CN111733284A - Primer, probe, reagent and method for quickly detecting feline parvovirus at normal temperature and isothermal temperature - Google Patents

Abstract

The invention is applicable to the technical field of feline parvovirus detection, and provides a primer, a probe, a reagent and a method for quickly detecting feline parvovirus at normal temperature and isothermal temperature. The kit can be used for quickly, real-timely and specifically detecting the feline parvovirus, quickly detecting a nucleic acid target object in an instrument with a fluorescence detection function under the combined action of the specific primer, the specific fluorescent probe, 5 engineering enzymes and other chemical components, ensuring closed-tube detection through strict experimental operation steps, effectively preventing aerosol pollution and being suitable for being applied to various fluorescence detection equipment for detection.

Description

Primer, probe, reagent and method for quickly detecting feline parvovirus at normal temperature and isothermal temperature

Technical Field

The invention relates to the technical field of feline parvovirus detection, in particular to a primer, a probe, a reagent and a method for quickly detecting feline parvovirus at normal temperature and isothermal temperature.

Background

Feline parvovirus (Feline panleukopenia virus), also known as Feline panleukopenia virus, is a single-stranded DNA virus of parvovirus of the family parvoviridae, and can cause symptoms such as anorexia, high fever, lethargy, rhinorrhea, dehydration vomiting, severe reduction of leukocytes, hemorrhagic enteritis, and the like in cats. The feline parvovirus does not infect humans, but can survive in the environment for up to one year, so cats are easy to be exposed in the environment with the feline parvovirus to infect, especially, kittens are easy to infect, the infection rate of cats under 1 year can reach 70%, the death rate can reach 50% -60%, and the death rate of kittens under 5 months can reach 80% -90% at most; pregnant queens can cause reproductive failure if infected with the virus, resulting in abortion or kittens with severely damaged cerebellum.

Most of the existing diagnostic methods for feline parvovirus are serological methods and virus separation and identification, the sensitivity is low, and accurate diagnosis on early infection cannot be carried out; the PCR-based diagnostic method is time-consuming, high in technical requirements, expensive in equipment and not popularized.

In view of the above, the prior art is obviously inconvenient and disadvantageous in practical use, and needs to be improved.

Disclosure of Invention

Aiming at the defects, the invention aims to provide the primers, the probe reagent and the method for quickly detecting the feline parvovirus at the normal temperature and the isothermal temperature, which can quickly, real-timely and specifically detect the feline parvovirus and are suitable for being applied to various fluorescence detection devices for detection.

In order to realize the purpose, the invention provides a primer and a probe for quickly detecting feline parvovirus at normal temperature and isothermal temperature, wherein the sequences of the primer and the probe are as follows:

the upstream primer VP 2-F1: CATTGATGGTTGCATTAGATAGTAATAATAC, respectively;

downstream primer VP 2-R2: CACCTGTTCTTAGTAAGTGYACTGGCACAG, respectively;

probe VP 2-Probe:

CAATGGGATAGGACATTAATACCATCTCA(F)A(H)(B)GGAACTAGTGGC-C3 Spacer；

wherein F is a fluorescent group, H is tetrahydrofuran, B is a quenching group, and the 3' end is marked with a C3 spacer.

The specific primer of the invention is an oligonucleotide designed aiming at VP2 gene of Capsid protein (Capsid proteins) of feline parvovirus. Two oligonucleotides form a pair of primers, and the primers respectively and specifically recognize the upstream and downstream nucleotide sequences of a nucleic acid target; the length is between 30 and 35 nucleotides (nt), and the sequence has no palindromic sequence, continuous single-base repeated sequence and internal secondary structure region; the Tm value of the primer is not considered as a main factor in designing; the optimal primer pair needs to be screened out through test optimization, and the amplification product is a single band without non-specific amplification and obvious primer dimer.

