CN109337891B - Phenylalanine aminomutase mutant with improved thermal stability - Google Patents
Phenylalanine aminomutase mutant with improved thermal stability Download PDFInfo
- Publication number
- CN109337891B CN109337891B CN201811493273.9A CN201811493273A CN109337891B CN 109337891 B CN109337891 B CN 109337891B CN 201811493273 A CN201811493273 A CN 201811493273A CN 109337891 B CN109337891 B CN 109337891B
- Authority
- CN
- China
- Prior art keywords
- mutant
- leu
- ser
- enzyme
- ala
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/90—Isomerases (5.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P13/00—Preparation of nitrogen-containing organic compounds
- C12P13/04—Alpha- or beta- amino acids
- C12P13/22—Tryptophan; Tyrosine; Phenylalanine; 3,4-Dihydroxyphenylalanine
- C12P13/222—Phenylalanine
Abstract
The invention discloses a phenylalanine aminomutase mutant with improved thermal stability, and belongs to the technical field of enzyme engineering. The mutant sequence of the phenylalanine aminomutase is shown in SEQ ID NO.2, the specific enzyme activity of the mutant enzyme is slightly improved compared with that of a wild type, 83% of residual enzyme activity still exists after 1 hour of treatment at 50 ℃, the temperature stability is greatly improved compared with that of the wild type enzyme, and the mutant is more suitable for industrial production.
Description
Technical Field
The invention relates to a phenylalanine aminomutase mutant, belonging to the technical field of enzyme engineering.
Background
Phenylalanine Aminomutase (PAM) can be used for catalyzing phenylalanine to isomerize, and catalyzing alpha-phenylalanine to be transformed into beta-phenylalanine with higher medicinal value, and the beta-phenylalanine is an important precursor for synthesizing anticancer drug paclitaxel, and has wide market prospect. However, the reaction is an exothermic reaction, and the structure of the enzyme is affected by high temperature in the production process, so that the enzyme activity is reduced, a large amount of energy consumption is generated, and the production cost is increased. In addition, the enzyme has relatively low enzyme activity in the catalytic process, and is not beneficial to the generation of beta phenylalanine. In the production catalysis process, the improvement of the thermal stability and the enzyme activity is particularly important.
Currently, phenylalanine aminomutases are mainly derived from Pantoea agglomerans (Pantoea agglomerans), Streptomyces marinus (Streptomyces maritimus) and Taxus chinensis (Taxus chinensis). The target gene from the taxus chinensis is not ideal to express in prokaryotes, the gene from the streptomyces marinus shows the activity of phenylalanine lyase at higher temperature, and the activity and the thermal stability of the phenylalanine aminomutase from the wild pantoea agglomerans are limited. Therefore, the obtained phenylalanine aminomutase with improved enzyme activity and enhanced stability has important application value for industrial production of beta-phenylalanine.
Disclosure of Invention
The first purpose of the invention is to provide a phenylalanine aminomutase mutant which contains an amino acid sequence shown in SEQ ID NO. 2.
It is a second object of the present invention to provide a gene encoding the mutant.
In one embodiment of the invention, the gene comprises the nucleotide sequence shown in SEQ ID NO. 1.
The third purpose of the invention is to provide a vector containing the gene.
It is a fourth object of the present invention to provide a cell expressing the phenylalanine aminomutase mutant.
The fifth purpose of the invention is to provide a genetic engineering bacterium, which takes escherichia coli as a host and expresses phenylalanine aminomutase mutant I91M shown in SEQ ID NO. 2.
In one embodiment of the invention, the genetically engineered bacterium takes escherichia coli BL21 as a host.
In one embodiment of the invention, the genetically engineered bacterium uses pET series plasmids as vectors.
In one embodiment of the invention, the vector is pET28 a.
The sixth purpose of the invention is to provide a method for improving the stability of phenylalanine aminomutase, which is to mutate isoleucine 91 of phenylalanine aminomutase shown in SEQ ID NO.3 into methionine.
The seventh purpose of the invention is to provide a method for producing the phenylalanine aminomutase mutant, which comprises the steps of inoculating the genetic engineering bacteria expressing the phenylalanine aminomutase mutant into an LB culture medium, and culturing at 35-37 ℃ to OD600When the temperature is 0.6-0.8 ℃, adding an inducer IPTG to induce for 16-18h at 20-22 ℃.
