colonies with different forms on the surface of a culture medium, streaking on an LB double-antibody culture medium plate containing 3.5% sea salt, and regularly observing the growth condition of the colonies; and finally, separating and purifying the fungus strains by adopting a plate marking method, numbering and storing.

(2) Identification of strains

The QJP1 strain was inoculated onto the surface of PDA plates and observed after 5-7 days of incubation at 28 ℃. A bulge is formed in the center of the bacterial colony, the surface of the bacterial colony is white, dense aerial hyphae are flocculent, and the back of the bacterial colony is light yellow; microscopic examination shows that sickle-shaped large and septate conidia grow spherical chlamydospores at the top or middle of hyphae.

The rDNA gene sequence determination results (ITS-5.8S-ITS2 region) of the strain are as follows:

TCCGTAGGTGAACCTTGCGGTTAAACTCCCAAACCCCTGTGACATACCTATACGTTGCCTCGGCGGATCAGCCCGCGCCCCGTAAAACGGGACGGCCCGCCCGAGGACCCCTAAACTCTGTTTTTAGTGGAACTTCTGAGTAAAACAAACAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCAGCTTGGTGTTGGGACTCGCGGTAACCCGCGTTCCCCAAATCGATTGGCGGTCACGTCGAGCTTCCATAGCGTAGTAATCATACACCTCGTTACTGGTAATCGTCGCGGCCACGCCGTAAAACCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGACCGCAAGGTTCACCTACGGA

in conclusion, the strain is identified as Fusarium chlamydosporum (Fusarium chlamydosporum), which is currently deposited in the China general microbiological culture Collection center (CGMCC, address: No. 3 Xilu-Beichen-Xihe-Shih 1 of the Chaoyang district, Beijing city, institute of microbiology, China academy of sciences), and the preservation date is as follows: the preservation number of the strain is CGMCC No.13198 at 2016, 12 months and 09.

Example 2: fusarium chlamydosporia strain QJP1 fermentation culture

(1) Fermentation culture

According to the conventional culture method of microorganisms, a small amount of Fusarium chlamydosporia strain QJP1 preserved on the slant of PDA culture medium is selected and inoculated on the surface of PDA plate, and cultured at 28 ℃ for 5 days to be used as the strain for large-scale fermentation culture for later use.

PDA culture medium: 200g of potato, 20g of glucose, 12g of agar and 1000mL of distilled water, and the pH is adjusted to 7.0.

(2) The strain (1/4 in the amount of plate) on the surface of PDA plate is cut, inoculated into sterilized conical flask containing PDB culture medium, and subjected to shake cultivation at 28 deg.C and 120rpm for 10 days.

PDB culture medium: 200g of potato, 20g of glucose and 1000mL of distilled water, and the pH is adjusted to 7.0.

(3) Preparation of fermentation products

Extracting the above culture product with ethyl acetate for 3 times, mixing ethyl acetate extractive solutions, and distilling under reduced pressure to obtain extract. Performing silica gel VLC (liquid chromatography) flash column chromatography, and performing silica gel column chromatography separation by using petroleum ether-ethyl acetate (in a volume ratio of 100:1 to 1:1) and chloroform-methanol (in a volume ratio of 60:1 to 1:1) as gradient eluents according to the ascending order of the polarity of the eluent. Collecting the elution component I with the gradient of petroleum ether-ethyl acetate volume ratio of 10:1 for preparing the microbial nematicide; and collecting the chloroform-methanol volume ratio 20:1 gradient elution component II for preparing the microbial bactericide.

Example 3: bacteriostatic activity

The activity of the fermentation product of the chlamydosporia strain QJP1 on inhibiting cotton fusarium wilt and citrus anthracnose is measured by a microdilution method.

1) Preparation of the bacterial suspension

After the test fungus was inoculated on the surface of PDA medium and cultured at 28 ℃ for 72 hours, 2mL of a sterile 0.85% NaCl solution (containing 0.25% Tween-20) was aspirated to wash the culture, and the colonies were gently scraped off with a glass scraper. Sucking a proper amount of bacterial suspension into a sterile test tube, and adjusting to 0.5 McLeod's turbidimetry (equivalent to 1.5 multiplied by 108CFU/mL) for later use;

2) preparation of samples

A certain amount of sample to be tested (elution component II of the fermentation product in example 2) is dissolved in 100 mu L of 50% DMSO, and after the sample is fully and uniformly mixed, 50 mu L of sample solution is absorbed into another centrifuge tube, and then 50 mu L of 50% DMSO is added to obtain sample solution with the concentration reduced by half. According to this method, 12 sets of sample solutions were obtained with successively halved concentrations.