With reference to fig. 1, the distance between the fluorophore and the immobilizer is 2-4nt, exo is an exonuclease capable of recognizing the THF site, and the immobilizer is detached from the fluorescent probe and the fluorescent signal emitted by the fluorophore is detected. The specific fluorescent probe is an oligonucleotide long chain designed aiming at the VP2 gene of the feline parvovirus. The oligonucleotide single strand specifically recognizes a certain region of the VP2 gene sequence of the feline parvovirus, does not overlap with a specific primer recognition site, has the length of 46-52nt, and avoids a palindromic sequence, an internal secondary structure and continuous repeated bases in the sequence; the total number of four modification sites is four, and a dSpacer (tetrahydrofuran, THF) is marked at the middle position which is 30-35nt away from the 5' end and is used as a recognition site of exonuclease; marking a fluorescent group at the upstream of the THF site, and marking a quenching group at the downstream, wherein the distance between the two groups is 2-4 nt; the 3' end is marked with a modifying group, such as an amine group, a phosphate group, biotin, or C3-spacer, for inhibiting the extension of polymerase from the site; the Tm of the probe is not a major design consideration; the types of the fluorescent group are many, such as FAM, Cy3, HEX, Texas Red, JOE, VIC, TAMRA, Cy5, etc., and the quenching group can be BHQ1 or BHQ2, so as to reduce the background fluorescence noise to the maximum.

The invention also provides a reagent for rapidly detecting the feline parvovirus at normal temperature and isothermal temperature, which comprises the primer and the probe in claim 1.

The reagent according to the invention further comprises polyethylene glycol, Tris, potassium acetate, dithiothreitol, adenosine monophosphate, creatine phosphate disodium salt, phosphoinositide, deoxyribonucleoside triphosphate, trehalose, mannitol, a recombinase, a single-stranded DNA binding protein, a DNA polymerase, an accessory protein and an exonuclease.

According to the reagent of the invention, the preparation method of the reagent comprises the following steps:

pre-freezing the reaction solution at-80 ℃ for 1-1.5 hours to obtain a pre-freezing reagent;

and (3) drying the pre-frozen reagent for 2-10 hours at-35 to-45 ℃, and then drying for 1-2 hours at 10-18 ℃ to obtain the freeze-dried powder.

The freeze-drying treatment is a process of drying the reaction mixture under the ultralow temperature condition, and aims to facilitate the storage and transportation of the reaction mixture and reduce the probability of reducing the enzyme activity in the long-distance transportation process. The reaction mixture is divided into reaction tubes, pre-frozen for 60-90 minutes at-80 ℃, and then put into a vacuum freeze dryer for drying after pre-freezing, wherein the process comprises two stages of main drying (-35-45 ℃, 2-10 hours) and final drying (10-18 ℃, 1-2 hours), and the drying time of the two stages depends on the number of freeze-dried samples; the freeze-dried finished product needs to be white dry powder and attached to the wall of a reaction tube, and can be completely dissolved without any granular residue after being added with water for heavy suspension.

The reagent according to the invention has the following concentration ranges of the components:

recombinase 520-725 ng/. mu.l; single-stranded DNA binding protein 100-200 ng/. mu.l; DNA polymerase 350-450 ng/. mu.l; exonuclease 300-400 ng/. mu.l.

