CN109321568A - The method of new-generation sequencing connector of the preparation with molecular label - Google Patents

The method of new-generation sequencing connector of the preparation with molecular label Download PDF

Info

Publication number
CN109321568A
CN109321568A CN201811245173.4A CN201811245173A CN109321568A CN 109321568 A CN109321568 A CN 109321568A CN 201811245173 A CN201811245173 A CN 201811245173A CN 109321568 A CN109321568 A CN 109321568A
Authority
CN
China
Prior art keywords
sequence
connector
label
new
generation sequencing
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201811245173.4A
Other languages
Chinese (zh)
Inventor
郑贤杰
朱垚
曹振
李剑辉
宋东亮
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Yi San Biotechnology (shanghai) Co Ltd
Original Assignee
Yi San Biotechnology (shanghai) Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yi San Biotechnology (shanghai) Co Ltd filed Critical Yi San Biotechnology (shanghai) Co Ltd
Priority to CN201811245173.4A priority Critical patent/CN109321568A/en
Publication of CN109321568A publication Critical patent/CN109321568A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

A kind of method preparing the new-generation sequencing connector with molecular label of the invention, it is characterized in that, it include: step 1: synthetic linker sequence, joint sequence includes First ray and the second sequence, wherein, second sequence includes: the protection base of restriction enzyme and the duplex molecule label of 6 randomized bases, and the restriction enzyme site of restriction enzyme MnlI, there is complementary sequence fragment in First ray and the second sequence, step 2: joint sequence annealing, mix First ray and the second sequence, it anneals to form double-strand by cycle of annealing in annealing system, step 3: the connector of double-strand formed in polishing step 2, step 4: digestion simultaneously recycles connector.The method of new-generation sequencing connector of the preparation with molecular label of the invention has the advantage that containing longer duplex molecule label in connector, provides better information basis for analysis of living；Suitable for a variety of microarray datasets.

Description

The method of new-generation sequencing connector of the preparation with molecular label
Technical field
The present invention relates to a kind of methods for preparing the new-generation sequencing connector with molecular label, belong to molecular biology neck Domain.
Background technique
In Illumina microarray dataset, connector is that necessary element in library is built in the sequencing of two generations, at present the connector packet of official Containing multiple types, p5 and p7 amplimer binding sequence, read1 and read2 sequencing primer binding sequence, sample are contained in sequence This sequence label, molecular label sequence etc., and with the 3 '-dT tails for A/T connection.
Often in the end p7, design single chain molecule label is used to add label to the target molecule built in library at present, makes raw letter analysis Process can capture finer molecular information, reduce the background noise of analysis of variance.
Alternatively, it is also possible to be believed by raw by the background of analysis of variance by duplex molecule label in conjunction with single chain molecule label Noise is even lower, and keeps sequencing analysis result more accurate reliable.
But library construction is convenient to currently without preferable double-strand label addition method.
Summary of the invention
The purpose of the present invention is to provide a kind of methods for preparing the new-generation sequencing connector with molecular label, to solve The above problem.
Present invention employs following technical solutions:
A method of preparing the new-generation sequencing connector with molecular label characterized by comprising
Step 1: synthetic linker sequence, joint sequence include First ray and the second sequence,
Wherein, second sequence includes: the protection base of restriction enzyme and the duplex molecule mark of 6 randomized bases The restriction enzyme site of label and restriction enzyme MnlI has complementary sequence fragment in First ray and the second sequence,
Step 2: joint sequence annealing mixes First ray and the second sequence, anneals in annealing system by cycle of annealing Double-strand is formed,
Step 3: the connector of double-strand formed in polishing step 2,
Step 4: digestion simultaneously recycles connector.
Further, the method for new-generation sequencing connector of the preparation with molecular label of the invention, also has such spy Sign: where also with the single chain molecule label of randomized bases in second sequence.
Further, the method for new-generation sequencing connector of the preparation with molecular label of the invention, also has such spy Sign: where also there is sample label in second sequence.
Further, the method for new-generation sequencing connector of the preparation with molecular label of the invention, also has such spy Sign: in step 3, the annealed product in filling-in step 2 is extended using T4DNA polymerase.
Further, the method for new-generation sequencing connector of the preparation with molecular label of the invention, also has such spy Sign: in step 4, using the extension products in restriction enzyme MnlI digestion step 3, the remnants within 50bp are then removed Double-strand small fragment retains connector.
Further, the method for new-generation sequencing connector of the preparation with molecular label of the invention, also has such spy Sign: the sequence of First ray is as follows:
5-A*A*TGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC-GCTCTTCCGAT*C*T-3。
Further, the method for new-generation sequencing connector of the preparation with molecular label of the invention, also has such spy Sign: the sequence of the second sequence is as follows:
5-NNNN-ANNNNNNGAGG-AG*A*TCGGAAGAGC-ACACGTCTGAACTCCAGTCAC-NNNN- NNNNNNNN-ATCTCGTATGCCGTCTTCTGCT*T*G-3
Wherein, the 1st to the 4 protection base for restriction enzyme, base number 0-10,
6th to the 11st be six randomized bases duplex molecule label,
50th to the 53rd be four randomized bases single chain molecule label,
54th to the 61st be 6-8 base sample label,
5th to the 15th is for the restriction enzyme site of restriction enzyme HpyAV.
Advantageous effect of the invention
The method of new-generation sequencing connector of the preparation with molecular label of the invention, has the advantage that
1, contain longer duplex molecule label in connector, provide better information basis for analysis of living；
2, effective, more economical acquisition connector can be synthesized economically；
3, it is suitable for a variety of microarray datasets such as Illumina Hi-Seq, Mi-Seq.
Specific embodiment
It is described the specific embodiments of the present invention in detail below in conjunction with specific embodiment.
Technical solution:
Step 1: synthetic linker sequence.Synthesize following two sequence:
Sequence 1:
5-A*A*TGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC-GCTCTTCCGAT*C*T-3
Sequence 2:
5-NNNN-ANNNNNNGAGG-AG*A*TCGGAAGAGC-ACACGTCTGAACTCCAGTCAC-NNNN- NNNNNNNN-ATCTCGTATGCCGTCTTCTGCT*T*G-3
" * " is protection sex modification in sequence；
1st to 4 base is the protection base of restriction enzyme, and base number 0-10 are differed, and specific base is variable, Depending on real case design；
6th to the 11st base is the duplex molecule label of 6 randomized bases；
50th to the 53rd base is the single chain molecule label of 4 randomized bases, can change base number according to application；
54th to the 61st base is the sample label of 6-8 base in sequence measuring joints, synthesizes fixed base every time Sequence, secondary sequence are variable；
The base of red font is the restriction enzyme site of restriction enzyme MnlI.
Step 2: joint sequence annealing.
Step 3: extend polishing connector.Annealed product in filling-in step 2 is extended using T4DNA polymerase.
Step 4: 3 '-dT tail connectors are recycled in digestion.It is produced using the extension in restriction enzyme MnlI digestion step 3 Object, and using the Hieff NGS of Shanghai Yi Sheng Biotechnology Co., LtdTMSmarter DNA Clean Beads purification and recovery Connector removes the remaining double-strand small fragment within 50bp, retains connector.
6N duplex molecule label connector prepares example:
1, synthetic linker sequence:
Sequence 1:
5-A*A*TGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC-GCTCTTCCGAT*C*T-3
Sequence 2:
5-TTTC-ANNNNNNGAGG-AG*A*TCGGAAGAGC-ACACGTCTGAACTCCAGTCAC-NNNN- NNNNNNNN-ATCTCGTATGCCGTCTTCTGCT*T*G-3
The NNNN at 5 ' ends specifically uses TTTC in present embodiment.
2, joint sequence is annealed:
1:1 mixes sequence 1 and sequence 2, anneals to form double-strand by cycle of annealing in annealing system, is formed with flowering structure:
3, extend polishing connector:
Extend polishing joint sequence using T4DNA polymerase, as follows:
4,3 '-dT tail connectors are recycled in digestion:
Using the above-mentioned connector of MnlI digestion with restriction enzyme, and utilize Shanghai Yi Sheng Biotechnology Co., Ltd Hieff NGSTMSmarter DNA Clean Beads purification and recovery connector, connector are as follows:
The connector recovery efficiency of method provided by the present invention, 40%~80%.

Claims (7)

1. a kind of method for preparing the new-generation sequencing connector with molecular label characterized by comprising
Step 1: synthetic linker sequence, joint sequence include First ray and the second sequence, wherein second sequence includes: The digestion of the duplex molecule label and restriction enzyme MnlI of the protection base of restriction enzyme and 6 randomized bases There is complementary sequence fragment in site, First ray and the second sequence,
Step 2: joint sequence annealing mixes First ray and the second sequence, anneals to be formed by cycle of annealing in annealing system Double-strand,
Step 3: the connector of double-strand formed in polishing step 2,
Step 4: digestion simultaneously recycles connector.
2. the method for new-generation sequencing connector of the preparation with molecular label as described in claim 1, it is characterised in that:
Wherein, also with the single chain molecule label of randomized bases in second sequence.
3. the method for new-generation sequencing connector of the preparation with molecular label as described in claim 1, it is characterised in that:
Wherein, also there is sample label in second sequence.
4. the method for new-generation sequencing connector of the preparation with molecular label as described in claim 1, it is characterised in that:
In step 3, the annealed product in filling-in step 2 is extended using T4DNA polymerase.
5. the method for new-generation sequencing connector of the preparation with molecular label as described in claim 1, it is characterised in that:
In step 4, using the extension products in restriction enzyme MnlI digestion step 3, then remove residual within 50bp Remaining double-strand small fragment retains connector.
6. the method for new-generation sequencing connector of the preparation with molecular label as described in claim 1, it is characterised in that:
The sequence of First ray is as follows:
5-A*A*TGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC-GCTCTTCCGAT*C*T-3。
7. the method for new-generation sequencing connector of the preparation with molecular label as described in claim 1, it is characterised in that:
The sequence of second sequence is as follows:
5-NNNN-ANNNNNNGAGG-AG*A*TCGGAAGAGC-ACACGTCTGAACTCCAGTCAC-NNNN-NNNNNNNN- ATCTCGTATGCCGTCTTCTGCT*T*G-3
Wherein, the 1st to the 4 protection base for restriction enzyme, base number 0-10,
6th to the 11st be six randomized bases duplex molecule label,
50th to the 53rd be four randomized bases single chain molecule label,
54th to the 61st be 6-8 base sample label,
5th to the 15th is for the restriction enzyme site of restriction enzyme MnlI.
CN201811245173.4A 2018-10-25 2018-10-25 The method of new-generation sequencing connector of the preparation with molecular label Pending CN109321568A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201811245173.4A CN109321568A (en) 2018-10-25 2018-10-25 The method of new-generation sequencing connector of the preparation with molecular label

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201811245173.4A CN109321568A (en) 2018-10-25 2018-10-25 The method of new-generation sequencing connector of the preparation with molecular label

Publications (1)

Publication Number Publication Date
CN109321568A true CN109321568A (en) 2019-02-12

Family

ID=65263302

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201811245173.4A Pending CN109321568A (en) 2018-10-25 2018-10-25 The method of new-generation sequencing connector of the preparation with molecular label

Country Status (1)

Country Link
CN (1) CN109321568A (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102559918A (en) * 2012-02-28 2012-07-11 盛司潼 Sequencing method capable of increasing reading length through enzyme digestion extension
CN106086162A (en) * 2015-11-09 2016-11-09 厦门艾德生物医药科技股份有限公司 A kind of double label joint sequences for detecting Tumor mutations and detection method
CN107586835A (en) * 2017-10-19 2018-01-16 东南大学 A kind of construction method of sequencing library of future generation based on single-stranded joint and its application
CN107858414A (en) * 2017-10-18 2018-03-30 广州漫瑞生物信息技术有限公司 A kind of high-flux sequence joint, its preparation method and its application in ultralow frequency abrupt climatic change

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102559918A (en) * 2012-02-28 2012-07-11 盛司潼 Sequencing method capable of increasing reading length through enzyme digestion extension
CN106086162A (en) * 2015-11-09 2016-11-09 厦门艾德生物医药科技股份有限公司 A kind of double label joint sequences for detecting Tumor mutations and detection method
CN107858414A (en) * 2017-10-18 2018-03-30 广州漫瑞生物信息技术有限公司 A kind of high-flux sequence joint, its preparation method and its application in ultralow frequency abrupt climatic change
CN107586835A (en) * 2017-10-19 2018-01-16 东南大学 A kind of construction method of sequencing library of future generation based on single-stranded joint and its application

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
MICHAEL W. SCHMITT ET AL.: "Detection of ultra-rare mutations by next-generation sequencing", 《PNAS》 *

Similar Documents

Publication Publication Date Title
US11505795B2 (en) Error detection in sequence tag directed sequencing reads
CN105849264B (en) For identifying the composition and method that repeat sequencing reading
CN103131754B (en) Method for detecting nucleic acid hydroxylmethylation modification, and application thereof
CN106555226B (en) A kind of method and kit constructing high-throughput sequencing library
CN107002292B (en) A kind of construction method and reagent in the twin adapter single stranded circle library of nucleic acid
CN106661575B (en) Linker element and method for constructing sequencing library by using same
CN107075513A (en) The oligonucleotides of separation and its purposes in nucleic acid sequencing
CN107653306B (en) Rapid bifidobacterium detection method based on high-throughput sequencing and application
CN108949941A (en) Low frequency mutation detection methods, kit and device
CN109486811A (en) Both-end molecular label connector and application thereof and the sequencing library with the connector
CN104562213A (en) Amplification sublibrary and construction method thereof
WO2018108328A1 (en) Method for increasing throughput of single molecule sequencing by concatenating short dna fragments
CN107119043A (en) A kind of non-targeted RNA method in removal RNA samples
CN106319639B (en) Build the method and apparatus of sequencing library
CN108753954B (en) Capture probe set of dementia-related gene, kit, library construction method and application
CN106637422B (en) Method for constructing Hi-C high-throughput sequencing library
CN106947827A (en) One kind obtains flathead sex specific molecular marker and its screening technique and application
CN105925671B (en) A method of target sequence nucleotides are enriched with from nucleic acid samples
CN105986015A (en) Method and kit for detecting one or more target sequence of multiple samples based on high-throughput sequencing
CN108913753B (en) A method of preparing two generation sequence measuring joints
CN109402224A (en) The method of two generation sequence measuring joints of the preparation with duplex molecule label
CN109055486A (en) A kind of construction method of high degradation of dna sequencing library and its application
CN109321568A (en) The method of new-generation sequencing connector of the preparation with molecular label
CN109295164A (en) A method of preparing the two generation sequence measuring joints with molecular label
CN109355281A (en) Method of the preparation with single-stranded and duplex molecule label new-generation sequencing connector

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20190212

WD01 Invention patent application deemed withdrawn after publication