3) MIC determination method

(1) By adopting aseptic operation, sample solutions with different concentrations after dilution in multiple proportion are respectively added into an aseptic 96-hole polystyrene plate, 5 mu L of sample solution is respectively added into the 1 st to 12 th holes, the hole without the sample is used as a blank control, and the hole with the 5 mu L of DMSO solution is used as a solvent control.

(2) After diluting the indicator suspension corresponding to 0.5 McLeod's turbidity 1000 times with the Sabouraud's medium, 95. mu.L of the indicator suspension was sequentially added to 96-well plates so that the sample concentrations in the 1 st to 12 th wells were 512, 256, 128, 64, 32, 16, 8, 4, 2, 1, 0.5 and 0.25. mu.g/mL in this order. All the above samples were repeated three times. After gently shaking and mixing, the 96-well plate is sealed and placed in a biochemical incubator at 28 ℃ for culturing for 72 hours.

(3) The absorbance of each well was measured using a microplate reader at a wavelength of 600nm, and the lowest sample concentration at which the growth of the indicator bacteria was completely inhibited in the wells was taken as the MIC of the compound. (Note: it is only meaningful to indicate that the bacteria grows significantly in the negative control wells; the highest concentration of drug inhibiting the growth of the strain should be recorded when a single jump occurs in the experiment; if multiple jumps occur, no results should be reported, and the experiment should be repeated.)

The test result shows that the MIC values of the fermentation product of the fusarium chlamydosporia strain QJP1 to cotton wilt pathogen and citrus anthracnose pathogen are respectively 4 and 8 mug/mL, and the bacterial inhibition activity is better.

The experimental results prove that the fermentation product of the fusarium chlamydosporia strain QJP1 has good bacteriostatic activity and can be used for preparing a microbial bactericide.

Example 4: nematicidal activity

(1) Experimental methods

Test nematode and culture method thereof

American ginseng root-knot nematode is provided by Shandong province forestry scientific research institute. Weighing 20g oatmeal, adding 60mL water, sterilizing, adding 1mL nematode suspension, and culturing at 25 deg.C for 7 d. Under aseptic condition, selecting appropriate amount of cultured oat containing nematodes, placing on filter paper, washing out nematodes by simple Beemann funnel method, suspending nematodes in sterile water at concentration of about 2000/mL, and storing at 4 deg.C.

Determination of nematicidal Activity

A certain amount of sample to be tested (elution component I of the fermentation product in example 2) is taken, diluted by 50 and 100 times by 50 percent DMSO respectively, 1mL of the diluted sample is sucked into a sterilized centrifuge tube, 100 mu L of nematode suspension is added, the diluted sample is treated by 50 percent DMSO as a control, and the mixture is kept stand for 12 hours at 25 ℃. After uniform mixing, the mixed solution is spotted on a glass slide, and the number of dead nematodes and the total number of nematodes (dead nematodes are regarded as dead) are counted under an optical microscope, and the death rate is calculated. The number of nematodes observed in each time is not less than 30.

The criteria for judging the activity level are: mortality > 90% is on the order of "+ + +"; the mortality rate is less than 70 percent and less than 90 percent, and the grade is '+ + +'; the mortality rate of the nematodes is more than 50% and less than 70%, and the level is plus; the mortality rate is less than 50 percent and is in the grade of- ".

(2) Results of the experiment

The lethality of 50 times of diluent of the fermentation product of the fusarium chlamydosporia strain to the American ginseng root-knot nematode is 100 percent, and the activity level is '+++'; after 12h, the shape of each treated worm body is observed under a microscope, and the dead nematodes are found to lose mobility and be stiff, while the control live nematodes move actively and bend to be S-shaped.