The 4 engineering enzymes in the reagent are recombinase, single-stranded DNA binding protein, DNA polymerase and auxiliary protein exonuclease respectively, and are a series of genetic engineering enzymes with specific functions. They have the following characteristics: (1) each gene engineering enzyme is derived from common bacteria in the nature, has the required specific function, and becomes high-purity and high-activity enzyme protein capable of being industrially produced after a series of processes such as gene engineering transformation, recombinant construction, fermentation expression, crushing purification, activity detection and the like; (2) each enzyme has different functions in the amplification reaction process, and the enzymes cooperate with each other to realize the rapid amplification of nucleic acid in vitro under the conditions of normal temperature and constant temperature; (3) recombinases derived from bacteriophages or bacteria, such as the escherichia coli (e.coli) recombinase RecA; (4) single-stranded DNA binding protein, gp32 from T4 or e. (5) More sources of DNA polymerase such as Phi-29 polymerase, or Bacillus subtilis PolI (Bsu), Bst polymerase, or E.coli DNA polymerase I Klenow large fragment; (6) helper proteins derived from the T4 phage uvsY protein; (7) exonuclease exoenzyme, exoenzyme exoIII or exoV from e.coli; (8) the optimal concentration ranges of each enzyme protein in the reaction system are respectively as follows: the concentration range of the recombinase is 520 ng/mu l and 725 ng/mu l; the concentration range of the single-stranded DNA binding protein is 100-200 ng/. mu.l; the concentration range of the DNA polymerase is 350-450 ng/. mu.l; the concentration range of exonuclease was 300-400 ng/. mu.l.

The reagent according to the invention has the following concentration ranges of the components:

the other components in the reagent are a mixture of various compounds which maintain the optimal conditions of the enzymatic reaction, and (1) the optimal concentration ranges of the components are respectively as follows: polyethylene glycol (PEG), 2-4%; tris, 20-40 mM; potassium acetate (KAc), 100-; dithiothreitol (DTT), 4-8 mM; adenosine monophosphate (ATP), 2-4 mM; creatine phosphate disodium salt (PCr), 40-60 mM; creatine Kinase (CK) 80-120 ng/mul; deoxyribonucleoside triphosphates (dNTPs), 250-; trehalose (Trehalose), 5-8%; mannitol (Mannitol), 20-40 ng/. mu.l; (2) these components provide the enzyme cofactors for the reaction, the salt ion concentration, the pH value, the energy required for the reaction, the raw materials required for amplification, and the protective agents during the lyophilization process and during the storage phase.

The invention also provides a method for realizing normal-temperature isothermal rapid detection of the feline parvovirus by using the reagent, which comprises the following steps:

adding a sample to be detected, double distilled water and a buffer solution into a reaction tube filled with the reagent;

and placing the mixture in a temperature control device for incubation for 15-25 minutes, and performing visual detection through an instrument with a fluorescence detection function, wherein the reaction tube is kept closed in the detection process.

According to the method of the invention, the temperature control device maintains a constant temperature, and the temperature ranges from 20 ℃ to 42 ℃.

The method for detecting the nucleic acid target object is a method for realizing the rapid detection of the nucleic acid target object in an instrument with a fluorescence detection function under the combined action of a specific primer, a specific fluorescent probe, 5 engineering enzymes and other chemical components under the condition of normal temperature and isothermy, ensures closed-tube detection through strict experimental operation steps, and effectively prevents aerosol pollution; the fluorescent probe is suitable for being applied to various fluorescent detection devices for detection.

The isothermal condition at normal temperature refers to a nucleic acid amplification mode for completing reaction without depending on a high-end precision instrument with precise temperature control. The method of the invention does not need repeated temperature rise and fall in the PCR process, and can realize amplification reaction on simple temperature control equipment, such as a metal bath, a water bath or a thermostat; the reaction temperature can be set between 20 and 42 ℃; since the reaction temperature has a certain correlation with the reaction rate by affecting the catalytic rate of the enzyme, the optimal temperature for the fluorescent reaction is between 37 and 39 ℃ for deoxyribonucleic acid (DNA).

The instrument with the fluorescence detection function is equipment and a platform which can simultaneously detect fluorescence signals of a plurality of nucleic acid targets in real time, is provided with a fluorescence detection channel and a heating module, and can maintain the normal-temperature and isothermal conditions required by the reaction; and the device can also be provided with a touch screen type or PC end controlled operation interface so as to facilitate a series of operations such as setting of experiment parameters, data analysis, real-time observation of reaction process and the like.

The detection method is suitable for being applied to various fluorescence detection devices, and the result of the detection method can be interpreted by different types of fluorescence detection devices. And (3) positive and negative judgment of the sample to be detected: calculating the standard deviation value of the sample according to the mean value of the fluorescence values detected by each sample in the previous 3 minutes, wherein the detection threshold line of the sample is the mean value of the fluorescence values detected by the sample in the previous 3 minutes plus three times of the standard deviation value (unit: fluorescence intensity, mV) of the sample; positive amplification is considered when the slope of the amplification curve is greater than 30 mV/min within the following 1 min after the intersection of the curve with the threshold line; an amplification curve is considered negative if it does not intersect the threshold line within the reaction time.

The invention adopts closed tube detection, after one-time sample adding, the reaction tube is kept closed in the whole detection process, and the false positive interference caused by aerosol can be effectively prevented.

The operation principle of the detection method of the present invention is shown in FIG. 2, which is a reaction mechanism for opening the higher structure of a nucleic acid substance by an enzymatic reaction to perform rapid amplification under a normal temperature and an isothermal condition. The recombinase forms a complex with the primer, and the complex is specifically bound on a DNA chain with the help of the auxiliary protein; opening a template DNA double-chain structure with the aid of single-chain DNA binding protein, binding single-chain tuberculosis protein on the opened single-chain DNA to stabilize the DNA single-chain structure, further facilitating a recombinase-primer complex to search a homologous complementary region on a DNA chain, once a primer on the complex finds a matching region and is bound on the DNA chain through a base complementary pairing principle, enabling the recombinase to fall off from the primer, binding DNA polymerase on the DNA chain of the region, and extending a daughter chain along the 3' end of the primer; because of the strand displacement activity of the DNA polymerase, the newly synthesized daughter strand replaces the position of the homologous parent strand, forming a double-stranded structure with the parent strand; due to the limitation of the upstream and downstream primers, the recombinase-primer compound greatly shortens the time required for scanning a matching region in the initial stage of the next round of amplification, so that a new daughter chain can be synthesized more quickly; when the double-stranded DNA is opened, the specific fluorescent probe base-complementary pair binds to the parent strand downstream of the primer binding region, and thus the fluorescent probe intercalates into the newly generated daughter strand; in a newly generated DNA double strand, due to the embedding of the fluorescent probe, bases which are not paired with the parent strand appear in a THF (tetrahydrofuran) region of the fluorescent probe, exonuclease can recognize the unpaired bases, and after the enzyme digestion, a fluorescent group and an extirpated group in the region are separated, so that a fluorescent signal of the fluorescent group is released, a modifying group at the 3' end is cut out, and the DNA polymerase continues to extend the daughter strand by taking the fluorescent group as a starting point. The newly synthesized double-stranded DNA chain carries fluorescent groups, so that fluorescent signals recorded by the fluorescent detection equipment are in one-to-one correspondence with the number of generated daughter chains, and the fluorescent signals recorded by the new method are also accumulated fluorescence.

The invention has the following technical advantages:

1) and (3) carrying out isothermal reaction at normal temperature: compared with several main nucleic acid amplification technologies, the normal-temperature isothermal reaction greatly reduces the requirements on an instrument heating module and a refrigeration module, so that the selection range of the reaction instrument is wider. In addition, the design of the matched detection instrument can tend to be miniaturized, portable and easy and convenient to operate, and the requirement on detection operation is simpler and more convenient, so that the applicable area and field are wider.

2) The reaction is quick: the normal temperature isothermal nucleic acid amplification technology utilizes various engineering enzymes to simulate nucleic acid amplification reaction in organisms to the maximum extent under a specific solution environment, and greatly shortens the time required by the amplification process. Compared with fluorescent quantitative PCR, the amplification reaction time is shortened from 1.5-2 hours to 10-25 minutes, and the amplification efficiency is obviously improved.

