CN109337891A - A kind of Phenylalanine aminomutase mutant that thermal stability improves - Google Patents
A kind of Phenylalanine aminomutase mutant that thermal stability improves Download PDFInfo
- Publication number
- CN109337891A CN109337891A CN201811493273.9A CN201811493273A CN109337891A CN 109337891 A CN109337891 A CN 109337891A CN 201811493273 A CN201811493273 A CN 201811493273A CN 109337891 A CN109337891 A CN 109337891A
- Authority
- CN
- China
- Prior art keywords
- mutant
- leu
- enzyme
- ser
- ala
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/90—Isomerases (5.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P13/00—Preparation of nitrogen-containing organic compounds
- C12P13/04—Alpha- or beta- amino acids
- C12P13/22—Tryptophan; Tyrosine; Phenylalanine; 3,4-Dihydroxyphenylalanine
- C12P13/222—Phenylalanine
Abstract
The invention discloses the Phenylalanine aminomutase mutant that a kind of thermal stability improves, and belong to technical field of enzyme engineering.The mutant sequence of Phenylalanine aminomutase of the invention is as shown in SEQ ID NO.2, the specific enzyme activity of the mutant enzyme is slightly improved relative to wild type, still there is 83% activity of residual enzyme in 50 DEG C of processing 1h, temperature stability has increased significantly compared to wild enzyme, is more suitably applied to industrial production.
Description
Technical field
The present invention relates to a kind of Phenylalanine aminomutase mutant, belong to technical field of enzyme engineering.
Background technique
Phenylalanine aminomutase (PAM) can be used for being catalyzed phenylalanine and isomerization occur, and catalysis α-phenylalanine turns
Amino becomes the higher β-phenylalanine of medical value, and β-phenylalanine is the important as precursors for synthesizing anti-cancer medicine paclitaxel, tool
There is vast market prospect.But the reaction is an exothermic reaction, production process high temperature will affect the structure of enzyme, cause
Enzyme activity decline, and then a large amount of energy consumption is produced, improve production cost.In addition, enzyme activity is relatively in catalytic process for the enzyme
It is low, it is unfavorable for the generation of β phenylalanine.In production catalytic process, thermal stability and the enzyme activity for improving this are particularly important.
Currently, Phenylalanine aminomutase is mainly derived from pantoea agglomerans (Pantoea agglomerans), ocean chain
Mould (Streptomyces maritimus) and Chinese Chinese yew (Taxus chinensis).The mesh in Chinese Chinese yew source
Gene expressed in prokaryotes not ideal enough, the gene in marine streptomyces source shows phenylalanine when temperature is higher
Enzymatic activity is cracked, and the Phenylalanine aminomutase vigor and thermal stability in wild type pantoea agglomerans source are also limited.Therefore,
Obtain that a kind of enzyme activity improves, the Phenylalanine aminomutase of stability enhancing has β-phenylalanine industrialized production
Important application value.
Summary of the invention
The first purpose of the invention is to provide a kind of Phenylalanine aminomutase mutant, contain SEQ ID NO.2
Shown in amino acid sequence.
A second object of the present invention is to provide the genes for encoding the mutant.
In one embodiment of the invention, the gene contains nucleotide sequence shown in SEQ ID NO.1.
Third object of the present invention is to provide the carriers for containing the gene.
Fourth object of the present invention is to provide the cell for expressing the Phenylalanine aminomutase mutant.
It is with Escherichia coli for host fifth object of the present invention is to provide a kind of genetic engineering bacterium, expresses SEQ ID
NO, Phenylalanine aminomutase mutant I91M shown in 2.
In one embodiment of the invention, the genetic engineering bacterium is host with e. coli bl21.
In one embodiment of the invention, the genetic engineering bacterium is using pET series plasmids as carrier.
In one embodiment of the invention, the carrier is pET28a.
Sixth object of the present invention is to provide a kind of method for improving Phenylalanine aminomutase stability, the sides
It is methionine that method, which is by the 91st isoleucine mutation of Phenylalanine aminomutase shown in SEQ ID NO.3,.
7th purpose of the invention is to provide a kind of method for producing the Phenylalanine aminomutase mutant, will
The genetic engineering bacterium for expressing the Phenylalanine aminomutase mutant is inoculated in LB culture medium, and 35-37 DEG C of culture is extremely
OD600When for 0.6-0.8, inducer IPTG is added in 20-22 DEG C of induction 16-18h.
In one embodiment of the invention, the method is that the genetic engineering bacterium is inoculated in containing kanamycins
LB is expressed in culture medium, 37 DEG C, 200r/min shaken cultivation to OD600When for 0.6-0.8, inducer IPTG to 0.1mM is added,
20 DEG C of induction 16-18h express Phenylalanine aminomutase mutant enzyme.
In one embodiment of the invention, the method also includes collecting the thallus of the genetic engineering bacterium, by bacterium
Supernatant is collected after body is broken, after the filtering of supernatant film, obtains Phenylalanine aminomutase mutation with His Trap HP post separation
Body.
The present invention also provides the Phenylalanine aminomutase mutant and the genetic engineering bacterium to contain β-in preparation
Application in the product of phenylalanine.
The utility model has the advantages that the optimal pH of Phenylalanine aminomutase mutant I91M provided by the invention is 8.5, most thermophilic
Degree is 55 DEG C, and 50 DEG C of processing 1h still have 83% activity of residual enzyme, compared to remaining 25% enzyme activity of 50 DEG C of processing 1h of wild enzyme, is improved
About 2.3 times；Mutant thermal stability is significantly improved.The mutant also has better catalytic activity, specific enzyme activity phase simultaneously
It is slightly improved compared with wild enzyme；Therefore, Phenylalanine aminomutase mutant I91M provided by the invention has good enzyme
Property is learned, later industrial production is conducive to.
Detailed description of the invention
Fig. 1: the enzyme activity curve of wild enzyme and mutant enzyme I91M at different temperatures, Pa (wt) are wild enzyme.
Fig. 2: the enzyme activity curve of wild enzyme and mutant enzyme I91M at 50 DEG C under difference pH, Pa (wt) are wild enzyme.
Fig. 3: wild enzyme and mutant enzyme I91M saved at 50 DEG C after thermal stability curve, Pa (wt) is wild enzyme.
Fig. 4: the enzyme activity histogram of wild enzyme and mutant enzyme I91M at 50 DEG C, Pa (wt) are wild enzyme.
Fig. 5: wild enzyme and mutant enzyme A95G, A95R, I91H, I91M handle the remaining enzyme activity of 1h at 50 DEG C, and PA is open country
Raw enzyme.
Fig. 6: the opposite enzyme activity histogram of wild enzyme and mutant enzyme I91H, I91V, I91M at 50 DEG C, Pa (wt) are wild
Enzyme.
Specific embodiment
The definition (U) of enzyme activity: enzyme amount needed for conversion L- α-phenylalanine generates 1 μm of ol/L β-phenylalanine per minute is fixed
Justice is 1U.
Specific enzyme activity (U/mg): the enzyme activity of every milligram of PAM.
The definition of opposite (residue) enzyme activity: by wild enzyme and mutant enzyme in the PBS buffer solution of pH=8.5, temperature 50
DEG C reaction 30min, measure product formation, be defined as 100% as standard using the yield of wild enzymatic.
LB culture medium: peptone 10g/L, yeast extract 5g/L, NaCl 10g/L.
Phenylalanine aminomutase reaction system: substrate is L- α-phenylalanine of 200 μ L 20mM, and it is pure that 100 μ g are added
Enzyme is added after 200 μ L of phosphate buffer reacts 30min at a certain temperature and is reacted with 100 DEG C of high temperature terminations, and is centrifuged removal
Precipitating, as the sample of liquid phase measurement after taking supernatant to cross 0.22 μm of film.
Phenylalanine aminomutase detection: HPLC detection is carried out using Agilent 1260, mobile phase is water-acetonitrile buffering
Liquid；Detection wavelength 254nm, flow velocity 0.5ml/min；Chromatographic column is C18 column.
The determination of optimal reaction pH: measuring the enzyme activity of wild enzyme and mutant in different pH buffers respectively, calculates phase
To enzyme activity, optimal reaction pH is determined.
The determination of optimal reactive temperature: wild enzyme and mutant enzyme activity are measured under condition of different temperatures respectively, determines phase
To enzyme activity, optimal reactive temperature is determined.
The determination of temperature stability: by wild enzyme and mutant in the PBS buffer solution of pH=8.5,50 DEG C keep the temperature respectively
Measurement residual enzyme activity, obtains temperature stability result after 30min, 1h, 2h.