While 100 times of diluent of the fermentation product of the fusarium chlamydosporia strain has 83 percent of lethality to the American ginseng root-knot nematode and has a + plus level of activity level. It can be seen that although the mortality rate of nematodes decreased after further dilution of the fermentation product, it still showed significant nematicidal activity compared to the blank (5%). Therefore, the fermentation product prepared by the strain can effectively prevent and control plant pathogenic nematodes, especially American ginseng root-knot nematodes, and can be used for preparing microbial nematicides.

SEQUENCE LISTING

<110> Qingdao agricultural university

<120> Fusarium chlamydosporia and application thereof

<130>1

<140>0

<141>2017-02-16

<160>1

<170>PatentIn version 3.3

<210>1

<211>548

<212>DNA

<213> rRNA gene sequence of Fusarium chlamydosporum strain QJP1 (ITS 1-5.8S-ITS4 region)

<400>1

tccgtaggtg aaccttgcgg ttaaactccc aaacccctgt gacataccta tacgttgcct 60

cggcggatca gcccgcgccc cgtaaaacgg gacggcccgc ccgaggaccc ctaaactctg 120

tttttagtgg aacttctgag taaaacaaac aaataaatca aaactttcaa caacggatct 180

cttggttctg gcatcgatga agaacgcagc aaaatgcgat aagtaatgtg aattgcagaa 240

ttcagtgaat catcgaatct ttgaacgcac attgcgcccg ccagtattct ggcgggcatg 300

cctgttcgag cgtcatttca accctcaagc tcagcttggt gttgggactc gcggtaaccc 360

gcgttcccca aatcgattgg cggtcacgtc gagcttccat agcgtagtaa tcatacacct 420

cgttactggt aatcgtcgcg gccacgccgt aaaaccccaa cttctgaatg ttgacctcgg 480

atcaggtagg aatacccgct gaacttaagc atatcaataa gcggaggacc gcaaggttca 540

cctacgga 548

Claims (8)

1. Fusarium chlamydosporia (C)Fusarium chlamydosporum) The strain QJP1, wherein the preservation number of the strain is CGMCC number 13198.

2. Use of the strain of Fusarium chlamydosporia QJP1 of claim 1 in the preparation of fermentation products for the control of phytopathogenic fungi diseases or of meloidogyne incognita of American ginseng; the plant pathogenic fungi are cotton wilt pathogen or citrus anthracnose pathogen.

3. Method for the fermentation of the strains of Fusarium chlamydosporia QJP1 of claim 1, characterized in that,

1) inoculating the stored Fusarium chlamydosporia strain QJP1 on the surface of PDA plate, and culturing at 26-30 deg.C for 5-10 days as large-scale fermentation culture strain;

2) then adding the strains into a fermentation medium, and performing shaking table or standing fermentation culture at 26-30 ℃ for 10-40 days to obtain a fermentation product for later use; the fermentation medium is as follows: 200g of potato, 20g of glucose and 1000mL of distilled water, and the pH is adjusted to 7.0.

4. A process for the simultaneous preparation of an eluate fraction I and an eluate fraction II from a fermentation product prepared according to claim 3,

1) extracting the fermentation product by using an organic solvent, and distilling the extracting solution under reduced pressure to obtain an extract;

2) then performing column chromatography separation on the extract;

3) performing gradient elution by using petroleum ether-ethyl acetate, and collecting an elution component I with the gradient volume ratio of the petroleum ether to the ethyl acetate of 10:1 for later use;

4) then carrying out gradient elution by chloroform-methanol, and collecting the elution component II with the gradient of the chloroform-methanol volume ratio of 20:1 for later use.

5. The method according to claim 4, wherein the organic solvent is one or more of ethyl acetate, chloroform, acetone, methanol, ethanol, or n-butanol.

6. The method as claimed in claim 4, wherein the column chromatography is one or more of silica gel column chromatography, reversed phase column chromatography or macroporous adsorbent resin column chromatography.

7. Use of the eluted fraction I prepared according to any one of claims 4 to 6 for the preparation of a microbial nematicide for the control of meloidogyne incognita disease in Panax quinquefolium.

8. Use of the eluate fraction II prepared in accordance with any one of claims 4 to 6 in the preparation of a microbial fungicide for the control of phytopathogenic fungal diseases of plants selected from the group consisting of Fusarium oxysporum f.sp.