In one embodiment of the invention, the method is to inoculate the genetically engineered bacteria in LB expression medium containing kanamycin, and culture the bacteria at 37 ℃ and 200r/min in a shaking way until OD is reached600When the concentration is 0.6-0.8, adding inducer IPTG to 0.1mM, and inducing at 20 deg.C for 16-18h to express phenylalanine aminomutase mutant enzyme.
In one embodiment of the invention, the method further comprises collecting the thallus of the genetically engineered bacteria, crushing the thallus, collecting the supernatant, performing membrane filtration on the supernatant, and separating by using a His Trap HP column to obtain the phenylalanine aminomutase mutant.
The invention also provides the phenylalanine aminomutase mutant and application of the genetic engineering bacteria in preparation of products containing beta-phenylalanine.
Has the advantages that: the optimum pH value of the phenylalanine aminomutase mutant I91M is 8.5, the optimum temperature is 55 ℃, 83% of residual enzyme activity still remains after 1 hour of 50 ℃ treatment, and the residual enzyme activity is improved by about 2.3 times compared with that of the wild enzyme which remains 25% of enzyme activity after 1 hour of 50 ℃ treatment; the thermal stability of the mutant is obviously improved. Meanwhile, the mutant also has better catalytic activity, and the specific enzyme activity is slightly improved compared with that of wild enzyme; therefore, the phenylalanine aminomutase mutant I91M provided by the invention has good enzymological properties and is beneficial to subsequent industrial production.
Drawings
FIG. 1: the enzyme activity curves of the wild enzyme and the mutant enzyme I91M at different temperatures, and Pa (wt) is the wild enzyme.
FIG. 2: the enzyme activity curves of the wild enzyme and the mutant enzyme I91M at different pH values at 50 ℃, and Pa (wt) is the wild enzyme.
FIG. 3: the thermostability curves after storage at 50 ℃ for the wild enzyme and the mutant enzyme I91M, Pa (wt) for the wild enzyme.
FIG. 4: the enzyme activity histograms of the wild enzyme and the mutant enzyme I91M at 50 ℃ are shown, and Pa (wt) is the wild enzyme.
FIG. 5: wild enzyme and mutant enzyme A95G, A95R, I91H and I91M are treated at 50 ℃ for 1h, and the residual enzyme activity is remained, wherein PA is wild enzyme.
FIG. 6: relative enzyme activity histograms of the wild enzyme and the mutant enzymes I91H, I91V and I91M at 50 ℃, Pa (wt) is the wild enzyme.
Detailed Description
Definition of enzyme activity (U): the amount of enzyme required to convert L- α -phenylalanine to 1. mu. mol/L β -phenylalanine per minute was defined as 1U.
Specific enzyme activity (U/mg): enzyme activity per mg of PAM.
Definition of relative (residual) enzyme activity: the wild enzyme and the mutant enzyme were reacted in PBS buffer at pH 8.5 at 50 ℃ for 30min, and the amount of the product formed was determined, and the yield based on the wild enzyme was defined as 100%.
LB culture medium: 10g/L of peptone, 5g/L of yeast extract and 10g/L of NaCl.
Phenylalanine aminomutase reaction system: substrate is 200 μ L20 mM L-alpha-phenylalanine, 100 μ g pure enzyme is added, 200 μ L phosphate buffer solution is added, reaction is stopped at 100 deg.C after 30min, and precipitate is removed by centrifugation, and supernatant is taken out and used as sample for liquid phase determination after passing through 0.22 μm membrane.
Detection of phenylalanine aminomutase: performing HPLC detection by using Agilent 1260, wherein a mobile phase is a water acetonitrile buffer solution; the detection wavelength is 254nm, and the flow rate is 0.5 ml/min; the chromatographic column is a C18 column.
Determination of optimum reaction pH: and respectively measuring the enzyme activities of the wild enzyme and the mutant in buffer solutions with different pH values, calculating the relative enzyme activities, and determining the optimal reaction pH value.
Determination of optimum reaction temperature: respectively measuring the activity of the wild enzyme and the mutant enzyme under different temperature conditions, determining the relative enzyme activity and determining the optimal reaction temperature.
Determination of temperature stability: and (3) respectively preserving the wild enzyme and the mutant in PBS buffer solution with the pH value of 8.5 at 50 ℃ for 30min, 1h and 2h, and then determining the residual enzyme activity to obtain a temperature stability result.