Embodiment 1
(1) building of mutant I91M:
Chemical synthesis synthesizes Pa-PAM gene (as shown in SEQ ID NO.1), and by the gene cloning in pET28a matter
It at NdeI the and HindIII restriction enzyme site of grain, is completed by Tian Lin biotech company, obtains pET28a-PAM recombinant plasmid.With
PET28a-PAM is template, is obtained after PCR under the conditions of the primer shown in table 1 is shown in the table 2, PCR product Transformed E .coli JM109
The recombinant plasmid pET28a-PAM-I91M of encoding mutant body gene must be carried.Recombinant plasmid pET28a-PAM-I91M is converted
E.coli BL21 bacterial strain obtains recombinant bacterial strain BL21/pET28a-PAM-I91M.
1 primer of table
| P1 | ATGGGTGGTTTCGTTAACTATTGGGTTCCGATTGCA |
| P2 | GCTTGCTTTTGCAATCGGAACCCAATAGTTAACGAA |
The full plasmid PCR amplification reaction system of table 2
| Reagent | Dosage |
| ddH2O | 32μL |
| 5×PS Buffer(Mg2+plus) | 10μL |
| dNTPMixture(2mmol/L) | 4μL |
| P1(10mmol/L)、P2(10mmol/L) | Each 1 μ L |
| pET28a-PAM | 1μL |
| Primer STAR HS archaeal dna polymerase | 1μL |
| It is total | 50μL |
Pcr amplification reaction condition are as follows:
PCR product is identified with agarose gel electrophoresis method for detecting.Then Escherichia coli will be transferred to after PCR product purifying, digestion
BL21 competent cell.
(2) recombination bacillus coli BL21/pET28a-PAM-I91M is inoculated in 4mL kanamycins concentration is 100 μ g/mL
LB culture medium (peptone 10g/L, yeast extract 5g/L, NaCl 10g/L), 37 DEG C, 200r/min shaken overnight culture.
It is 100 μ g/mL's that above-mentioned overnight culture, which is inoculated in concentration containing kanamycins by the inoculum concentration of 1% (v/v),
100mLLB is expressed in culture medium (peptone 10g/L, yeast extract 5g/L, NaCl10g/L), 37 DEG C, 200r/min oscillation training
It supports to OD600When to 0.6-0.8, inducer IPTG to 0.1mM is added, 20 DEG C of induction 16-18h obtain thallus, the revolving speed of 5000g
Bacterium is received in centrifugation.
(3) recombination thallus is dissolved in 20mL combination buffer solution (50mmol/L Na2HPO4、50mmol/L NaH2PO4、
500mmol/L NaCl, 20mmol/L imidazole), ultrasonication, 13000g is centrifuged 25min, 0.22 μm of filter membrane of supernatant
Filtering.With the His Trap HP column of the combination buffer solution balance 1mL of 10 times of column volumes, buffered with the combination of 15 times of column volumes
Solution washes away the albumen of non-specific adsorption, is washed respectively with the buffer of the 150 of 8 times of column volumes, 300 and 500mmol/L imidazoles
De- albumen is collected sample and is analyzed and identified with SDS-PAGE.
Embodiment 2
The mutant enzyme of 100 μ g embodiments 1 after purification is added in 200 μ L buffering reaction systems, adds substrate L- α-phenylpropyl alcohol ammonia
200 μ L of acid, react 30min at 40 DEG C, 45 DEG C, 50 DEG C, 55 DEG C, 60 DEG C, determine corresponding enzyme activity.Made with unmutated wild enzyme
To compare, other conditions are identical as enzyme mutant.
As shown in Figure 1, the optimum temperature of wild enzyme is 50 DEG C.Enzyme activity of the enzyme mutant I91M at 50 DEG C is 92%, 55
DEG C enzyme activity highest, optimal reactive temperature improves 5 DEG C than wild enzyme.
Embodiment 3
It prepares the PBS buffer solution of different pH: setting 8.0,8.5,9.0,9.5 for pH.By wild enzyme and enzyme mutant
After I91M places 30min at 50 DEG C in different pH buffer solutions respectively, enzyme activity is measured.
As shown in Fig. 2, enzyme activity highest is defined as 100% in pH=8.5, when pH is 9,9.5, mutant enzyme enzyme activity is all
It is maintained at 80% or less.Illustrate mutant easy in inactivation under alkaline condition.
Embodiment 4
It takes 100 μ g in 200 μ L buffers respectively wild enzyme and enzyme mutant I91M, is stored in 50 DEG C of metal baths
30min-2h, sampling, measurement residual enzyme activity.
As shown in fig. 3, it was found that the remaining enzyme activity of mutant enzyme is by wild enzyme after mutant enzyme handles 60min at 50 DEG C
25% is increased to 83%, only has dropped 9% compared to initial enzyme activity of the enzyme mutant I91M at 50 DEG C；It is handled at 50 DEG C
After 30min and 120min, the opposite enzyme activity of mutant enzyme is increased to 90% and 22% by the 49% of wild enzyme and 17%.It is mutated body heat
Stability is significantly increased.
Embodiment 5
It takes 100 μ g in 200 μ L buffers respectively wild enzyme and enzyme mutant I91M, exists using α phenylalanine as substrate
30min is reacted in 50 DEG C of metal baths, 100 DEG C of inactivations is sampled, measures wild enzyme and mutant enzyme activity.It is produced with the product of protoenzyme catalysis
Amount is standard, is defined as 100%.
As shown in figure 4, specific enzyme activity is promoted from 410U/mg to 440U/mg after discovery mutant reacts 30min at 50 DEG C,
Catalytic efficiency is promoted.
Embodiment 6
Configuration concentration of substrate be 1mM, 3mM, 5mM, 7mM, 10mM, 12mM, 15mM, 20mM, 25mM, 30mM, 35mM,
α-phenylalanine of 40mM, 45mM, 50mM carry out catalysis reaction, detect product formation rate, are counted using origin software
According to fitting, K is measuredmValue and KcatValue, and calculate specific enzyme activity.The kinetic parameter of wild enzyme and enzyme mutant I91M is divided
Analysis, the results are shown in Table 3, finds KmAnd KcatValue has the tendency that becoming larger, and specific enzyme activity slightly improves.
The wild enzyme Pa (wt) of table 3 and mutant kinetic parameter.
Comparative example 1
Using Phenylalanine aminomutase shown in SEQ ID NO.3 as parent enzyme, the 95th alanine is dashed forward respectively
Become glycine and arginine, obtain enzyme mutant A95G and A95R, is histidine and first by the 91st isoleucine mutation
Methyllanthionine obtains enzyme mutant I91H and I91M.Take 100 μ g in the PBS of 200 μ LpH=8.5 respectively wild enzyme and mutant enzyme
In buffer, it is stored in 1h in 50 DEG C of metal baths, is sampled, remaining enzyme activity is measured.As shown in figure 5, wild enzyme, A95G, A95R,
The remaining enzyme activity of I91H, I91M are respectively 25%, 45%, 43%, 68%, 83%.
Comparative example 2
Using Phenylalanine aminomutase shown in SEQ ID NO.3 as parent enzyme, 91 isoleucines are dashed forward respectively
Become histidine and valine and methionine, obtains enzyme mutant I91H, I91V, I91M.In the PBS buffer solution of pH=8.5
In, temperature is 50 DEG C of reaction 30min, measures product formation, is defined as 100% as standard using the yield of wild enzymatic.
The opposite enzyme activity of I91H, I91V, I91M are respectively 50%, 78% and 107%, as shown in Figure 6.
Although the present invention has been described by way of example and in terms of the preferred embodiments, it is not intended to limit the invention, any to be familiar with this skill
The people of art can do various change and modification, therefore protection model of the invention without departing from the spirit and scope of the present invention
Enclosing subject to the definition of the claims.
SEQUENCE LISTING
<110>Southern Yangtze University
<120>the Phenylalanine aminomutase mutant that a kind of thermal stability improves
<160> 5
<170> PatentIn version 3.3
<210> 1
<211> 1626
<212> DNA
<213>artificial synthesized
<400> 1
atgagcattg tgaatgaaag cggtagccag ccggttgtta gccgtgatga aaccctgagc 60
cagattgaac gtaccagctt tcatattagc agcggcaaag atattagcct ggaagaaatt 120
gcacgcgcag cacgtgatca tcagccggtt acactgcatg atgaagttgt taatcgtgtt 180
acccgtagcc gtagcattct ggaaagcatg gttagtgatg aacgtgtgat ttatggtgtg 240
aataccagca tgggtggttt cgttaactat atggttccga ttgcaaaagc aagcgaactg 300
cagaataatc tgattaatgc agttgccacc aatgtgggca aatatttcga tgataccacc 360
gttcgtgcaa ccatgctggc acgtattgtt agcctgagcc gtggtaatag cgcaattagc 420
attgtcaact tcaaaaaact gatcgagatc tacaatcagg gtattgtgcc gtgtattccg 480
gaaaaaggta gcctgggcac cagcggtgat ctgggtccgc tggcagcaat tgcactggtt 540
tgtaccggtc agtggaaagc acgttatcag ggtgagcaga tgagcggtgc aatggcactg 600
gaaaaagcag gtattagccc gatggaactg agctttaaag aaggtctggc actgattaac 660
ggtacaagcg caatggttgg tctgggtgtt ctgctgtatg atgaggttaa acgtctgttt 720
gatacctatc tgaccgttac cagcctgagc attgaaggtc tgcatggtaa aaccaaaccg 780
tttgaaccgg cagttcatcg tatgaaaccg catcagggtc agctggaagt tgcaaccacc 840
atttgggaaa ccctggcaga tagcagcctg gcagttaatg aacatgaagt tgagaaactg 900
attgccgaag aaatggatgg cctggttaaa gcaagcaatc atcagattga agatgcctat 960
agcattcgtt gtacaccgca gattctgggt cctgttgcag ataccctgaa aaacattaaa 1020
cagaccctga ccaatgaact gaatagcagc aatgataatc cgctgattga tcagaccacc 1080
gaagaagttt ttcataacgg tcattttcat ggccagtatg tgagcatggc aatggatcat 1140
ctgaatattg ccctggttac catgatgaat ctggcaaatc gtcgtattga tcgcttcatg 1200
gataaaagca atagcaatgg tctgcctccg tttctgtgtg cagaaaatgc aggtctgcgt 1260
ctgggtctga tgggtggtca gtttatgacc gcaagcatta ccgcagaaag ccgtgcaagc 1320
tgtatgccga tgagcattca gagcctgagt accaccggtg attttcagga tattgtgagc 1380
tttggtctgg ttgcagcacg tcgtgttcgt gaacagctga aaaatctgaa atatgtgttt 1440
agcttcgaac tgctgtgtgc atgtcaggca gttgatattc gtggcaccgc aggtctgagc 1500
aaacgtaccc gtgcactgta tgataaaacc cgtacactgg ttccgtatct ggaagaagat 1560
aaaaccatca gcgattatat cgaaagcatt gcacagaccg ttctgaccaa aaacagcgat 1620
atttaa 1626
<210> 2
<211> 541
<212> PRT
<213>artificial synthesized
<400> 2
Met Ser Ile Val Asn Glu Ser Gly Ser Gln Pro Val Val Ser Arg Asp
1 5 10 15
Glu Thr Leu Ser Gln Ile Glu Arg Thr Ser Phe His Ile Ser Ser Gly
20 25 30
Lys Asp Ile Ser Leu Glu Glu Ile Ala Arg Ala Ala Arg Asp His Gln
35 40 45
Pro Val Thr Leu His Asp Glu Val Val Asn Arg Val Thr Arg Ser Arg
50 55 60
Ser Ile Leu Glu Ser Met Val Ser Asp Glu Arg Val Ile Tyr Gly Val
65 70 75 80
Asn Thr Ser Met Gly Gly Phe Val Asn Tyr Met Val Pro Ile Ala Lys
85 90 95
Ala Ser Glu Leu Gln Asn Asn Leu Ile Asn Ala Val Ala Thr Asn Val
100 105 110
Gly Lys Tyr Phe Asp Asp Thr Thr Val Arg Ala Thr Met Leu Ala Arg
115 120 125
Ile Val Ser Leu Ser Arg Gly Asn Ser Ala Ile Ser Ile Val Asn Phe
130 135 140
Lys Lys Leu Ile Glu Ile Tyr Asn Gln Gly Ile Val Pro Cys Ile Pro
145 150 155 160
Glu Lys Gly Ser Leu Gly Thr Ser Gly Asp Leu Gly Pro Leu Ala Ala
165 170 175
Ile Ala Leu Val Cys Thr Gly Gln Trp Lys Ala Arg Tyr Gln Gly Glu
180 185 190
Gln Met Ser Gly Ala Met Ala Leu Glu Lys Ala Gly Ile Ser Pro Met
195 200 205
Glu Leu Ser Phe Lys Glu Gly Leu Ala Leu Ile Asn Gly Thr Ser Ala
210 215 220
Met Val Gly Leu Gly Val Leu Leu Tyr Asp Glu Val Lys Arg Leu Phe
225 230 235 240
Asp Thr Tyr Leu Thr Val Thr Ser Leu Ser Ile Glu Gly Leu His Gly
245 250 255
Lys Thr Lys Pro Phe Glu Pro Ala Val His Arg Met Lys Pro His Gln
260 265 270
Gly Gln Leu Glu Val Ala Thr Thr Ile Trp Glu Thr Leu Ala Asp Ser
275 280 285
Ser Leu Ala Val Asn Glu His Glu Val Glu Lys Leu Ile Ala Glu Glu
290 295 300
Met Asp Gly Leu Val Lys Ala Ser Asn His Gln Ile Glu Asp Ala Tyr
305 310 315 320
Ser Ile Arg Cys Thr Pro Gln Ile Leu Gly Pro Val Ala Asp Thr Leu
325 330 335
Lys Asn Ile Lys Gln Thr Leu Thr Asn Glu Leu Asn Ser Ser Asn Asp
340 345 350
Asn Pro Leu Ile Asp Gln Thr Thr Glu Glu Val Phe His Asn Gly His
355 360 365
Phe His Gly Gln Tyr Val Ser Met Ala Met Asp His Leu Asn Ile Ala
370 375 380
Leu Val Thr Met Met Asn Leu Ala Asn Arg Arg Ile Asp Arg Phe Met
385 390 395 400
Asp Lys Ser Asn Ser Asn Gly Leu Pro Pro Phe Leu Cys Ala Glu Asn
405 410 415
Ala Gly Leu Arg Leu Gly Leu Met Gly Gly Gln Phe Met Thr Ala Ser
420 425 430
Ile Thr Ala Glu Ser Arg Ala Ser Cys Met Pro Met Ser Ile Gln Ser
435 440 445
Leu Ser Thr Thr Gly Asp Phe Gln Asp Ile Val Ser Phe Gly Leu Val
450 455 460
Ala Ala Arg Arg Val Arg Glu Gln Leu Lys Asn Leu Lys Tyr Val Phe
465 470 475 480
Ser Phe Glu Leu Leu Cys Ala Cys Gln Ala Val Asp Ile Arg Gly Thr
485 490 495
Ala Gly Leu Ser Lys Arg Thr Arg Ala Leu Tyr Asp Lys Thr Arg Thr
500 505 510
Leu Val Pro Tyr Leu Glu Glu Asp Lys Thr Ile Ser Asp Tyr Ile Glu
515 520 525
Ser Ile Ala Gln Thr Val Leu Thr Lys Asn Ser Asp Ile
530 535 540
<210> 3
<211> 541
<212> PRT
<213> Pantoea agglomerans
<400> 3
Met Ser Ile Val Asn Glu Ser Gly Ser Gln Pro Val Val Ser Arg Asp
1 5 10 15
Glu Thr Leu Ser Gln Ile Glu Arg Thr Ser Phe His Ile Ser Ser Gly
20 25 30
Lys Asp Ile Ser Leu Glu Glu Ile Ala Arg Ala Ala Arg Asp His Gln
35 40 45
Pro Val Thr Leu His Asp Glu Val Val Asn Arg Val Thr Arg Ser Arg
50 55 60
Ser Ile Leu Glu Ser Met Val Ser Asp Glu Arg Val Ile Tyr Gly Val
65 70 75 80
Asn Thr Ser Met Gly Gly Phe Val Asn Tyr Ile Val Pro Ile Ala Lys
85 90 95
Ala Ser Glu Leu Gln Asn Asn Leu Ile Asn Ala Val Ala Thr Asn Val
100 105 110
Gly Lys Tyr Phe Asp Asp Thr Thr Val Arg Ala Thr Met Leu Ala Arg
115 120 125
Ile Val Ser Leu Ser Arg Gly Asn Ser Ala Ile Ser Ile Val Asn Phe
130 135 140
Lys Lys Leu Ile Glu Ile Tyr Asn Gln Gly Ile Val Pro Cys Ile Pro
145 150 155 160
Glu Lys Gly Ser Leu Gly Thr Ser Gly Asp Leu Gly Pro Leu Ala Ala
165 170 175
Ile Ala Leu Val Cys Thr Gly Gln Trp Lys Ala Arg Tyr Gln Gly Glu
180 185 190
Gln Met Ser Gly Ala Met Ala Leu Glu Lys Ala Gly Ile Ser Pro Met
195 200 205
Glu Leu Ser Phe Lys Glu Gly Leu Ala Leu Ile Asn Gly Thr Ser Ala
210 215 220
Met Val Gly Leu Gly Val Leu Leu Tyr Asp Glu Val Lys Arg Leu Phe
225 230 235 240
Asp Thr Tyr Leu Thr Val Thr Ser Leu Ser Ile Glu Gly Leu His Gly
245 250 255
Lys Thr Lys Pro Phe Glu Pro Ala Val His Arg Met Lys Pro His Gln
260 265 270
Gly Gln Leu Glu Val Ala Thr Thr Ile Trp Glu Thr Leu Ala Asp Ser
275 280 285
Ser Leu Ala Val Asn Glu His Glu Val Glu Lys Leu Ile Ala Glu Glu
290 295 300
Met Asp Gly Leu Val Lys Ala Ser Asn His Gln Ile Glu Asp Ala Tyr
305 310 315 320
Ser Ile Arg Cys Thr Pro Gln Ile Leu Gly Pro Val Ala Asp Thr Leu
325 330 335
Lys Asn Ile Lys Gln Thr Leu Thr Asn Glu Leu Asn Ser Ser Asn Asp
340 345 350
Asn Pro Leu Ile Asp Gln Thr Thr Glu Glu Val Phe His Asn Gly His
355 360 365
Phe His Gly Gln Tyr Val Ser Met Ala Met Asp His Leu Asn Ile Ala
370 375 380
Leu Val Thr Met Met Asn Leu Ala Asn Arg Arg Ile Asp Arg Phe Met
385 390 395 400
Asp Lys Ser Asn Ser Asn Gly Leu Pro Pro Phe Leu Cys Ala Glu Asn
405 410 415
Ala Gly Leu Arg Leu Gly Leu Met Gly Gly Gln Phe Met Thr Ala Ser
420 425 430
Ile Thr Ala Glu Ser Arg Ala Ser Cys Met Pro Met Ser Ile Gln Ser
435 440 445
Leu Ser Thr Thr Gly Asp Phe Gln Asp Ile Val Ser Phe Gly Leu Val
450 455 460
Ala Ala Arg Arg Val Arg Glu Gln Leu Lys Asn Leu Lys Tyr Val Phe
465 470 475 480
Ser Phe Glu Leu Leu Cys Ala Cys Gln Ala Val Asp Ile Arg Gly Thr
485 490 495
Ala Gly Leu Ser Lys Arg Thr Arg Ala Leu Tyr Asp Lys Thr Arg Thr
500 505 510
Leu Val Pro Tyr Leu Glu Glu Asp Lys Thr Ile Ser Asp Tyr Ile Glu
515 520 525
Ser Ile Ala Gln Thr Val Leu Thr Lys Asn Ser Asp Ile
530 535 540
<210> 4
<211> 36
<212> DNA
<213>artificial synthesized
<400> 4
atgggtggtt tcgttaacta ttgggttccg attgca 36
<210> 5
<211> 36
<212> DNA
<213>artificial synthesized
<400> 5
gcttgctttt gcaatcggaa cccaatagtt aacgaa 36
Claims (10)
1. a kind of Phenylalanine aminomutase mutant, which is characterized in that contain amino acid sequence shown in SEQ ID NO.2
Column.
2. encoding the gene of Phenylalanine aminomutase mutant described in claim 1.
3. the carrier containing gene described in claim 2.
4. expressing the cell of Phenylalanine aminomutase mutant described in claim 1.
5. a kind of genetic engineering bacterium, which is characterized in that be with Escherichia coli for host, express phenylpropyl alcohol shown in SEQ ID NO.2
Histidine amino group conjugates enzyme mutant.
6. genetic engineering bacterium according to claim 5, which is characterized in that with e. coli bl21 be host, with pET series
Plasmid is carrier.
7. a kind of method for improving Phenylalanine aminomutase stability, which is characterized in that by benzene shown in SEQ ID NO.3
The 91st amino acids of alanine aminomutase sport methionine.
8. the genetic engineering bacterium of claim 5 or 6 is in the application of fermentation arts.
9. a kind of method for producing Phenylalanine aminomutase mutant described in claim 1, which is characterized in that right
Genetic engineering bacterium described in asking 5 or 6 is inoculated in LB culture medium, in 35-37 DEG C of culture to OD600For 0.6-0.8, induction is added
Agent IPTG is in 20-22 DEG C of induction 16-18h.
10. Phenylalanine aminomutase mutant described in claim 1 or the genetic engineering bacterium of claim 5 or 6 are being made
It is standby to contain the application in β-phenylalanine product.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811493273.9A CN109337891B (en) | 2018-12-07 | 2018-12-07 | Phenylalanine aminomutase mutant with improved thermal stability |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811493273.9A CN109337891B (en) | 2018-12-07 | 2018-12-07 | Phenylalanine aminomutase mutant with improved thermal stability |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109337891A true CN109337891A (en) | 2019-02-15 |
| CN109337891B CN109337891B (en) | 2020-11-06 |
Family
ID=65297586
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811493273.9A Active CN109337891B (en) | 2018-12-07 | 2018-12-07 | Phenylalanine aminomutase mutant with improved thermal stability |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109337891B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1871357A (en) * | 2002-02-08 | 2006-11-29 | 布里斯托尔-迈尔斯斯奎布公司 | Compositions and methods for altering biosynthesis of taxanes and taxane-related compounds |
| CN106497905A (en) * | 2016-12-14 | 2017-03-15 | 江南大学 | The mutant of the PD in one plant of anabena source |
| CN106636048A (en) * | 2016-12-14 | 2017-05-10 | 江南大学 | Phenylalanine deaminase mutant with improved enzyme activity |
| CN108004225A (en) * | 2017-12-19 | 2018-05-08 | 江南大学 | A kind of mutant of the Phenylalanine aminomutase in pantoea agglomerans source |
-
2018
- 2018-12-07 CN CN201811493273.9A patent/CN109337891B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1871357A (en) * | 2002-02-08 | 2006-11-29 | 布里斯托尔-迈尔斯斯奎布公司 | Compositions and methods for altering biosynthesis of taxanes and taxane-related compounds |
| CN106497905A (en) * | 2016-12-14 | 2017-03-15 | 江南大学 | The mutant of the PD in one plant of anabena source |
| CN106636048A (en) * | 2016-12-14 | 2017-05-10 | 江南大学 | Phenylalanine deaminase mutant with improved enzyme activity |
| CN108004225A (en) * | 2017-12-19 | 2018-05-08 | 江南大学 | A kind of mutant of the Phenylalanine aminomutase in pantoea agglomerans source |
Non-Patent Citations (4)
| Title |
|---|
| BIAN WU 等: "Enzymatic Synthesis of Enantiopure a- and b-Amino Acids by Phenylalanine Aminomutase-Catalysed Amination of Cinnamic Acid Derivatives", 《CHEMBIOCHEM》 * |
| 刘辉 等: "成团泛菌苯丙氨酸氨基变位酶的热稳定性改造", 《食品与发酵工业》 * |
| 李斌 等主编: "《食品酶学与酶工程第2版》", 30 September 2017, 中国农业大学出版社 * |
| 葛飞 等: "产β-苯丙氨酸变位酶基因工程菌的构建及其发酵条件优化", 《食品与机械》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109337891B (en) | 2020-11-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109593750B (en) | Nitrile hydratase mutant, genetic engineering bacterium containing same and application thereof | |
| CN108467860B (en) | Method for high yield of gamma-aminobutyric acid | |
| CN109486794B (en) | Chitinase mutant with improved enzyme activity | |
| CN110938580A (en) | Method for improving production efficiency of D-tyrosine | |
| CN111534493A (en) | Purine nucleoside phosphorylase mutant, gene and application | |
| CN109777788B (en) | Leucine dehydrogenase mutant and application thereof | |
| CN113337495B (en) | Method for improving sialic acid yield and application | |
| CN109321509B (en) | Method for producing 1, 2-aminoalcohol compound by whole cell transformation | |
| WO2020147031A1 (en) | Nitrile hydratase mutant, genetically engineered bacterium containing same, and use thereof | |
| CN108004225B (en) | Mutant of phenylalanine aminomutase from Pantoea agglomerans | |
| CN103695443B (en) | A kind of Novel carbonyl reductase, its gene and application | |
| CN111808829A (en) | Gamma-glutamyl methylamine synthetase mutant and application thereof | |
| CN104877983B (en) | A kind of trehalose synthase mutant and its preparation and application | |
| CN109337891A (en) | A kind of Phenylalanine aminomutase mutant that thermal stability improves | |
| CN109370997B (en) | Phenylalanine aminomutase mutant | |
| CN110643585B (en) | Method for producing alpha-ketone-beta-methyl n-pentanoic acid by using amino acid deaminase | |
| CN110904088B (en) | High-temperature-resistant D-psicose3-epimerase, mutant and application thereof | |
| CN113215120A (en) | Method for producing trans-4-hydroxy-L-proline by recombinant escherichia coli transformation | |
| CN109182286B (en) | Improved cyano reductase and application thereof in synthesis of 3-chloropyrazine-2 methylamine | |
| CN114107270B (en) | L-aspartic acid beta-decarboxylase mutant | |
| CN111057697A (en) | High-temperature-resistant TIM barrel protein mutant and application thereof | |
| CN110713965A (en) | Method for producing 1, 2-aminoalcohol compound by whole cell transformation | |
| CN115786296B (en) | Meso-diaminopimelate dehydrogenase mutant and production method thereof | |
| CN110904086B (en) | Tryptophanase mutant and application thereof | |
| CN114621944B (en) | Arginine deiminase mutant with improved enzyme activity |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |