CN109321682A - A kind of primer pair, primer and probe composition, reagent and kit based on BTNAA system detection canine parvovirus - Google Patents
A kind of primer pair, primer and probe composition, reagent and kit based on BTNAA system detection canine parvovirus Download PDFInfo
- Publication number
- CN109321682A CN109321682A CN201811487273.8A CN201811487273A CN109321682A CN 109321682 A CN109321682 A CN 109321682A CN 201811487273 A CN201811487273 A CN 201811487273A CN 109321682 A CN109321682 A CN 109321682A
- Authority
- CN
- China
- Prior art keywords
- primer
- canine parvovirus
- btnaa
- system detection
- reagent
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of primer pair, primer and probe composition, reagent and kits based on BTNAA system detection canine parvovirus；The primer pair includes upstream primer and downstream primer；The sequence of the upstream primer and the downstream primer is specific as follows: upstream primer: TTCTGGGGGTGTGGGGATTTCTACGGGTACTTTC respectively as shown in SEQ ID NO.1 and SEQ ID NO.2；Downstream primer: CTAACTAAATGCAACTCACTCATAGTATTAAC.The advantages of present invention has in the fluorescence detection equipment for having function of temperature control, and (37 DEG C) carry out quick, real-time, sensitive, accurate, convenient and fast detection to canine parvovirus under body temperature.The present invention is more convenient, quick compared to normal PCR method, can also accomplish to carry out canine parvovirus detection convenient, quickly and precisely in the outlying district of the pet shop of not laboratory condition, small-sized pet clinic and scarcity of resources.
Description
Technical field
The present invention relates to technical field of molecular biology, and in particular to one kind detects canine parvovirus based on BTNAA system
Primer pair, primer and probe composition, reagent and kit.
Background technique
Canine parvovirus (Canine Parvovirus, CPV) belongs to Parvoviridae, and parvovirus belongs to one of member, tool
The representative configuration and structure that detailed small virus belongs to.CPV structure be etc. axisymmetric, the icosahedron of approximate sphericity, diameter be about
18nm~26nm, appearance is round or hexagon, without cyst membrane.CPV is in 1977 at first by the U.S. Liang Wei researcher
Eugster and Nairn separates (Appel M J et al., 1979) from the dog for suffering from diarrhea and hemorrhagic enteritis.At this
In several later years, the states such as Australia, Canada, France, Italy, South Africa, Japan report the virus successively, in the world by this
Viral nomenclature is canine parvovirus (CPV), is to endanger one of most important deadly infectious disease of canine.
CPV old complaint generally can be divided into two kinds of types according to clinical symptoms, and one kind is myocarditis type, and another kind is hemorrhagic enteritis
Type.The former is more common in weanling puppy, and sudden onset is simultaneously dead quickly, before the onset often without sign.Occurs essence under normal circumstances
Mind is depressed, loss of appetite, slight vomiting, visual mucosal pallor, expiratory dyspnea, heartbeat is weak and has heart murmur, pathogenic process
It is very short, it is just dead to have little time treatment.Enteritis type is mainly in the dog at 6 to 12 monthly ages, mostly based on 2~6 monthly age puppies, incubation period
Up to 7~15d or so, any symptom is not showed in incubation period；The course of disease is generally up to 3~7d.Sick dog is mainly heavy with low fever, spirit
Strongly fragrant, appetite abolish, vomiting is violent, is dehydrated, based on diarrhea.Vomiting number is different with disease, and the later period only spits negative actuation,
And empty vomitus.Excrement situation initial stage is yellow, canescence g., jelly-like mucus, disease to later period, excrement presentation color of soy sauce
Or tomato sample bloody stool, in spurting and with the stench made us unbearably when defecation；Sick dog body fast dewatering is thin at this time, until
It dies of exhaustion.The disease can all occur throughout the year, and with urgency of falling ill, the course of disease is short, and infectiousness is strong, and the death rate is high, often in explosive stream
Row.All ages and classes, gender, kind dog can infect, the non-survival rate < 5% through treating is to endanger China's dog industry the most
One of serious infectious disease.
People detect canine parvovirus (CPV) by a variety of methods, such as Serology test, Protocols in Molecular Biology,
Restriction endeunclease analysis etc., wherein Protocols in Molecular Biology have many advantages, such as high specificity, high sensitivity increasingly by
People pay attention to.However, these technologies make it be concentrated mainly on reality the dependence of precision equipment height, especially fluorescence quantitative PCR instrument
Indoor use is tested, the quick detection for helping medical worker really to realize canine parvovirus (CPV) at the scene is failed.Further, since
The high-accuracy property of fluorescence quantitative PCR instrument, so that entire experimental setup process is relative complex, therefore not only experimental implementation, Er Qiejie
The technical staff that the interpretation of fruit also requires to have received professional training could complete.These disadvantages more allow quantitative fluorescent PCR to be difficult to
Testing laboratory of base or unit are promoted, thus the outlying district of scarcity of resources is then more not convenient to use.
Therefore, existing canine parvovirus detection means is urgently improved.
Summary of the invention
The technical problem to be solved by the present invention is to overcome the technological deficiency of background technique, provide a kind of based on BTNAA body
Primer pair, primer and probe composition, reagent and the kit of system's detection canine parvovirus.The present invention is directed to existing canine parvovirus
The defect and the market demand of poison detection develop a kind of primer pair, primer and spy based on BTNAA system detection canine parvovirus
Injection composition, reagent and kit.The present invention passes through BTNAA (Body Temperature Nucleic Acid
Amplification, body temperature nucleic acid amplification) isothermal quickly detects canine parvovirus；The present invention usually exists under room temperature constant temperature
The amplified fragments that can be detected with agarose gel electrophoresis can be obtained in 30min.The present invention is more just compared to normal PCR method
It is prompt, quick, it can also accomplish to dog in the outlying district of the pet shop of not laboratory condition, small-sized pet clinic and scarcity of resources
Detection convenient, quickly and precisely that parvovirus carries out.
It is as follows that the present invention solves technical solution used by above-mentioned technical problem:
A kind of primer pair based on BTNAA system detection canine parvovirus, the primer pair includes upstream primer and downstream
Primer；The sequence of the upstream primer and the downstream primer is respectively as shown in SEQ ID NO.1 and SEQ ID NO.2, specifically
It is as follows:
Upstream primer: TTCTGGGGGTGTGGGGATTTCTACGGGTACTTTC；
Downstream primer: CTAACTAAATGCAACTCACTCATAGTATTAAC.
A kind of primer and probe composition based on BTNAA system detection canine parvovirus, the primer and probe combination
Object includes primer and probe；The primer includes upstream primer and downstream primer；The upstream primer, the downstream primer and institute
The sequence of probe is stated respectively as shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3, specific as follows:
Upstream primer: TTCTGGGGGTGTGGGGATTTCTACGGGTACTTTC；
Downstream primer: CTAACTAAATGCAACTCACTCATAGTATTAAC；
Probe:
TTAGATGATACTCATGTACAAATTGTAACACCT(F)(H)G(B) CATTGGTTGATGCAA-SpacerC3；
Wherein, F is fluorophor, and H is tetrahydrofuran site, and B is quencher, and 3 ' ends are SpacerC3 modification.
Specific primer of the invention is the oligonucleotides for the design of canine parvovirus VP2 protein gene.By two few nucleosides
Acid partners primer, respectively the upstream and downstream nucleotide sequence of one target set nucleic acid object of specific recognition；Length is in 30 nucleotide
(nt) left and right, series arrangement randomness are high；C/G content 30%~70%；100~400bp of amplified production；5 ' end 3~
5bp, few G, more C/T；3 ' end C/G endings；Without considering Tm value；Best primer pair need to be filtered out by assay optimization, it is desirable that be
Its amplified production is single band, no non-specific amplification and apparent primer dimer.
Specificity fluorescent probe of the invention is the oligonucleotides long-chain for the design of canine parvovirus VP2 protein gene.The spy
Anisotropic fluorescent probe specific recognition primer amplified of the invention comes out part canine parvovirus VP2 protein gene order
A certain region, not Chong Die with specific primer recognition site, length is 50nt or so, C/G content 30%~70%；5 ' end 3~
5bp, few G；There are four decorating sites altogether, first find two T (thymidine) of 2~3 bases in interval, wherein close to 5 ' ends
T will have 28~32nt away from 5 ' ends, and the T close to 3 ' ends will have 15~18nt away from 3 ' ends.By its in 2~3 bases at this interval
In one replaced with tetrahydrofuran (THF), recognition site as exonuclease；The T at 5 ' ends is replaced with FAM (fluorophor)
It changes, the T at 3 ' ends is replaced with BHQ (quenching group)；3 ' the modification groups of end mark one, such as amido, phosphate group, biology
Element, biotin-TEG or C3-spacer, for inhibiting polymerase to extend since the site.
A kind of reagent based on BTNAA system detection canine parvovirus, includes above-mentioned primer pair and primer and probe group
Close object.
Preferably, the reagent further includes reaction solution, and the reaction solution includes polyethylene glycol (PEG), Tris, potassium acetate
(KAc), atriphos (ATP), disodium creatine phosphate (Creatinephosphatedisodiumsalt, PCr), deoxidation
Ribonucleotide triphosphate (dNTP), sucrose, glycerol, recombinase, single-stranded DNA binding protein, archaeal dna polymerase, auxilin and core
Sour excision enzyme.
It is saved after above-mentioned reaction solution is freeze-dried, isothermal is re-dissolved in distilled water use when quickly detecting canine parvovirus.
The lyophilisation condition are as follows: pre-freeze 3~4 hours under the conditions of -80 DEG C are put into vacuum freeze drier after pre-freeze
In be dried, 2~10 hours dry prior to -20~-45 DEG C, last 10~18 DEG C of drying 1~2 hour, two stages did
The dry time depends on the quantity of freeze-drying sample.Reaction solution after freeze-drying becomes dry powder-shaped, to reduce enzyme during long-distance transport
The probability that activity reduces.
5 kinds of engineering enzymes in reaction solution of the present invention: recombinase, single-stranded DNA binding protein, archaeal dna polymerase, auxilin
And exonuclease, it is a series of genetic engineering enzymes for having specific function.Above-mentioned 5 kinds of genetic engineering enzymes all derive from nature
In common bacteria, have required specific function, by genetic engineering transformation, recombination to construct, fermentation expression, broken purifying and
After a series of processes such as Activity determination, become can the high-purity of industrialized production, high activity zymoprotein.
Preferably, the recombinase derives from bacteriophage or bacterium.
It is highly preferred that the recombinase is selected from T4 bacteriophage recombinase uvsX or Escherichia coli (E.coli) recombinase
RecA。
Most preferably, the recombinase is Escherichia coli (E.coli) recombinase RecA.
Preferably, the single-stranded DNA binding protein is selected from the gp32 of T4 or E.coli.
It is highly preferred that the single-stranded DNA binding protein is the gp32 of E.coli.
Preferably, the archaeal dna polymerase is selected from Phi-29 polymerase, Bacillus subtillis PolI (Bsu), Bst polymerase
Or any one in the DNA polymerase i Klenow large fragment of E.coli.
It is highly preferred that the archaeal dna polymerase is the DNA polymerase i Klenow large fragment of E.coli.
Preferably, the auxilin is T4 bacteriophage uvsY albumen.
Preferably, the exonuclease is selected from the exonuclease exoIII or exoIV of E.coli.
It is highly preferred that the exonuclease is the exonuclease exoIII of E.coli.
Preferably, the concentration of 5 kinds of engineering enzymes is respectively as follows: recombinase 220~280ng/ μ l in above-mentioned reaction solution；Single stranded DNA
Binding protein 200~250ng/ μ l；Archaeal dna polymerase 100~150ng/ μ l；Auxilin 70~100ng/ μ l；Exonuclease
80~120ng/ μ l.
It is highly preferred that the concentration of 5 kinds of engineering enzymes is respectively as follows: 220 ng/ μ l of recombinase in above-mentioned reaction solution；Single stranded DNA knot
Hop protein 200ng/ μ l；Archaeal dna polymerase 100ng/ μ l；Auxilin 70ng/ μ l；Exonuclease 80ng/ μ l.
Other components in reaction solution, for react the co-factor of enzyme, salt ionic concentration, pH value, reaction are provided needed for energy
Amount expands required raw material, provides protective agent in frozen dried process and memory phase.
Preferably, each component concentration in reaction solution are as follows: polyethylene glycol (PEG) 2~4%；20~40mM of Tris；Potassium acetate
(KAc) 100~140mM；Acid phosphoric acid adenosine (ATP) 2~4mM；Disodium creatine phosphate (Creatinephosphatedisodiu
Msalt, PCr) 40~60mM；250~300 μM of deoxyribonucleoside triphosphate (dNTP)；Sucrose 5~8%；Glycerol 20~
40%.
It is highly preferred that each component concentration in reaction solution are as follows: polyethylene glycol (PEG) 3%；Tris 30 mM；Potassium acetate (KAc)
120mM；Acid phosphoric acid adenosine (ATP) 3mM；Disodium creatine phosphate (Creatinephosphatedisodiumsalt, PCr)
50mM；275 μM of deoxyribonucleoside triphosphate (dNTP)；Sucrose 6%；Glycerol 30%.
A kind of kit based on BTNAA system detection canine parvovirus, the kit include mentioned reagent.
Basic principle of the invention:
BTNAA (Body Temperature Nucleic Acid Amplification, body temperature nucleic acid amplification) of the present invention
It is a kind of system simulating the self-replacation of bacterium nucleic acid intracellular and being developed；The system opens nucleic acid substances by a variety of enzymes
Higher structure, thus realize rapid amplifying is carried out under room temperature isothermy.Under room temperature constant temperature, recombinase and primer are formed
Albumen/single-stranded nucleotide complex Rec/ssDNA, with the help of auxilin and single strand binding protein SSB, intrusion is double
Chain DNA template；The region D-loop is formed in intrusion site, and starts to be scanned DNA double chain；Wait find and Primers complementary
Behind destination region, while complex Rec/ssDNA disintegrates, polymerase is also coupled to 3 ' ends of primer, starts prolonging for chain
It stretches, forms new DNA complementary strand.Simultaneously after double-stranded DNA is opened, specificity fluorescent probe base complementary pairing is incorporated in
On the fundamental chain in the downstream in primer binding zone domain, therefore fluorescence probe is embedded in newly-generated subchain；In newly-generated DNA double chain
In, due to the insertion of fluorescence probe, there is the not base with fundamental chain pairing, Exonucleolytic in the tetrahydrofuran site of fluorescence probe
Enzyme can identify these unpaired bases, separate the fluorophor in the region and quencher after carrying out digestion, make fluorescence
The fluorescence signal of group is released, and one DNA double chain of every opening can discharge a fluorophor, fluorescence signal intensity with
The DNA double chain of synthesis is positively correlated, and is visualized by fluorescence detection equipment.
Compared with prior art, the beneficial effects of the present invention are:
(1) reaction kit is more portable: compared with main several nucleic acid amplification technologies, BTNAA system of the present invention
Amplification procedure is not necessarily to alternating temperature, reaction kit is done more small more convenient, is suitable for more non-lab environments；
(2) reaction speed is faster: relative to quantitative fluorescent PCR, the BTNAA system amplified reaction time of the present invention by
It foreshortens within 1.5~2 hours 15~25 minutes, hence it is evident that improve amplification efficiency；
(3) being capable of real-time monitoring: by exo probe, one DNA double chain of every opening can discharge a fluorescent base in reaction
The DNA double chain of group, fluorescence signal intensity and synthesis is positively correlated, and is visualized by fluorescence detection equipment, to realize real-time monitoring
Effect；
(4) can qualitative and quantitative detection: by observe fluorescence curve whether play whether have purpose core in peak judgement sample
Acid；It may determine that the concentration of purpose nucleic acid in sample by the time that fluorescence curve plays peak；
(5) specificity is high: each pair of primer and fluorescence probe can only be specifically bound with target nucleic acid object, therefore be detected
Accurate specificity is high；
(6) easy to operate: reaction solution of the present invention freeze-drying saves, only need to be by ddH as defined in being added in dry powder when use2O、
PEG, MgAc and sample to be tested nucleic acid, can start amplified reaction after mixing, be suitable for the popularization of testing agency of base；
(7) result detection method multiplicity: the present invention can both be detected by agarose gel electrophoresis, can also be passed through
Fluorescent instrument is detected.
Detailed description of the invention
Fig. 1 is that (M Marker, 1 is primer CPV-1, and 2 be primer for the electrophoretogram of primer pair amplifies influential effect of the present invention
CPV-2,3 be primer CPV-3, and N is negative control).
Fig. 2 is that (M Marker, 1~3 primer are CPV-2 to amplified reaction sensitivity electrophoretogram of the present invention；1 concentration is
100fg/ μ l, 2 concentration are 10fg/ μ l, and 3 concentration are that 1fg/ μ l, N are negative control, and concentration of the invention refers to template concentrations, is root
According to the concentration of the plasmid template of canine parvovirus VP2 protein Gene Partial sequent synthesis).
Fig. 3 is fluorescence probe structure chart of the present invention.
Fig. 4 is amplified reaction sensitivity fluorescence figure of the present invention.
Fig. 5 is reaction principle figure of the present invention.
Fig. 6 is the fluorogram of actual sample of the present invention detection.
Specific embodiment
In order to better understand the content of the present invention, it is described further combined with specific embodiments below with attached drawing.Ying Li
Solution, these embodiments are only used for that the present invention is further described, rather than limit the scope of the invention.In addition, it should also be understood that,
After having read content of the present invention, person skilled in art makes some nonessential changes or adjustment to the present invention,
Still fall within protection scope of the present invention.
One, the screening of primer
With reference to the canine parvovirus VP2 protein gene order announced on GenBank, present inventor is to canine parvovirus
The information such as genome, protein structure and the function of VP2 have carried out more in-depth study, and the VP2 base in canine parvovirus
The specificity of cause is high, more conservative, therefore the present invention selects in canine parvovirus VP2 gene gene as a purpose.Many experiments
The effect and sensitivity tool for showing different primer pair constant-temperature amplifications have a certain impact.Therefore, this research is directed to canine parvovirus
Three pairs of different primers of malicious VP2 gene Preliminary design: CPV-1, CPV-2 and CPV-3 (as shown in table 1), these sequences can be with
It is specifically bound with the corresponding sequence of canine parvovirus VP2 protein gene.
The sequence and corresponding target fragment size of the primer of the present invention of table 1
Fig. 1 is the electrophorogram of primer pair amplifies influential effect of the present invention.As can be seen that different primer pairs from Fig. 1
Expanding effect be it is influential, band brightness is markedly less than CPV- when carrying out DNA cloning experiment using primer CPV-1 and CPV-3
2, negative control N illustrate that system is pollution-free without band.Therefore, primer CPV-1 and CPV-3 is undesirable, is also unfavorable for into one
The fluorescence detection of step.
For the sensitivity for further probing into primer CPV-2.The sensitivity examination of template gradient dilution is carried out for primer CPV-2
It tests.The electrophorogram of DNA cloning sensitivity experiment is as shown in Figure 2.It can be seen that the limiting snesibility of CPV-2 is from Fig. 2
1fg/μl.Template concentrations are the concentration according to the plasmid template of the partial sequence of canine parvovirus VP2 protein gene synthesis.
According to above-mentioned experimental result, the primer for selecting primer CPV-2 to test as fluorescence detection.
Two, fluorescence detection
In order to shorten detection time further, operating procedure is reduced, therefore, this research is devised for primer CPV-2
Specific probe, probe schematic diagram are as shown in Figure 3: probe sequence CPV-probe1 (as shown in table 2), these probes can be with
The amplified production corresponding sequence of primer CPV-2 is specifically bound, and issues fluorescence signal through digestion.
The sequence of the probe of the present invention of table 2
Note: * F is fluorophor (Fluorophore), and H is tetrahydrofuran site (THF residue), and B is quencher
(Quencher), 3 ' ends are SpacerC3 modification.
Fig. 4 is amplified reaction sensitivity fluorescence figure of the present invention.From fig. 4, it can be seen that primer CPV-2 and probe CPV-
The limit detectable concentration of probe 1 is 1fg/ μ l.
Three, the method that specific detection is carried out to canine parvovirus
By polyethylene glycol (PEG), Tris, potassium acetate (KAc), atriphos (ATP), disodium creatine phosphate
(Creatinephosphatedisodiumsalt, PCr), deoxyribonucleoside triphosphate (dNTP), sucrose, glycerol, recombination
The reaction solution that enzyme, single-stranded DNA binding protein, archaeal dna polymerase, auxilin and exonuclease form is freeze-dried.
Lyophilisation condition are as follows: pre-freeze 3~4 hours under the conditions of -80 DEG C, be put into after pre-freeze in vacuum freeze drier into
Row drying, it is 2~10 hours, last 10~18 DEG C of dryings 1~2 hour dry prior to -20~-45 DEG C.Freeze-dried powder is obtained, for use.
Freeze-dried powder each component concentration is as shown in table 3.
The freeze-dried powder reaction member component of the present invention of table 3
The present invention detects specific steps are as follows:
(1) by above-mentioned freeze-dried powder, ddH is added2O28.4 μ l, 12.5 μ l of polyethylene glycol (PEG), 2.5 μ l of magnesium acetate, sample 2
Each 2 μ l of μ l, upstream and downstream primer, 0.6 μ l of probe；
(2) reagent in step (1) is mixed, centrifugation；
(3) mixture mixed after being centrifuged is put into the fluorescent instrument with function of temperature control, set temperature is 37 DEG C；Every 20
Second detects first order fluorescence signal strength, altogether detection 60 times, totally 20 min；
It (4) after the reaction was completed, whether is positive according to fluorescence intensity curves judgement sample.
Testing principle of the invention is as shown in figure 5, BTNAA of the present invention (Body Temperature Nucleic Acid
Amplification, body temperature nucleic acid amplification) it is a kind of system simulating the self-replacation of bacterium nucleic acid intracellular and being developed；Institute
The higher structure that system opens nucleic acid substances by a variety of enzymes is stated, carries out rapid amplifying under room temperature isothermy to realize.
Under room temperature constant temperature, recombinase and primer form albumen/single-stranded nucleotide complex Rec/ssDNA, in auxilin and list
With the help of chain binding protein SSB, double-stranded DNA template is invaded；The region D-loop is formed in intrusion site, and is started to DNA double
Chain is scanned；After finding the destination region with Primers complementary, while complex Rec/ssDNA disintegrates, polymerase is also tied
3 ' the ends for closing primer, start the extension of chain, form new DNA complementary strand.Simultaneously after double-stranded DNA is opened, specifically
Property the fluorescence probe base pair complementarity downstream that is incorporated in primer binding zone domain fundamental chain on, therefore fluorescence probe insertion is newly-generated
Subchain in；In newly-generated DNA double chain, due to the insertion of fluorescence probe, occur in the tetrahydrofuran site of fluorescence probe
Not with the base of fundamental chain pairing, exonuclease can identify these unpaired bases, by the glimmering of the region after progress digestion
Light group and quencher separation, are released the fluorescence signal of fluorophor, one DNA double chain of every opening can discharge one
The DNA double chain of a fluorophor, fluorescence signal intensity and synthesis is positively correlated, and is visualized by fluorescence detection equipment.
Four, actual sample detects
For verify primer of the present invention, probe, reagent in practical situations can normal use, then simulate practical feelings
Condition detects actual sample using primer of the invention, probe, reagent.Actual sample information is as shown in table 4.
The actual sample information of the present invention of table 4
Using Tiangeng blood/cell/tissue genome DNA extracting reagent kit, according to illustrating step to the practical sample in table 4
This extracts its genomic DNA.Then the DNA of extraction is detected using primer of the invention, probe, reagent.Fig. 6 is to use
Primer of the invention, probe, reagent carry out testing result to actual sample.From fig. 6 it can be seen that primer of the invention, spy
Needle, reagent detect actual sample and can be used, and are as a result positive, consistent with known results.
The present invention has in the fluorescence detection equipment for having function of temperature control, and (37 DEG C) are tiny to dog under body temperature
Virus carries out the advantages of quick, real-time, sensitive, accurate, convenient and fast detection.
Above description is not limitation of the present invention, and the present invention is also not limited to the example above.The art it is common
Within the essential scope of the present invention, the variations, modifications, additions or substitutions made also should belong to protection of the invention to technical staff
Range.
Sequence table
<110>Ningbo Jiang Shen Biotechnology Co., Ltd
<120>a kind of primer pair, primer and probe composition, reagent and reagent based on BTNAA system detection canine parvovirus
Box
<130> 2018.10.24
<160> 7
<170> SIPOSequenceListing 1.0
<210> 1
<211> 34
<212> DNA
<213>artificial synthesized (Unknown)
<400> 1
ttctgggggt gtggggattt ctacgggtac tttc 34
<210> 2
<211> 32
<212> DNA
<213>artificial synthesized (Unknown)
<400> 2
ctaactaaat gcaactcact catagtatta ac 32
<210> 3
<211> 49
<212> DNA
<213>artificial synthesized (Unknown)
<400> 3
ttagatgata ctcatgtaca aattgtaaca cctgcattgg ttgatgcaa 49
<210> 4
<211> 30
<212> DNA
<213>artificial synthesized (Unknown)
<400> 4
tcacagcaaa ctcaagcaga cttgtacatt 30
<210> 5
<211> 30
<212> DNA
<213>artificial synthesized (Unknown)
<400> 5
ctttagttgg tggytgagta gcagattctg 30
<210> 6
<211> 30
<212> DNA
<213>artificial synthesized (Unknown)
<400> 6
atctgggaac gggtctggag gcgggggtgg 30
<210> 7
<211> 33
<212> DNA
<213>artificial synthesized (Unknown)
<400> 7
catagtatta acaattagtt gccaatctcc tgg 33
Claims (10)
1. a kind of primer pair based on BTNAA system detection canine parvovirus, which is characterized in that the primer pair includes that upstream is drawn
Object and downstream primer；The sequence of the upstream primer and the downstream primer is respectively such as SEQ ID NO.1 and SEQ ID NO.2 institute
Show, specific as follows:
Upstream primer: TTCTGGGGGTGTGGGGATTTCTACGGGTACTTTC；
Downstream primer: CTAACTAAATGCAACTCACTCATAGTATTAAC.
2. it is a kind of based on BTNAA system detection canine parvovirus primer and probe composition, which is characterized in that the primer and
Probe compositions include primer and probe；The primer includes upstream primer and downstream primer；The upstream primer, the downstream
The sequence of primer and the probe is specific as follows respectively as shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3:
Upstream primer: TTCTGGGGGTGTGGGGATTTCTACGGGTACTTTC；
Downstream primer: CTAACTAAATGCAACTCACTCATAGTATTAAC；
Probe:
TTAGATGATACTCATGTACAAATTGTAACACCT(F)(H)G(B)CATTGGTTGATGCAA-SpacerC3；
Wherein, F is fluorophor, and H is tetrahydrofuran site, and B is quencher, and 3 ' ends are SpacerC3 modification.
3. a kind of reagent based on BTNAA system detection canine parvovirus, which is characterized in that the reagent includes such as claim
Described in 1 it is a kind of based on BTNAA system detection canine parvovirus primer pair or include as claimed in claim 2 a kind of base
In the primer and probe composition of BTNAA system detection canine parvovirus.
4. a kind of reagent based on BTNAA system detection canine parvovirus as claimed in claim 3, which is characterized in that described
Reagent includes reaction solution；The reaction solution include polyethylene glycol, Tris, potassium acetate, atriphos, disodium creatine phosphate,
Deoxyribonucleoside triphosphate, sucrose, glycerol, recombinase, single-stranded DNA binding protein, archaeal dna polymerase, auxilin and nucleic acid
Excision enzyme.
5. a kind of reagent based on BTNAA system detection canine parvovirus as claimed in claim 4, which is characterized in that described
It is saved after reaction solution is freeze-dried, distilled water is re-dissolved in when to be detected and is mixed with the primer and the probe；The lyophilisation condition
Are as follows: pre-freeze 3~4 hours under the conditions of -80 DEG C are put into vacuum freeze drier after pre-freeze and are dried, prior to -20
~-45 DEG C drying 2~10 hours, last 10~18 DEG C of dryings 1~2 hour.
6. a kind of reagent based on BTNAA system detection canine parvovirus as claimed in claim 4, which is characterized in that described
Recombinase is selected from T4 bacteriophage recombinase uvsX or Escherichia coli (E.coli) recombinase RecA；The single-stranded DNA binding protein
Gp32 selected from T4 or E.coli；The archaeal dna polymerase is selected from Phi-29 polymerase, Bacillus subtillis PolI (Bsu), Bst
Polymerase, E.coli DNA polymerase i Klenow large fragment in any one；The auxilin is T4 bacteriophage uvsY
Albumen；The exonuclease is selected from the exonuclease exoIII or exoIV of E.coli.
7. a kind of reagent based on BTNAA system detection canine parvovirus as claimed in claim 6, which is characterized in that described
Recombinase is Escherichia coli (E.coli) recombinase RecA；The single-stranded DNA binding protein is the gp32 of E.coli；The DNA
Polymerase is the DNA polymerase i Klenow large fragment of E.coli；The exonuclease is the exonuclease of E.coli
exoIII。
8. a kind of reagent based on BTNAA system detection canine parvovirus as claimed in claim 4, which is characterized in that described
The concentration of each component in reaction solution are as follows: 220~280ng/ of recombinase μ l；200~the 250ng/ of single-stranded DNA binding protein
μl；100~150ng/ of archaeal dna polymerase μ l；70~100ng/ of auxilin μ l；The exonuclease 80~
120ng/μl；The polyethylene glycol 2~4%；20~the 40mM of Tris；100~the 140mM of potassium acetate；The triphosphoric acid
2~4mM of adenosine；40~the 60mM of disodium creatine phosphate；250~300 μM of the deoxyribonucleoside triphosphate；The sugarcane
Sugar 5~8%；The glycerol 20~40%.
9. a kind of reagent based on BTNAA system detection canine parvovirus as claimed in claim 8, which is characterized in that described
The concentration of each component in reaction solution are as follows: the recombinase 220ng/ μ l；The single-stranded DNA binding protein 200ng/ μ l；The DNA
Polymerase 100ng/ μ l；The auxilin 70ng/ μ l；The exonuclease 80ng/ μ l；The polyethylene glycol 3%；It is described
Tris 30mM；The potassium acetate 120mM；The atriphos 3mM；The disodium creatine phosphate 50mM；The deoxidation core
275 μM of riboside triphosphoric acid；The sucrose 6%；The glycerol 30%.
10. a kind of kit based on BTNAA system detection canine parvovirus, which is characterized in that including as claimed in claim 3
It is a kind of based on BTNAA system detection canine parvovirus reagent.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811487273.8A CN109321682A (en) | 2018-12-06 | 2018-12-06 | A kind of primer pair, primer and probe composition, reagent and kit based on BTNAA system detection canine parvovirus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811487273.8A CN109321682A (en) | 2018-12-06 | 2018-12-06 | A kind of primer pair, primer and probe composition, reagent and kit based on BTNAA system detection canine parvovirus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109321682A true CN109321682A (en) | 2019-02-12 |
Family
ID=65256121
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811487273.8A Pending CN109321682A (en) | 2018-12-06 | 2018-12-06 | A kind of primer pair, primer and probe composition, reagent and kit based on BTNAA system detection canine parvovirus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109321682A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110592237A (en) * | 2019-10-11 | 2019-12-20 | 青岛英赛特生物科技有限公司 | Primer, probe, kit and detection method for detecting weight traits of white geese in east Zhejiang province |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105087825A (en) * | 2015-07-01 | 2015-11-25 | 浙江泰晶生物科技有限公司 | Method, reagent, primer and probe for quickly detecting Ebola viruses under constant-temperature and isothermal conditions |
| CN105603123A (en) * | 2016-01-25 | 2016-05-25 | 中国农业科学院兰州兽医研究所 | Real-time fluorescence RPA reagent kit and test strip RPA reagent kit for rapidly detecting porcine parvovirus and application of reagent kits |
| CN105803112A (en) * | 2016-03-28 | 2016-07-27 | 中国人民解放军成都军区疾病预防控制中心 | Primer, probe and kit for detecting canine parvovirus and detection method |
-
2018
- 2018-12-06 CN CN201811487273.8A patent/CN109321682A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105087825A (en) * | 2015-07-01 | 2015-11-25 | 浙江泰晶生物科技有限公司 | Method, reagent, primer and probe for quickly detecting Ebola viruses under constant-temperature and isothermal conditions |
| CN105603123A (en) * | 2016-01-25 | 2016-05-25 | 中国农业科学院兰州兽医研究所 | Real-time fluorescence RPA reagent kit and test strip RPA reagent kit for rapidly detecting porcine parvovirus and application of reagent kits |
| CN105803112A (en) * | 2016-03-28 | 2016-07-27 | 中国人民解放军成都军区疾病预防控制中心 | Primer, probe and kit for detecting canine parvovirus and detection method |
Non-Patent Citations (3)
| Title |
|---|
| JIANCHANG WANG等: "Rapid and sensitive detection of canine parvovirus type 2 by recombinase polymerase amplification", 《ARCH VIROL》 * |
| 姜一曈等: "基于重组酶聚合酶扩增技术的犬细小病毒快速检测方法的建立", 《中国预防兽医学报》 * |
| 郭正洋等: "重组酶聚合酶扩增技术的研究进展", 《食品科技》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110592237A (en) * | 2019-10-11 | 2019-12-20 | 青岛英赛特生物科技有限公司 | Primer, probe, kit and detection method for detecting weight traits of white geese in east Zhejiang province |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111235232B (en) | Visual rapid nucleic acid detection method based on CRISPR-Cas12a system and application | |
| CN105087825B (en) | Room temperature isothermal quickly detects method, reagent and the primer and probe of Ebola virus | |
| CN101903537B (en) | bordetella detection assay | |
| CN111004870A (en) | Novel coronavirus N gene nucleic acid detection kit | |
| CN112226489B (en) | Nucleic acid extraction method based on magnetic bead targeting enrichment target gene and application thereof | |
| CN101680029A (en) | Nucleic acid detection | |
| CN106399590A (en) | General nucleic acid isothermal detection reagent of respiratory tract infection associated adenoviruses | |
| CN109355428A (en) | Room temperature constant temperature quickly detects primer, probe, reagent and the kit of pseudorabies virus | |
| CN106967845A (en) | A kind of kit detected for pig Delta coronavirus and detection method | |
| CN107828913A (en) | Prawn white spot syndrome（WSSV）RAA constant temperature fluorescence detection method and kit | |
| CN111733284A (en) | Primer, probe, reagent and method for quickly detecting feline parvovirus at normal temperature and isothermal temperature | |
| CN106574304A (en) | Strand-invasion based dna amplification method | |
| EP1851325B1 (en) | Method for detecting viable cells in a sample by using a virus | |
| CN109371171A (en) | A kind of primer pair, primer and probe composition, reagent and kit based on BTNAA system detection canine distemper virus | |
| KR101857684B1 (en) | Primers and probe for detection of middle east respiratory syndrome coronavirus and detecting method for middle east respiratory syndrome coronavirus using the same | |
| CN109321682A (en) | A kind of primer pair, primer and probe composition, reagent and kit based on BTNAA system detection canine parvovirus | |
| CN106987657B (en) | Primer combination for identifying bovine virus diarrhea virus and bovine rotavirus and application thereof | |
| RU2005118073A (en) | METHODS AND COMPOSITIONS FOR DETECTION OF TELOMERASIS ACTIVITY | |
| CN106701940A (en) | Method for detecting DNA of schistosoma through fluorescent probe | |
| CN108950080A (en) | A kind of primed probe group and kit based on double fluorescent PCR method joint-detection sindbis alphavirus and getah virus | |
| CN115125313A (en) | Primer pair for detecting pathogenic enterocolitis yersinia and CRISPR/Cas12a detection kit | |
| CN109355427A (en) | Primer, probe, reagent and the kit of pig annulus 2 type virus are quickly detected based on BTNAA system isothermal | |
| CN108130385A (en) | A kind of human cytomegalovirus kit for detecting nucleic acid | |
| CN107988429B (en) | Reagent for detecting rabies virus and application thereof | |
| CN106929608A (en) | A kind of fluorescence PCR method and kit of specific detection rubella virus nucleic acid |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190212 |
|
| RJ01 | Rejection of invention patent application after publication |