3) Real-time detection: the fluorophores separated from the quenching group and the newly synthesized daughter strands are in one-to-one correspondence in number, and the fluorescent signals accumulate as the amplification reaction advances. Because the detecting instrument collects the fluorescence signal for a certain time interval, the detected fluorescence signal is a changing process along with the change of time, thereby realizing the effect of real-time monitoring.

4) Qualitative and quantitative detection: an amplification curve drawn by the collected fluorescent signal can be used for determination of the detection result. The qualitative detection can be quickly judged according to the linearity of an amplification curve, an S-shaped curve represents a positive sample, and a straight curve represents a negative sample; the semi-quantitative detection can preliminarily judge the concentration of the target nucleic acid in different samples to be detected according to the intersection time of the amplification curve and a threshold line, for example, the amount of the target nucleic acid in the sample with a small time value is higher than that in the sample with a large time value; qualitative detection can be achieved by plotting a standard curve against samples of known concentration.

5) Specificity and sensitivity: each pair of the primer and the fluorescent probe can only be specifically combined with a target nucleic acid object, so the detection is accurate and specific. Experimental data show that the sensitivity of the kit to the feline parvovirus detection is as high as 1 x 102 copies/mul within 25 minutes and reaches a detection level of-0.3 fg/mul.

6) The detection process is simple: the main reaction components are prepared and then are subpackaged into reaction tubes, and are freeze-dried into a dry powder state. The preparation in the early stage of the reaction only needs to add a sample to be detected, double distilled water and a buffer solution, and the amplification reaction can be started after the mixture is uniformly mixed, so that the requirement on experimental skills is low, and ordinary experimenters can complete the operation. The qualitative judgment of the result after the amplification reaction is finished is simpler and easier to understand, and the judgment can be made according to the shape of the graph, so the new method is also suitable for popularization of the basic detection mechanism.

7) The application range is wide: the method has the characteristics of normal temperature, isothermality, rapidness, sensitivity, specificity, simplicity and convenience in operation and the like, and is suitable for various fluorescent detection devices such as fluorescent quantitative PCR, an enzyme labeling instrument, ESEQuant Tube Scanner, Optigene Genie III and the like, and can also be suitable for a future microfluidic molecular detection platform.

Drawings

FIG. 1 is a view showing the structure of a fluorescent probe;

FIG. 2 is a reaction scheme;

FIG. 3 is an electropherogram showing the effect of primers on amplification;

FIG. 4 fluorescence spectra of the amplification sensitivity experiments;

FIG. 5 is a fluorescence spectrum of a specificity experiment for detecting different samples.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is described in further detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

The first embodiment is as follows: screening of primers

The present inventors have conducted intensive studies on the information of the genome, protein structure and function of VP2 of FPV and have found that the content of VP2 gene in FPV is high, referring to the published gene sequence of Feline Parvovirus (FPV) VP2 in GenBank. The present invention selects VP2 gene of FPV as a target gene. A large number of experiments show that different primers have certain influence on the effect and sensitivity of isothermal amplification. Therefore, four different pairs of primers were initially designed for the VP2 gene of FPV in this study: VP-1, VP-2, VP-3, and VP-4 (shown in Table 1), which specifically bind to the corresponding sequences of VP2 gene of FPV.

Table 1: sequences of primers and probes

FIG. 3 is an electropherogram showing the effect of primers on amplification. In the figure, M is Marker, 1 is a negative control group, 2 is a primer pair VP2-1, 3 is a primer pair VP2-2, 4 is a primer pair VP2-3, and 5 is a primer pair VP 2-4. As can be seen from FIG. 3, different primers have an effect on the amplification effect, the band obtained by using primer VP2-2 for DNA amplification experiment is weak, the band obtained by using primer VP2-3 for amplification has a diffuse tail, the effect obtained by using primer VP2-1 for DNA amplification experiment is good, and the amplification result of the negative control group is normal.

Based on the above experimental results, primer VP2-1 was selected as the primer for the fluorescence detection experiment. A fluorescent Probe VP2-Probe (Probe sequence shown below) was designed based on the DNA sequence corresponding to primer VP 2-1.

VP2-Probe:

CAATGGGATAGGACATTAATACCATCTCA(F)A(H)(B)GGAACTAGTGGC-C3 Spacer；

Wherein F is a fluorescent group, H is tetrahydrofuran, B is a quenching group, and the 3' end is marked with a C3 spacer;

example two: fluorescence detection

This example illustrates the fluorescent reaction carried out on a fluorometer at room temperature and constant temperature.

1. The feline parvovirus VP2 gene sequence is synthesized in a whole gene according to the feline parvovirus VP2 gene sequence already published on NCBI GenBank.

2. A pair of primers (VP2-F1 and VP2-R1) and a fluorescent Probe (VP2-Probe) are designed from the gene sequence of the feline parvovirus VP2, and the sequences are shown in the following table 2:

TABLE 2 sequences of primers and probes for the feline parvovirus VP2 Gene

In Table 2, (F) is Fluorophore, (H) is THF residue, (B) is Quencher, and 3' end is labeled Biotin-TEG.

3. The amplification reaction system is as follows:

remarking: the lyophilized powder reagent contains the above essential enzymes and auxiliary components.

4. And (3) amplification reaction program: constant temperature of 39 ℃ for 20 minutes.

And (3) performing 10-fold gradient dilution on the gene template of the feline parvovirus VP2 by using RNase Free dH2O, performing a fluorescence experiment by using an MIRA fluorescence detection kit, and judging the result to be positive by judging that the fluorescence detection has an increase curve of a fluorescence signal within 20 min. As shown in FIG. 4, 1-4 shows the amplification effect of primer VP2-1 and Probe VP2-Probe at different template concentrations (template concentrations: 1: 104 copies/. mu.L, 2: 103 copies/. mu.L, 3: 102 copies/. mu.L, 4: 101 copies/. mu.L, negative control group). The method can detect that the synthetic positive plasmid template of 102 copies/. mu.L of feline parvovirus VP2 gene is positive. As can be seen from FIG. 4, 104 copies/. mu.L of the positive plasmid template detected an increased fluorescence signal at around 4.5min, and even the lowest amount of 102 copies/. mu.L of the DNA template detected an increase in fluorescence signal at 9 min. Moreover, the negative reaction is kept at a low level throughout the fluorescence detection process.

Example 3: sample detection

In order to test the specificity of the detection method, samples of different viruses frequently suffered by cats are collected for detection.

The detection result shows that: only the feline parvovirus sample has a positive result of normal amplification, and none of the feline coronavirus sample, the feline herpesvirus type I sample, and the negative control has amplification, as shown in FIG. 5, wherein 1 and 2 are feline parvovirus samples, 3 is a feline coronavirus sample, 4 is a feline herpesvirus type I sample, and 5 is a negative control group. The results show that the MIRA constant temperature fluorescence detection kit can specifically amplify the target sequence in the FPV without cross reaction with other virus nucleic acids. The method of the invention has good specificity and no false negative.

In conclusion, the kit can be used for quickly, real-timely and specifically detecting the feline parvovirus, the rapid detection of a nucleic acid target object is realized in an instrument with a fluorescence detection function under the combined action of the specific primer, the specific fluorescent probe, 5 engineering enzymes and other chemical components, the closed-tube detection is ensured through strict experimental operation steps, the aerosol pollution is effectively prevented, and the kit is suitable for being applied to various fluorescence detection devices for detection.

The present invention may be embodied in other specific forms without departing from the spirit or essential attributes thereof, and it should be understood that various changes and modifications can be effected therein by one skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

Sequence listing

<110> Weifang 'ann Pu' er future Biotechnology Co Ltd

<120> primers, probes, reagents and method for rapidly detecting feline parvovirus at normal temperature and isothermal temperature

<130>WF

<160>10

<170>SIPOSequenceListing 1.0

<210>1

<211>31

<212>DNA

<213> Artificial sequence ()

<400>1

cattgatggt tgcattagat agtaataata c 31

<210>2

<211>30

<212>DNA

<213> Artificial Synthesis ()

<400>2

cacctgttct tagtaagtgy actggcacag 30

<210>3

<211>30

<212>DNA

<213> Artificial Synthesis ()

<400>3

tagtaataat actatgccat ttactccagc 30

<210>4

<211>30

<212>DNA

<213> Artificial Synthesis ()

<400>4

ttgattgtaa accatgtaga ctaacacata 30

<210>5

<211>31

<212>DNA

<213> Artificial Synthesis ()

<400>5

ctccagcagc tatgagatct gagacattrg g 31

<210>6

<211>31

<212>DNA

<213> Artificial Synthesis ()

<400>6

ttcctgtagc aaattcatca cctgttctta g 31

<210>7

<211>31

<212>DNA

<213> Artificial Synthesis ()

<400>7

ttactccagc agctatgaga tctgagacat t 31

<210>8

<211>31

<212>DNA

<213> Artificial Synthesis ()

<400>8

ctaagaacag gtgatgaatt tgctacagga a 31

<210>9

<211>42

<212>DNA

<213> Artificial Synthesis-VP 2-Probe ()

<400>9

caatgggata ggacattaat accatctcaa ggaactagtg gc 42

<210>10

<211>1755

<212>DNA

<213> Artificial sequence ()

<400>10

atgagtgatg gagcagttca accagacggt ggtcaacctg ctgtcagaaa tgaaagagct 60

acaggatctg ggaacgggtc tggaggcggg ggtggtggtg gttctggggg tgtggggatt 120

tctacgggta ctttcaataa tcagacggaa tttaaatttt tggaaaacgg atgggtggaa 180

atcacagcaa actcaagcag acttgtacat ttaaatatgc cagaaagtga aaattataaa 240

agagtagttg taaataatat ggataaaact gcagttaaag gaaacatggc tttagatgat 300

actcatgtac aaattgtaac accttggtca ttggttgatg caaatgcttg gggagtttgg 360

tttaatccag gagattggca actaattgtt aataccatga gtgagttgca tttagttagt 420

tttgaacaag aaatttttaa tgttgtttta aagactgttt cagaatctgc tactcagcca 480

ccaactaaag tctataataa tgatttaact gcatcattga tggttgcatt agatagtaat 540

aatactatgc catttactcc agcagctatg agatctgaga cattaggttt ttatccatgg 600

aaaccaacca taccaactcc atggagatat tattttcaat gggataggac attaatacca 660

tctcatactg gaactagtgg cacaccaaca aatgtatatc atggtacaga tccagatgat 720

gttcaatttt atactattga aaattctgtg ccagtacact tactaagaac aggtgatgaa 780

tttgctacag gaacattttt ttttgattgt aaaccatgta gactaacaca tacatggcaa 840

acaaatagag cattgggctt accaccattt ctaaattctt tgcctcaatc tgaaggagct 900

actaactttg gtgatatagg agttcaacaa gataaaagac gtggtgtaac tcaaatggga 960

aatacagact atattactga agctactatt atgagaccag ctgaggttgg ttatagtgca 1020

ccatattatt cttttgaagc atctacacga gggccattta aaacacctat tgcagcagga 1080

cgggggggag cacaaacaga tgaaaatcaa gcagcagatg gtgatccaag atatgcattt 1140

ggtagacaac atggtcaaaa aactactaca acaggagaaa cacctgagag atttacatat 1200

atagcacacc aagatacagg aagatatcca gaaggagatt ggattcaaaa tattaacttt 1260

aaccttcctg taacaaatga taatgtatta ctaccaacag atccaattgg aggtaaaaca 1320

ggaattaact atactaatat atttaatact tatggtcctt taactgcatt aaataatgta 1380

ccaccagttt atccaaatgg tcaaatttgg gataaagaat ttgatactga cttaaaacca 1440

agacttcatg taaatgcacc atttgtttgt caaaataatt gtcctggtca attatttgtg 1500

aaagttgcgc ctaatttaac aaatgaatat gatcctgatg catctgctaa tatgtcaaga 1560

attgtgactt actcagattt ttggtggaaa ggtaaattag tatttaaagc taaactaaga 1620

gcatctcata cttggaatcc aattcaacaa atgagtatta atgtagataa ccaatttaac 1680

tatgtaccaa ataatattgg agctatgaaa attgtatatg aaaaatctca actagcacct 1740

agaaaattat attaa 1755

Claims (8)

1. A primer and a probe for quickly detecting feline parvovirus at normal temperature and isothermal temperature are characterized in that the sequences of the primer and the probe are as follows:

the upstream primer VP 2-F1: CATTGATGGTTGCATTAGATAGTAATAATAC, respectively;

downstream primer VP 2-R2: CACCTGTTCTTAGTAAGTGYACTGGCACAG, respectively;

probe VP 2-Probe:

CAATGGGATAGGACATTAATACCATCTCA(F)A(H)(B)GGAACTAGTGGC-C3 Spacer；

wherein F is a fluorescent group, H is tetrahydrofuran, B is a quenching group, and the 3' end is marked with a C3 spacer.

2. A reagent for rapidly detecting feline parvovirus at normal temperature and isothermal temperature, which comprises the primer and the probe of claim 1.

3. The reagent for rapid detection of feline parvovirus at normal temperature and isothermal according to claim 2, wherein the reagent further comprises polyethylene glycol, Tris, potassium acetate, dithiothreitol, adenosine monophosphate, creatine phosphate disodium salt, phosphocreatinase, deoxyribonucleoside triphosphate, trehalose, mannitol, recombinase, single-stranded DNA binding protein, DNA polymerase, helper protein, and exonuclease.

4. The reagent for rapidly detecting feline parvovirus at normal temperature and isothermal temperature according to claim 3, wherein the preparation method of the reagent comprises the following steps:

pre-freezing the reaction solution at-80 ℃ for 1-1.5 hours to obtain a pre-freezing reagent;

and (3) drying the pre-frozen reagent for 2-10 hours at-35 to-45 ℃, and then drying for 1-2 hours at 10-18 ℃ to obtain the freeze-dried powder.

5. The reagent for rapidly detecting feline parvovirus at normal temperature and isothermal temperature according to claim 3, wherein the concentration ranges of the components are as follows:

recombinase 520-725 ng/. mu.l; single-stranded DNA binding protein 100-200 ng/. mu.l; DNA polymerase 350-450 ng/. mu.l; exonuclease 300-400 ng/. mu.l.

6. The reagent for rapidly detecting feline parvovirus at normal temperature and isothermal temperature according to claim 5, wherein the concentration ranges of the components are as follows:

2-4% of polyethylene glycol; tris, 20-40 mM; potassium acetate, 100-; dithiothreitol, 4-8 mM; adenosine monophosphate, 2-4 mM; creatine phosphate disodium salt, 40-60 mM; phosphocreatinase, 80-120 ng/. mu.l; deoxyribonucleoside triphosphates, 250-; 5-8% of trehalose; mannitol, 20-40 ng/. mu.l.

7. A method for rapidly detecting feline parvovirus at normal temperature and isothermally by using the reagent as defined in any one of claims 3 to 6, wherein the method comprises the following steps:

adding a sample to be detected, double distilled water and a buffer solution into a reaction tube filled with the reagent;

and placing the mixture in a temperature control device for incubation for 15-25 minutes, and performing visual detection through an instrument with a fluorescence detection function, wherein the reaction tube is kept closed in the detection process.

8. The method of claim 7, wherein the temperature control device maintains a constant temperature, and the temperature is in the range of 20 ℃ to 42 ℃.

Images