Example 1
(1) Construction of mutant I91M:
Pa-PAM gene (shown as SEQ ID NO. 1) is synthesized by a chemical synthesis method, and cloned at NdeI and HindIII enzyme cutting sites of pET28a plasmid, and the enzyme cutting sites are finished by Tianlin biotechnology company to obtain pET28a-PAM recombinant plasmid. Using pET28a-PAM as a template, carrying the recombinant plasmid pET28a-PAM-I91M of the coding mutant gene is obtained after transforming E.coli JM109 with the PCR product by PCR with the primers shown in Table 1 under the conditions shown in Table 2. E.coli BL21 strain was transformed with the recombinant plasmid pET28a-PAM-I91M to obtain recombinant strain BL21/pET28 a-PAM-I91M.
TABLE 1 primers
| P1 | ATGGGTGGTTTCGTTAACTATTGGGTTCCGATTGCA |
| P2 | GCTTGCTTTTGCAATCGGAACCCAATAGTTAACGAA |
TABLE 2 Whole plasmid PCR amplification reaction System
| Reagent | Dosage of |
| ddH2O | 32μL |
| 5×PS Buffer(Mg2+plus) | 10μL |
| dNTPMixture(2mmol/L) | 4μL |
| P1(10mmol/L)、P2(10mmol/L) | Each 1 mu L |
| pET28a-PAM | 1μL |
| Primer STAR HS DNA polymerase | 1μL |
| In total | 50μL |
The PCR amplification reaction conditions are as follows:
the PCR product was identified by agarose gel electrophoresis. Then, the PCR product is purified and digested and transferred into competent cells of Escherichia coli BL 21.
(2) Recombinant Escherichia coli BL21/pET28a-PAM-I91M was inoculated into 4mL of LB medium (peptone 10g/L, yeast extract 5g/L, NaCl10g/L) with a kanamycin concentration of 100. mu.g/mL, and cultured overnight at 37 ℃ with shaking at 200 r/min.
The above overnight culture was inoculated into 100mL containing 100. mu.g/mL kanamycin in an amount of 1% (v/v)Culturing in LB expression medium (peptone 10g/L, yeast extract 5g/L, NaCl10g/L) at 37 deg.C under shaking at 200r/min to OD600When the concentration is 0.6-0.8, adding inducer IPTG to 0.1mM, inducing at 20 deg.C for 16-18h to obtain thallus, and centrifuging at a rotation speed of 5000g to collect thallus.
(3) The recombinant cells were dissolved in 20mL of binding buffer (50mmol/L Na)2HPO4、50mmol/L NaH2PO4500mmol/L NaCl, 20mmol/L imidazole), sonicated, 13000g centrifuged for 25min, and the supernatant filtered through a 0.22 μm filter. A1 mL His Trap HP column was equilibrated with 10 column volumes of binding buffer, non-specifically adsorbed proteins were washed off with 15 column volumes of binding buffer, proteins were eluted with 8 column volumes of buffers of 150, 300 and 500mmol/L imidazole, respectively, and samples were collected and identified by SDS-PAGE analysis.
Example 2
Mu.g of the mutant enzyme purified in example 1 was added to 200. mu.L of a buffer reaction system, 200. mu.L of the substrate L- α -phenylalanine was added, and the reaction was carried out at 40 ℃, 45 ℃, 50 ℃, 55 ℃ and 60 ℃ for 30min to determine the corresponding enzyme activity. The non-mutated wild enzyme was used as a control, and the other conditions were the same as for the enzyme mutant.
As shown in FIG. 1, the optimum temperature for the wild-type enzyme was 50 ℃. The enzyme activity of the enzyme mutant I91M at 50 ℃ is 92%, the enzyme activity at 55 ℃ is the highest, and the optimal reaction temperature is increased by 5 ℃ compared with that of wild enzyme.
Example 3
PBS buffer solutions of different pH were prepared: the pH was set to 8.0, 8.5, 9.0, 9.5. Respectively placing wild enzyme and enzyme mutant I91M in buffer solutions with different pH values at 50 deg.C for 30min, and measuring enzyme activity.
As shown in fig. 2, the enzyme activity was highest at pH 8.5, defined as 100%, and the mutant enzyme activity was maintained at 80% or less at pH 9 and 9.5. Indicating that the mutant is easily inactivated under alkaline conditions.
Example 4
Respectively taking 100 mu g of wild enzyme and enzyme mutant I91M in 200 mu L of buffer solution, preserving in a metal bath at 50 ℃ for 30min-2h, sampling, and determining the residual enzyme activity.
As shown in FIG. 3, it was found that after the mutant enzyme was treated at 50 ℃ for 60min, the residual enzyme activity of the mutant enzyme was increased from 25% of that of the wild enzyme to 83%, which was only reduced by 9% compared with the initial enzyme activity of the enzyme mutant I91M at 50 ℃; after 30min and 120min of treatment at 50 ℃, the relative enzyme activity of the mutant enzyme is improved to 90 percent and 22 percent from 49 percent and 17 percent of the wild enzyme. The thermal stability of the mutant is obviously improved.
Example 5
Respectively taking 100 mu g of wild enzyme and enzyme mutant I91M in 200 mu L of buffer solution, reacting for 30min in a metal bath at 50 ℃ by taking alpha phenylalanine as a substrate, sampling and inactivating at 100 ℃, and determining the enzyme activities of the wild enzyme and the mutant. The product yield catalyzed by the proenzyme was defined as 100%.
As shown in FIG. 4, the mutant is found to have the catalytic efficiency improved from 410U/mg to 440U/mg after reacting for 30min at 50 ℃.
Example 6
Preparing alpha-phenylalanine at a substrate concentration of 1mM, 3mM, 5mM, 7mM, 10mM, 12mM, 15mM, 20mM, 25mM, 30mM, 35mM, 40mM, 45mM, 50mM, carrying out the catalytic reaction, measuring the product formation rate, and performing data fitting by using origin software to measure KmValue sum KcatAnd calculating the specific enzyme activity. The kinetic parameters of the wild enzyme and the enzyme mutant I91M were analyzed, and the results are shown in Table 3, and K was foundmAnd KcatThe values all tend to be larger, and the specific activity is slightly improved.
Table 3 wild enzyme pa (wt) and mutant kinetic parameters.
Comparative example 1
Phenylalanine aminomutase shown in SEQ ID NO.3 is used as parent enzyme, alanine at the 95 th position is mutated into glycine and arginine respectively to obtain enzyme mutants A95G and A95R, isoleucine at the 91 th position is mutated into histidine and methionine, and enzyme mutants I91H and I91M are obtained. The wild enzyme and the mutant enzyme were stored in PBS buffer (100. mu.g/200. mu. LpH-8.5) in a metal bath at 50 ℃ for 1 hour, and then sampled to determine the residual enzyme activity. As shown in FIG. 5, the residual enzyme activities of the wild enzymes A95G, A95R, I91H and I91M are 25%, 45%, 43%, 68% and 83%, respectively.
Comparative example 2
Phenylalanine aminomutase shown in SEQ ID NO.3 is used as parent enzyme, isoleucine at position 91 is mutated into histidine, valine and methionine respectively, and enzyme mutants I91H, I91V and I91M are obtained. The reaction was carried out at 50 ℃ for 30min in PBS buffer at pH 8.5, and the amount of the product formed was determined and defined as 100% based on the yield catalyzed by the wild-type enzyme. The relative enzyme activities of I91H, I91V and I91M were 50%, 78% and 107%, respectively, as shown in FIG. 6.
Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.
SEQUENCE LISTING
<110> university of south of the Yangtze river
<120> phenylalanine aminomutase mutant with improved thermostability
<160>5
<170>PatentIn version 3.3
<210>1
<211>1626
<212>DNA
<213> Artificial Synthesis
<400>1
atgagcattg tgaatgaaag cggtagccag ccggttgtta gccgtgatga aaccctgagc 60
cagattgaac gtaccagctt tcatattagc agcggcaaag atattagcct ggaagaaatt 120
gcacgcgcag cacgtgatca tcagccggtt acactgcatg atgaagttgt taatcgtgtt 180
acccgtagcc gtagcattct ggaaagcatg gttagtgatg aacgtgtgat ttatggtgtg 240
aataccagca tgggtggttt cgttaactat atggttccga ttgcaaaagc aagcgaactg 300
cagaataatc tgattaatgc agttgccacc aatgtgggca aatatttcga tgataccacc 360
gttcgtgcaa ccatgctggc acgtattgtt agcctgagcc gtggtaatag cgcaattagc 420
attgtcaact tcaaaaaact gatcgagatc tacaatcagg gtattgtgcc gtgtattccg 480
gaaaaaggta gcctgggcac cagcggtgat ctgggtccgc tggcagcaat tgcactggtt 540
tgtaccggtc agtggaaagc acgttatcag ggtgagcaga tgagcggtgc aatggcactg 600
gaaaaagcag gtattagccc gatggaactg agctttaaag aaggtctggc actgattaac 660
ggtacaagcg caatggttgg tctgggtgtt ctgctgtatg atgaggttaa acgtctgttt 720
gatacctatc tgaccgttac cagcctgagc attgaaggtc tgcatggtaa aaccaaaccg 780
tttgaaccgg cagttcatcg tatgaaaccg catcagggtc agctggaagt tgcaaccacc 840
atttgggaaa ccctggcaga tagcagcctg gcagttaatg aacatgaagt tgagaaactg 900
attgccgaag aaatggatgg cctggttaaa gcaagcaatc atcagattga agatgcctat 960
agcattcgtt gtacaccgca gattctgggt cctgttgcag ataccctgaa aaacattaaa 1020
cagaccctga ccaatgaact gaatagcagc aatgataatc cgctgattga tcagaccacc 1080
gaagaagttt ttcataacgg tcattttcat ggccagtatg tgagcatggc aatggatcat 1140
ctgaatattg ccctggttac catgatgaat ctggcaaatc gtcgtattga tcgcttcatg 1200
gataaaagca atagcaatgg tctgcctccg tttctgtgtg cagaaaatgc aggtctgcgt 1260
ctgggtctga tgggtggtca gtttatgacc gcaagcatta ccgcagaaag ccgtgcaagc 1320
tgtatgccga tgagcattca gagcctgagt accaccggtg attttcagga tattgtgagc 1380
tttggtctgg ttgcagcacg tcgtgttcgt gaacagctga aaaatctgaa atatgtgttt 1440
agcttcgaac tgctgtgtgc atgtcaggca gttgatattc gtggcaccgc aggtctgagc 1500
aaacgtaccc gtgcactgta tgataaaacc cgtacactgg ttccgtatct ggaagaagat 1560
aaaaccatca gcgattatat cgaaagcatt gcacagaccg ttctgaccaa aaacagcgat 1620
atttaa 1626
<210>2
<211>541
<212>PRT
<213> Artificial Synthesis
<400>2
Met Ser Ile Val Asn Glu Ser Gly Ser Gln Pro Val Val Ser Arg Asp
1 5 10 15
Glu Thr Leu Ser Gln Ile Glu Arg Thr Ser Phe His Ile Ser Ser Gly
20 25 30
Lys Asp Ile Ser Leu Glu Glu Ile Ala Arg Ala Ala Arg Asp His Gln
35 40 45
Pro Val Thr Leu His Asp Glu Val Val Asn Arg Val Thr Arg Ser Arg
50 55 60
Ser Ile Leu Glu Ser Met Val Ser Asp Glu Arg Val Ile Tyr Gly Val
65 70 75 80
Asn Thr Ser Met Gly Gly Phe Val Asn Tyr Met Val Pro Ile Ala Lys
85 90 95
Ala Ser Glu Leu Gln Asn Asn Leu Ile Asn Ala Val Ala Thr Asn Val
100 105 110
Gly Lys Tyr Phe Asp Asp Thr Thr Val Arg Ala Thr Met Leu Ala Arg
115 120 125
Ile Val Ser Leu Ser Arg Gly Asn Ser Ala Ile Ser Ile Val Asn Phe
130 135 140
Lys Lys Leu Ile Glu Ile Tyr Asn Gln Gly Ile Val Pro Cys Ile Pro
145 150 155 160
Glu Lys Gly Ser Leu Gly Thr Ser Gly Asp Leu Gly Pro Leu Ala Ala
165 170 175
Ile Ala Leu Val Cys Thr Gly Gln Trp Lys Ala Arg Tyr Gln Gly Glu
180 185 190
Gln Met Ser Gly Ala Met Ala Leu Glu Lys Ala Gly Ile Ser Pro Met
195 200 205
Glu Leu Ser Phe Lys Glu Gly Leu Ala Leu Ile Asn Gly Thr Ser Ala
210 215 220
Met Val Gly Leu Gly Val Leu Leu Tyr Asp Glu Val Lys Arg Leu Phe
225 230 235 240
Asp Thr Tyr Leu Thr Val Thr Ser Leu Ser Ile Glu Gly Leu His Gly
245 250 255
Lys Thr Lys Pro Phe Glu Pro Ala Val His Arg Met Lys Pro His Gln
260 265 270
Gly Gln Leu Glu Val Ala Thr Thr Ile Trp Glu Thr Leu Ala Asp Ser
275 280 285
Ser Leu Ala Val Asn Glu His Glu Val Glu Lys Leu Ile Ala Glu Glu
290 295300
Met Asp Gly Leu Val Lys Ala Ser Asn His Gln Ile Glu Asp Ala Tyr
305 310 315 320
Ser Ile Arg Cys Thr Pro Gln Ile Leu Gly Pro Val Ala Asp Thr Leu
325 330 335
Lys Asn Ile Lys Gln Thr Leu Thr Asn Glu Leu Asn Ser Ser Asn Asp
340 345 350
Asn Pro Leu Ile Asp Gln Thr Thr Glu Glu Val Phe His Asn Gly His
355 360 365
Phe His Gly Gln Tyr Val Ser Met Ala Met Asp His Leu Asn Ile Ala
370 375 380
Leu Val Thr Met Met Asn Leu Ala Asn Arg Arg Ile Asp Arg Phe Met
385 390 395 400
Asp Lys Ser Asn Ser Asn Gly Leu Pro Pro Phe Leu Cys Ala Glu Asn
405 410 415
Ala Gly Leu Arg Leu Gly Leu Met Gly Gly Gln Phe Met Thr Ala Ser
420 425 430
Ile Thr Ala Glu Ser Arg Ala Ser Cys Met Pro Met Ser Ile Gln Ser
435 440 445
Leu Ser Thr Thr Gly Asp Phe Gln Asp Ile Val Ser Phe Gly Leu Val
450 455460
Ala Ala Arg Arg Val Arg Glu Gln Leu Lys Asn Leu Lys Tyr Val Phe
465 470 475 480
Ser Phe Glu Leu Leu Cys Ala Cys Gln Ala Val Asp Ile Arg Gly Thr
485 490 495
Ala Gly Leu Ser Lys Arg Thr Arg Ala Leu Tyr Asp Lys Thr Arg Thr
500 505 510
Leu Val Pro Tyr Leu Glu Glu Asp Lys Thr Ile Ser Asp Tyr Ile Glu
515 520 525
Ser Ile Ala Gln Thr Val Leu Thr Lys Asn Ser Asp Ile
530 535 540
<210>3
<211>541
<212>PRT
<213>Pantoea agglomerans
<400>3
Met Ser Ile Val Asn Glu Ser Gly Ser Gln Pro Val Val Ser Arg Asp
1 5 10 15
Glu Thr Leu Ser Gln Ile Glu Arg Thr Ser Phe His Ile Ser Ser Gly
20 25 30
Lys Asp Ile Ser Leu Glu Glu Ile Ala Arg Ala Ala Arg Asp His Gln
35 40 45
Pro Val Thr Leu His Asp Glu Val Val Asn Arg Val Thr Arg Ser Arg
50 55 60
Ser Ile Leu Glu Ser Met Val Ser Asp Glu Arg Val Ile Tyr Gly Val
65 70 75 80
Asn Thr Ser Met Gly Gly Phe Val Asn Tyr Ile Val Pro Ile Ala Lys
85 90 95
Ala Ser Glu Leu Gln Asn Asn Leu Ile Asn Ala Val Ala Thr Asn Val
100 105 110
Gly Lys Tyr Phe Asp Asp Thr Thr Val Arg Ala Thr Met Leu Ala Arg
115 120 125
Ile Val Ser Leu Ser Arg Gly Asn Ser Ala Ile Ser Ile Val Asn Phe
130 135 140
Lys Lys Leu Ile Glu Ile Tyr Asn Gln Gly Ile Val Pro Cys Ile Pro
145 150 155 160
Glu Lys Gly Ser Leu Gly Thr Ser Gly Asp Leu Gly Pro Leu Ala Ala
165 170 175
Ile Ala Leu Val Cys Thr Gly Gln Trp Lys Ala Arg Tyr Gln Gly Glu
180 185 190
Gln Met Ser Gly Ala Met Ala Leu Glu Lys Ala Gly Ile Ser Pro Met
195 200 205
Glu Leu Ser Phe Lys Glu Gly Leu Ala Leu Ile Asn Gly Thr Ser Ala
210 215 220
Met Val Gly Leu Gly Val Leu Leu Tyr Asp Glu Val Lys Arg Leu Phe
225 230 235 240
Asp Thr Tyr Leu Thr Val Thr Ser Leu Ser Ile Glu Gly Leu His Gly
245 250 255
Lys Thr Lys Pro Phe Glu Pro Ala Val His Arg Met Lys Pro His Gln
260 265 270
Gly Gln Leu Glu Val Ala Thr Thr Ile Trp Glu Thr Leu Ala Asp Ser
275 280 285
Ser Leu Ala Val Asn Glu His Glu Val Glu Lys Leu Ile Ala Glu Glu
290 295 300
Met Asp Gly Leu Val Lys Ala Ser Asn His Gln Ile Glu Asp Ala Tyr
305 310 315 320
Ser Ile Arg Cys Thr Pro Gln Ile Leu Gly Pro Val Ala Asp Thr Leu
325 330 335
Lys Asn Ile Lys Gln Thr Leu Thr Asn Glu Leu Asn Ser Ser Asn Asp
340 345 350
Asn Pro Leu Ile Asp Gln Thr Thr Glu Glu Val Phe His Asn Gly His
355 360 365
Phe His Gly Gln Tyr Val Ser Met Ala Met Asp His Leu Asn Ile Ala
370 375 380
Leu Val Thr Met Met Asn Leu Ala Asn Arg Arg Ile Asp Arg Phe Met
385 390 395 400
Asp Lys Ser Asn Ser Asn Gly Leu Pro Pro Phe Leu Cys Ala Glu Asn
405 410 415
Ala Gly Leu Arg Leu Gly Leu Met Gly Gly Gln Phe Met Thr Ala Ser
420 425 430
Ile Thr Ala Glu Ser Arg Ala Ser Cys Met Pro Met Ser Ile Gln Ser
435 440 445
Leu Ser Thr Thr Gly Asp Phe Gln Asp Ile Val Ser Phe Gly Leu Val
450 455 460
Ala Ala Arg Arg Val Arg Glu Gln Leu Lys Asn Leu Lys Tyr Val Phe
465 470 475 480
Ser Phe Glu Leu Leu Cys Ala Cys Gln Ala Val Asp Ile Arg Gly Thr
485 490 495
Ala Gly Leu Ser Lys Arg Thr Arg Ala Leu Tyr Asp Lys Thr Arg Thr
500 505 510
Leu Val Pro Tyr Leu Glu Glu Asp Lys Thr Ile Ser Asp Tyr Ile Glu
515 520 525
Ser Ile Ala Gln Thr Val Leu Thr Lys Asn Ser Asp Ile
530535 540
<210>4
<211>36
<212>DNA
<213> Artificial Synthesis
<400>4
atgggtggtt tcgttaacta ttgggttccg attgca 36
<210>5
<211>36
<212>DNA
<213> Artificial Synthesis
<400>5
gcttgctttt gcaatcggaa cccaatagtt aacgaa 36
Claims (10)
1. A phenylalanine aminomutase mutant is characterized in that the amino acid sequence of the mutant is shown in SEQ ID NO. 2.
2. A gene encoding the phenylalanine aminomutase mutant according to claim 1.
3. A vector comprising the gene of claim 2.
4. A cell expressing the phenylalanine aminomutase mutant of claim 1.
5. A genetically engineered bacterium is characterized in that escherichia coli is used as a host to express a phenylalanine aminomutase mutant shown in SEQ ID No. 2.
6. The genetically engineered bacterium of claim 5, wherein Escherichia coli BL21 is used as a host, and pET-series plasmids are used as vectors.
7. A method for improving the stability of phenylalanine aminomutase is characterized in that the 91 st amino acid of the phenylalanine aminomutase shown in SEQ ID NO.3 is mutated into methionine, and the improvement of the stability of the phenylalanine aminomutase is to improve the thermal stability of the phenylalanine aminomutase.
8. The use of the genetically engineered bacteria of claim 5 or 6 in the field of fermentation.
9. A method for producing the phenylalanine aminomutase mutant according to claim 1, wherein the genetically engineered bacterium according to claim 5 or 6 is inoculated into LB medium and cultured at 35-37 ℃ to OD6000.6-0.8, adding inducer IPTG, and inducing at 20-22 deg.C for 16-18 h.
10. Use of the phenylalanine aminomutase mutant according to claim 1 or the genetically engineered bacterium according to claim 5 or 6 for producing a product containing β -phenylalanine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811493273.9A CN109337891B (en) | 2018-12-07 | 2018-12-07 | Phenylalanine aminomutase mutant with improved thermal stability |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811493273.9A CN109337891B (en) | 2018-12-07 | 2018-12-07 | Phenylalanine aminomutase mutant with improved thermal stability |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109337891A CN109337891A (en) | 2019-02-15 |
| CN109337891B true CN109337891B (en) | 2020-11-06 |
Family
ID=65297586
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811493273.9A Active CN109337891B (en) | 2018-12-07 | 2018-12-07 | Phenylalanine aminomutase mutant with improved thermal stability |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109337891B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1871357A (en) * | 2002-02-08 | 2006-11-29 | 布里斯托尔-迈尔斯斯奎布公司 | Compositions and methods for altering biosynthesis of taxanes and taxane-related compounds |
| CN106497905A (en) * | 2016-12-14 | 2017-03-15 | 江南大学 | The mutant of the PD in one plant of anabena source |
| CN106636048A (en) * | 2016-12-14 | 2017-05-10 | 江南大学 | Phenylalanine deaminase mutant with improved enzyme activity |
| CN108004225A (en) * | 2017-12-19 | 2018-05-08 | 江南大学 | A kind of mutant of the Phenylalanine aminomutase in pantoea agglomerans source |
-
2018
- 2018-12-07 CN CN201811493273.9A patent/CN109337891B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1871357A (en) * | 2002-02-08 | 2006-11-29 | 布里斯托尔-迈尔斯斯奎布公司 | Compositions and methods for altering biosynthesis of taxanes and taxane-related compounds |
| CN106497905A (en) * | 2016-12-14 | 2017-03-15 | 江南大学 | The mutant of the PD in one plant of anabena source |
| CN106636048A (en) * | 2016-12-14 | 2017-05-10 | 江南大学 | Phenylalanine deaminase mutant with improved enzyme activity |
| CN108004225A (en) * | 2017-12-19 | 2018-05-08 | 江南大学 | A kind of mutant of the Phenylalanine aminomutase in pantoea agglomerans source |
Non-Patent Citations (3)
| Title |
|---|
| Enzymatic Synthesis of Enantiopure a- and b-Amino Acids by Phenylalanine Aminomutase-Catalysed Amination of Cinnamic Acid Derivatives;Bian Wu 等;《ChemBioChem》;20090115;第338-344页 * |
| 产β-苯丙氨酸变位酶基因工程菌的构建及其发酵条件优化;葛飞 等;《食品与机械》;20170128;第33卷(第1期);第16-21页 * |
| 成团泛菌苯丙氨酸氨基变位酶的热稳定性改造;刘辉 等;《食品与发酵工业》;20190409;第45卷(第13期);第59-64页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109337891A (en) | 2019-02-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109593750B (en) | Nitrile hydratase mutant, genetic engineering bacterium containing same and application thereof | |
| CN108559735B (en) | Construction and application of leucine dehydrogenase mutant | |
| CN109609474B (en) | Amino acid dehydrogenase mutant and application thereof in synthesis of L-glufosinate-ammonium | |
| CN109055327B (en) | Aldehyde ketone reductase mutant and application thereof | |
| CN110938616B (en) | Mutant of nitrile hydratase derived from hot spring thermokalite bacillus | |
| CN108048438B (en) | Halohydrin dehalogenase mutant and application thereof | |
| US20210388336A1 (en) | Mutant of Nitrile Hydratase Derived from Caldalkalibacillus thermarum | |
| CN112877307B (en) | Amino acid dehydrogenase mutant and application thereof | |
| CN109468291B (en) | Carbonyl reductase EbSDR8 mutant and construction method and application thereof | |
| CN109777788B (en) | Leucine dehydrogenase mutant and application thereof | |
| CN113337495B (en) | Method for improving sialic acid yield and application | |
| WO2020147031A1 (en) | Nitrile hydratase mutant, genetically engineered bacterium containing same, and use thereof | |
| CN110862980A (en) | D-psicose3-epimerase mutant and application thereof | |
| CN108004225B (en) | Mutant of phenylalanine aminomutase from Pantoea agglomerans | |
| CN112322606B (en) | Nitrile hydratase mutant and application thereof | |
| CN111454918B (en) | Enol reductase mutant and application thereof in preparation of (R) -citronellal | |
| CN110819601B (en) | Reductive amination enzyme, coding gene, recombinant vector, recombinant cell and application thereof | |
| CN110423740B (en) | Halohydrin dehalogenase mutant for improving enantioselectivity and application thereof | |
| CN112908417A (en) | Gene mining method combining functional sequence and structure simulation, NADH (nicotinamide adenine dinucleotide) preference type glufosinate dehydrogenase mutant and application | |
| CN110592035B (en) | Carbonyl reductase mutant, recombinant expression vector and application of carbonyl reductase mutant in production of chiral alcohol | |
| CN109593739B (en) | Recombinant ketoacid reductase mutant, gene, engineering bacterium and application thereof | |
| CN108034646B (en) | PvEH3 mutant with improved catalytic activity and improved enantiotropic normalization | |
| CN109337891B (en) | Phenylalanine aminomutase mutant with improved thermal stability | |
| CN109370997B (en) | Phenylalanine aminomutase mutant | |
| CN112831532B (en) | Method for enzymatic synthesis of D-leucine |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |