CN109266648A - For the gene editing compositions or agents box in body gene therapy - Google Patents
For the gene editing compositions or agents box in body gene therapy Download PDFInfo
- Publication number
- CN109266648A CN109266648A CN201811144025.3A CN201811144025A CN109266648A CN 109266648 A CN109266648 A CN 109266648A CN 201811144025 A CN201811144025 A CN 201811144025A CN 109266648 A CN109266648 A CN 109266648A
- Authority
- CN
- China
- Prior art keywords
- sgrna
- sequence
- gene
- nucleic acid
- compositions
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/12—Drugs for disorders of the urinary system of the kidneys
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P21/00—Drugs for disorders of the muscular or neuromuscular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases RNAses, DNAses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
Abstract
The present invention is provided to the gene editing compositions or agents boxes in body gene therapy.The present invention provides a kind of gene editing compositions or agents box, it includes the sgRNA connecting with protein-bonded nucleic acid molecules or its coded sequence that 1) target purpose mutated gene, 2) template nucleic acid or its coded sequence of purpose mutated gene are repaired, 3) nuclease or its coded sequence of sgRNA guidance, 4) albumen or its coded sequence of the promotion homologous recombination merged with nucleic acid binding protein, wherein the nucleic acid binding protein can with it is above-mentioned 1) in nucleic acid molecules in conjunction with.The purposes of disease such as genetic disease caused by being mutated the invention further relates to the sgRNA, compositions or agents box therapeutic gene.SgRNA of the invention, compositions or agents box can effectively improve the efficiency of homologous recombination repair, and also be able to achieve homologous recombination repair in non-dividing cell.
Description
Technical field
The present invention relates to molecular biology gene editing fields.Specifically, the present invention is combined by a kind of gene editing
Object efficiently accurately hardens such as genetic disease of disease caused by gene mutation such as retinitis pigmentosa, genetic muscle
Disease, hereditary tyrosinemia etc. carry out gene repair in body gene mutation.
Background technique
In recent years, advancing by leaps and bounds due to technique for gene engineering, CRISPR/Cas9 technology just like have become scientific circles
One of hot spot is widely used in all kinds of internal and external science of heredity transformation, building transgenosis model animal and genes and controls
The fields such as treatment.Two CRISPR technical papers being of great significance, the Massachusetts Institute of Technology have been published in instalments within 2013 on Science
The locus specificity for promoting RNA guidance has been displayed in the study group of Zhang Feng, II type protokaryon CRISPR adaptive immune system
DNA cutting.Researcher designs two different II type CRISPR systems, and proves that Cas9 nuclease can be lured by short rna s
Accurate cutting is led in the mankind and mouse cell endogenous gene group gene loci.Cas9 can also be converted into nickase and promote to have most
The same source orientation reparation of small mutagenic activity.
Genome fixed point editor/modification basic principle is lacked using in the DNA double chain that target spot area is spontaneous or induces at present
Mouth (double-strain breaks, DSBs), the DNA repair mechanism in active cell is carried out changing for genome by DSBs
It makes, such as the end connection (Non-homologous end joint, NHEJ) or homologous recombination in non-homogeneous area
(Homologousrecombination, HR).In mammalian cell, the probability of the spontaneous generation of DSB is less than about 1/104, such as
Fruit induces DSBs using the nucleases such as spCas9 and SaCas9 by gene engineering method, and efficiency can be improved to 10% or more, and
With locus specificity, therefore facilitates the gene repair process carried out in next step to endogenous gene target site and go on smoothly.
After DNA repair pathways in DSBs active cell, have two different repair mechanisms it is emulative participate in DSBs reparation, one
Kind is the end connection NHEJ of non-homologous region, and one is homologous recombination HR.The accurate editor for realizing genome target site, needs
Rely on homologous recombination repair mechanism intracellular.Therefore the frequency or inhibition that homologous recombination occurs in DSBs repair process are directly improved
The end connection (NHEJ) in non-homogeneous area both contributes to improve genome fixed point editor/modification efficiency.The end in non-homogeneous area
Connection (NHEJ) and the generation of homologous recombination (HR) are all participated there are many albumen.
Retinitis pigmentosa is one group of genetic disease, and wherein (rod cell or the cone are thin for the photosensory cell of retina
Born of the same parents) or retinal pigment epithelium exception, will lead to progressive visual loss.In retinitis pigmentosa pathogenic process
In, the slow death of mainly intraretinal rod cell then causes the apoptosis of cone cell.And rod cell works as light
It is responsible for vision when very low, then the apoptosis of the cell can make dark vision become poor.The first symptoms of retinitis pigmentosa
Children's early stage is normally started from, over time, the progressive loss of indirect vision then occurs.After the disease
Phase, people, which have, retains (tunnel vision) compared with the central vision of small area and lesser indirect vision.Phosphodiesterase
(phosphodiesterase, PDE) is played an important role in light conductive process, and the stimulation of extraneous photon makes rhodopsin
(rhodopsin) it activates, the latter activates downstream light transducin (transducin), and the transducin of activation has activated retinal rod again
Cyclic guanosine monophosphate (cGMP) makes the reduction of its concentration in PDE in cell, PDE degradation photosensory cell.And cGMP be photoreceptor from
The specific receptor of subchannel, its degradation cause rod cell film cationic channel to be closed, and flow and reduce in Na+, Ca2+, light sensation
Receiver cell hyperpolarization, the nerve impulse generated so as to cause visual signal are transmitted step by step to visual centre, therefore people feel
Stimulation by light.It has now been found that the exception of PDE is widely present in many retina pigment denaturation patients.
Pde6b gene coding includes the PDE albumen β subunit of 856 amino acid residue composition, its mutation usually causes PDE
Dysfunction, light signal transduction access are cut off, can generate excessive oxidative stress, eventually lead to withering for photoreceptor cell
It dies.The Retinal degeneration (retinaldegeneration, rd) being found as the first, rd1 mouse is by people
A kind of retinal pigment degeneration mouse model studied extensively, Disease-causing gene are confirmed as pde6b, a nothing on exon 7
Justice mutation (TAC → TAA) is the reason of causing disease to occur.Retinitis pigmentosa model mice pde6brd1/rd1, mouse exists
Outer nuclear layer is thinning in 10 days beginning retinas after birth, and rod cell is degenerated rapidly loss, to birth after 30 days rod cells move back
Change complete.
In recent years it about genetic diseases such as muscle gellings, is able to successfully be successfully realized on model animal in body base
Because for the treatment of, but since there is also certain limitations and optimization property for its method, led for gene defect in nerve cell
The genetic disease of cause, it is also necessary to more further be developed on raising homologous recombination efficiency.
Summary of the invention
In order to improve the efficiency of the critical homologous recombination repair in body gene therapy, at the same it is postnatal in order to realize
In body homologous recombination repair, and then hope can also maintain the generation of homologous recombination repair on the non-dividing cells such as nervous system,
Make it possible for individual in body gene therapy after birth.
For the deficiency of existing gene editing technology, the present invention provide a kind of gene editing composition, preparation method and
Disease such as genetic disease such as retinitis pigmentosa, genetic muscle sclerosis, heredity caused by being mutated in body therapeutic gene
Property tyrosinemia etc. application, improve the efficiency and therapeutic effect of fixed point gene repair.
In some embodiments, the present invention provides a kind of gene editing compositions or agents box, and it includes 1) target mesh
Mutated gene the sgRNA being connect with protein-bonded nucleic acid molecules or its coded sequence, 2) repair purpose mutated gene
Template nucleic acid or its coded sequence, 3) rush nuclease or its coded sequence of sgRNA guidance, 4) merged with nucleic acid binding protein
Into the albumen of homologous recombination or its coded sequence, wherein the nucleic acid binding protein can with it is above-mentioned 1) in nucleic acid molecules knot
It closes.
In some embodiments, the present invention provides a kind of gene editing compositions or agents box, and it includes 1) target
The sgRNA of the SEQ ID NO:1 of pde6b gene, 2) template nucleic acid and the 3) core of sgRNA guidance of pde6b mutated gene are repaired
Sour enzyme or its coded sequence.In some embodiments, as described above, the sgRNA can be with protein-bonded nucleic acid molecules
Connection.In some embodiments, the compositions or agents box also includes that the promotion merged with nucleic acid binding protein is homologous heavy
The albumen or its coded sequence of group, wherein the nucleic acid binding protein can be specifically bound with above-mentioned nucleic acid molecules.
In some embodiments, the purpose mutated gene can be for example since its mutation leads to disease such as heredity
The gene of disease.In some embodiments, the purpose mutated gene can be such as Pde6b gene, Fah gene,
Dystrophin gene etc..In some embodiments, the sgRNA is the sgRNA for targeting the purpose mutated gene.One
In a little embodiments, the sgRNA is the sgRNA for targeting Pde6b gene, such as includes sequence shown in SEQ ID NO:2
sgRNA。
In some embodiments, it is described promote homologous recombination albumen include promote in protokaryon and eukaryocyte it is homologous heavy
The albumen of group.In some embodiments, the albumen for promoting homologous recombination includes RecA, the eukaryon in such as prokaryotes
Rad51, Rad52 and Brca1 etc. in biology.Rad51, Rad52 and Brcal are the important participation eggs of homologous recombination repair process
White, RecA is the homologous protein of Rad51 in prokaryotes, these albumen can promote homologous recombination repair process.In some implementations
In scheme, the albumen for promoting homologous recombination can merge the fusion protein to be formed with nucleic acid binding protein.
In some embodiments, the nucleic acid binding protein is not particularly limited, if its can specifically bind with
The nucleic acid molecules of sgRNA connection.In some embodiments, the nucleic acid binding protein can be such as MS2 albumen,
RPA-4 subunit, BRCA2, XRCC2, XRCC3, RadA, HNRNPA1, NABP2 (SSB1), NABPI (SSB2) and UHRF1.One
In a little embodiments, the protein-bonded nucleic acid molecules include, such as the sequence that can be identified by above-mentioned protein-specific, example
Such as DNA and/or RNA sequence, such as aptamer, such as DNA and/or RNA aptamer.In some embodiments, it specifically binds
The albumen of specific nucleic acid sequence is well known in the art, for example, can be have than control sequence more high-affinity so as to from
The albumen of aim sequence is combined and separated in control sequence.In some embodiments, it can be identified by above-mentioned protein-specific
Sequence can have specific structure, such as hairpin.In some embodiments, it can be identified by above-mentioned protein-specific
Sequence can be for example can be by hairpin shown in SEQ IDNO:3 that MS2 protein-specific identifies.
In some embodiments, the ingredient 1 of compositions or agents box), 2), 3) He 4) be present in one or more carriers
In.For example, in some embodiments, sgRNA can reside in a carrier, and the template nucleic acid for repairing mutated gene can
To be included in a separated carrier, or it is provided as a separated polynucleotides.For example, in some embodiments,
The coded sequence of the sgRNA and sgRNA nuclease guided can be included in the same carrier.In some embodiments,
The ingredient 1 of compositions or agents box), 2), 3) and optional 4) be present in multiple carriers, such as in 2,3,4 carriers.
In some embodiments, the template nucleic acid for repairing purpose mutated gene is that the target gene that will be mutated restores
For wildtype gene sequence or the homologous complementary recovery template of required sequence.In some embodiments, required sequence is to eliminate
The sequence for leading to the mutation of disease in the gene, is not limited to wild-type sequence.In some embodiments, the template sequence
Column can be such as single stranded template nucleic acid or double stranded template nucleic acid, such as single-stranded DNA templates, double-stranded DNA template or cyclic plasmid
Template.In some embodiments, homologous complementary recovery template is used to repair prominent in pde6b gene such as the 7th exon
Become, such as point mutation, missing, insertion or other mutation.In some embodiments, homologous complementary recovery template is for repairing
The mutation for causing gene activity to be lost in pde6b gene in such as the 7th exon, such as nonsense mutation.In some embodiment party
In case, homologous complementary recovery template leads to retinitis pigmentosa in such as the 7th exon for repairing in pde6b gene
Mutation.
In some embodiments, the nuclease of the sgRNA guidance is not particularly limited, and may include such as CRISPR
Enzyme, such as Cas9, such as the spCas9 of spCas9, saCas9, such as SEQ ID NO:11 coding.
In some embodiments, the present invention provides a kind of sgRNA molecule, encodes the nucleic acid sequence of the sgRNA sequence,
Carrier comprising the sgRNA sequence or its coded sequence such as plasmid, and/or the cell comprising the carrier, wherein described
SgRNA molecule can be the sgRNA as described herein for gene editing.In some embodiments, the sgRNA molecule with
The nucleic acid molecules of binding proteins specific connect.In some embodiments, the sgRNA molecule can be for example for
The sgRNA comprising SEQ ID NO:2 of Pde6b gene.In some embodiments, provided herein is include the thin of the carrier
Born of the same parents.In some embodiments, the cell is mammalian cell such as people's cell.
In some embodiments, provided herein is disease such as genetic diseases caused by the gene mutation for the treatment of subject such as
The method of retinitis pigmentosa, genetic muscle sclerosis, hereditary tyrosinemia etc., the method includes to subject
Introduce the sgRNA sequence, the DNA sequence dna, the cell of the carrier and/or the modification, or into the cell of subject
The sgRNA sequence, the DNA sequence dna and/or the carrier are introduced, so that nuclease is directed to the base of mutation by sgRNA
Cause, to restore the expression of the mutated gene.In some embodiments, wherein the method (in vivo), body in vivo
(in vitro) and/or in vitro (ex vivo) is carried out outside.
In some embodiments, the present invention provides composition or sgRNA molecule of the invention, encodes the sgRNA sequence
The nucleic acid sequence of column, the carrier comprising the sgRNA sequence or its coded sequence, and/or the cell comprising the carrier are being made
It is ready for use on disease caused by therapeutic gene is mutated such as the purposes in genetic disease.
In some embodiments, disease such as genetic disease caused by the gene mutation can be for example due to gene
Disease caused by being mutated.In some embodiments, gene mutation includes being mutated such as displacement, missing, insertion.In some realities
It applies in scheme, gene mutation includes frameshift mutation, missense mutation, nonsense mutation, terminator codon mutation etc..In some embodiments
In, the disease can be such as heredity retinitis pigmentosa, genetic muscle sclerosis, hereditary tyrosinemia
Deng.
In some embodiments, provided herein is a kind of compositions or agents boxes comprising it is selected from the sgRNA sequence,
It is any one or more in the DNA sequence dna, the carrier and/or the cell.In some embodiments, described
Composition and/or kit include operation instructions, and the preferred kit can be used for purposes and method described herein.
In some embodiments, the kit is including suitable for storing the sgRNA sequence, the carrier, and/or described
The various reagents of DNA molecular such as buffer etc..In some embodiments, the kit includes being appropriate for the sgRNA
The various reagents that sequence, the carrier, and/or the DNA molecular are reacted with target gene include enzyme, conversion or transfection reagent
Deng.In some embodiments, the kit includes fitting through the sgRNA sequence, the carrier, and/or the DNA
Molecule adjusts destination gene expression reagent and reacting with target gene.
In some embodiments, RNA sequence provided herein such as sgRNA sequence and/or DNA sequence dna is isolated sequence
Or the sequence of synthesis.In some embodiments, the present invention provides sgRNA molecule and/or composition described herein and/or examination
The purposes of disease such as genetic disease caused by agent box is mutated for therapeutic gene.In some embodiments, the present invention provides
A kind of method that therapeutic gene is mutated caused disease such as genetic disease, the method includes making sgRNA described herein
Molecule and/or composition and/or kit are administered to the patient with the disease, thus treat the disease.In some realities
It applies in scheme, the present invention provides sgRNA molecule and/or composition and/or kit described herein in preparation for repairing base
Purposes in the drug of the disease because of caused by gene mutation caused by mutation such as genetic disease.In some embodiments, originally
Invention provides sgRNA molecule and/or composition and/or kit described herein, is used for disease caused by therapeutic gene is mutated
Disease such as genetic disease.
In some embodiments, the present invention provides a kind of body of caused disease such as genetic disease of target gene mutation
Interior gene editing method and gene editing composition, including the nuclease, sgRNA being connect with protein-bonded nucleic acid molecules, same
The albumen of source complementation recovery template, the promotion homologous recombination merged with nucleic acid binding protein.Have been found that sgRNA of the invention points
Son and/or composition and/or kit have achieved the effect that efficient fixed point precisely repairs mutated gene.
In some embodiments, the protein-bonded nucleic acid molecules connecting with the sgRNA can be sent out with specific RNA
Clamping structure.In some embodiments, for example, the specific site in sgRNA (SpCas9 and SaCas9) accesses RNA hair clip such as
MS2 hair clip (see, for example, Figure 13), this kind of hairpin structure can by corresponding nucleic binding protein such as MS2 binding protein specificity
Identification.In some embodiments, the nucleic acid sequence of MS2 hair clip can be the sequence as shown in SEQ ID NO:3.
In some embodiments, homologous recovery template as described herein can be to contain the artificial of pde6b normal sequence
Synthesizing single-stranded DNA sequence dna.In some embodiments, homologous recovery template may include template sequence shown in SEQ ID NO:5
Column or its segment.
In some embodiments, the present invention includes the promotion homologous recombination for constructing targeting and merging with nucleic acid binding protein
Albumen such as MS2-recA fusion protein, wherein nucleic acid binding protein such as MS2 albumen can recognize the nucleic acid molecules in sgRNA such as
The albumen for promoting homologous recombination such as RecA is accurately positioned to the gene loci of reparation MS2 hairpin structure.In some embodiments
In, the sequence of fusion protein can under the promoter that can drive the expressing fusion protein such as EF1a promoter carry out table
It reaches.
Inventor has had found that pigmentosa view can be greatly improved in gene editing method of the invention in an experiment
The efficiency that film inflammation In vivo homologous recombination occurs.
In some embodiments, the present invention provides the retinitis pigmentosa model mice and its structure of a kind of fluorescent marker
Construction method.In some embodiments, the method includes by the retinitis pigmentosa mouse of pde6b gene mutation with have
The mouse hybrid of fluorescin such as GFP, then the retinitis pigmentosa mouse with resulting F1 generation and the pde6b gene mutation
Backcrossing, screening pde6b gene mutation is homozygous and has the mouse of fluorescin such as GFP, to obtain the pigment of fluorescent marker
Property retinitis model mice.In some embodiments, it is described it is optional further include by compositions described herein or sgRNA
Molecule is introduced into the model mice of building.In some embodiments, the present invention uses the pigmentosa view with fluorescent marker
Epiplotitis mouse.To realize intuitive observation of the experiment overall process to rdl mouse rod cell, experiment using Nrl-eGFP mouse come
Rod cells whole in Mouse Retina are marked, retinitis pigmentosa rd1 mouse and Nrl-eGFP mouse are carried out
It after hybridization, then is gone to be returned rd1 mouse with resulting F1 generation, the homozygous and mouse with Nrl-eGFP of screening rd1 gene mutation makees
For the female parent of subsequent experimental, mouse situation is observed, and selects to carry out after the birth of P0 or P3 young rat in body reparative experiment.
In some embodiments, sgRNA molecule and/or composition and/or kit can be by drawing in body electroporation
Enter in subject.In some embodiments, it can be introduced into subject's photoreceptor cell, pass through genomic level, transcription
The efficiency of level, protein level, morphology, physiological level and the verifying of the big level of behavior level six in body gene repair.
The present invention includes the method in body gene editing.Have discovered that by nucleic acid binding protein such as MS2 albumen and corresponding
The albumen for promoting homologous recombination such as recA albumen can be directed enrichment by the interaction of binding sequence such as MS2 binding sequence
Cleavage site, the effective efficiency for improving homologous recombination repair are identified in Cas9, and are also able to achieve together in non-dividing cell
Source recombinantal repair.
Detailed description of the invention
Fig. 1 is rdl mouse mutational site and reparation schematic diagram.
Fig. 2 is newborn rat subretinal space electroporation transfection method.
Fig. 3 is green cells acquisition and subsequent unicellular genome and transcriptional level detection schematic diagram.
Fig. 4 is that sequencing result is repaired in genomic level detection.
Fig. 5 is the site estimation that misses the target.
Fig. 6 is the site sequencing result that misses the target.
Fig. 7 is that sequencing result is repaired in transcriptional level detection.
Fig. 8 is protein level testing result.
Fig. 9 is Mouse Retina Morphological comparison after 0 day electroporation transfection after birth.
Figure 10 is that 3 days Mouse Retinas divide Mouse Retina Morphological comparison after situations and electroporation transfection after being born.
Figure 11 is mouse isolated retina electrograph after electroporation transfection.
Figure 12 is mouse pupillary light reflex function after 0 day electroporation transfection after birth.
Figure 13 shows the sgRNA with MS2 hairpin structure.
Figure 14 is spCas9 expression vector plasmid map.
Figure 15 is the expression vector plasmid map that the sgRNA and MS2-recA fusion protein of hairpin structure is targeted with MS2.
Specific embodiment
Some exemplary implementation schemes of the invention are now specifically described in conjunction with attached drawing.In fact, the present invention can be many
Different forms embodies, and is not limited by specific embodiment illustrated herein.
1.sgRNA
In general, sgRNA is that have complementarity enough to hybridize with target sequence and instruct with target polynucleotide sequence
The polynucleotide sequence of CRISPR compound and target sequence specific binding.In some embodiments, sgRNA packet of the invention
Including has about 100%, about 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91% with the sequence specifically enumerated,
90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 75%, 70%, 65%, 60%,
55% or 50% identity, but the sequence that CRISPR compound and target sequence still can be instructed to specifically bind.
In some embodiments, can using be shorter in length than 20nt sgRNA (such as 17~18nt " truncate
SgRNA ") without influencing its activity, and risk of missing the target can be can significantly reduce.In some embodiments, it can use shorter
SgRNA, such as the sgRNA of 17,18,19nt.
In some embodiments, the difference in site occurs for different genetic diseases, it can be for corresponding mutation position
Point carries out the sgRNA sequence design of surrounding, to guarantee the targeting and high efficiency of whole gene editor's composition.
2. the extension sequence of the recognition site containing nucleic acid binding protein
In some embodiments, described to prolong using the extension sequence specifically bound with nucleic acid binding protein on sgRNA
Long sequence can interact with nucleic acid binding protein such as MS2 albumen, so that nucleic acid binding protein such as MS2 albumen is recruited,
And due to such as MS2 albumen of the nucleic acid binding protein in embodiment with promote homologous recombination albumen be connected such as RecA albumen
Fusion protein, therefore a large amount of albumen for promoting homologous recombination such as RecA albumen are enriched near sgRNA recognition site, thus
Increase homologous recombination efficiency.
In some embodiments, the identification sequence of nucleic acid binding protein MS2 could alternatively be, RPA-4 subunit, BRCA2,
The identification sequence of the rna binding proteins such as XRCC2, XRCC3, it is desirable that while being substituted for the nucleic acid binding protein MS2 in component
RPA-4 subunit, BRCA2, XRCC2, the corresponding rna binding protein such as XRCC3 are merged with homologous recombination protein.In some embodiment party
In case, it is preferred to use MS2 sequence and MS2 albumen.
3. homologous recombination repair template
In some embodiments, homologous complementary recovery template is additionally provided.Homologous complementary recovery template can be such as this
Another individual single stranded DNA component described in text is perhaps provided as an individual double-stranded DNA component or offer one
The carrier comprising target sequence of single copy or multicopy.
In some embodiments, homologous complementary recovery template is designed to be used as the template in homologous recombination, such as exists
Within the target sequence opened or cut by the CRISPR digestion of a part as CRISPR compound or in its vicinity.In some realities
It applies in scheme, the length of homologous complementary recovery template can be between such as 100bp-10kb, such as 100bp, 120bp,
150bp, 180bp, 200bp, 300bp, 400bp, 500bp, 600bp, 700bp, 800bp, 900bp, 1kb, 2kb, 3kb, 4kb,
The length of 5kb, 6kb, 7kb, 8kb, 9kb, 10kb or any therebetween.In some embodiments, 100bp- can preferably be used
The template of 500bp, such as the homologous repairing sequence of 100bp and 120bp.
4.CRISPR enzyme
In some embodiments, the present invention relates to CRISPR enzymes, such as Cas9.In some embodiments, of the invention
Be related to nuclease such as Cas9, it includes at least one nuclear localization signal, at least one nuclease domain and at least one with
SgRNA interaction is with the structural domain for the specific nucleotide sequences for being used to shear by nuclease targeting.In some embodiments
In, the nuclease can lack at least one functional nucleic acid enzyme domains through modification.In some embodiments, this hair
It is bright to be related to nucleic acid, encode nuclease of the present invention.In some embodiments, the nucleic acid is directed to mammalian cell
In translation carry out codon optimization.In some embodiments, the nucleic acid is to carry out codon for translation in people's cell
Coded sequence after optimization.In some embodiments, the nucleic acid for encoding the enzyme is operably connected with promoter sequence.
5.Cas9, sgRNA carrier and delivery system
In some embodiments, provided herein is sgRNA carriers.SgRNA carrier includes that can be transcribed into sgRNA sequence
Polynucleotides, the sgRNA sequence can edit target gene.
In some embodiments, the carrier is plasmid vector.In some embodiments, the carrier can be disease
Poisonous carrier, such as slow virus or baculoviral or preferably adenovirus/adeno-associated virus (AAV) carrier.
In some embodiments, the carrier includes but is not limited to single-stranded, double-strand or partially double stranded nucleic acid molecules,
Nucleic acid molecules including DNA, RNA, or both.In some embodiments, the carrier is viral vectors, for example, reverse transcription
The carrier of virus, replication defect type retrovirus, adenovirus, replication-defective adenoviral and adeno-associated virus.Some
In embodiment, the carrier includes the one or more expression and adjusting member for being directed to the host cell for expression and selecting
Part, the expression and regulating element are operably coupled to nucleic acid sequence to be expressed such as sgRNA.The expression and regulating element
Including promoter, enhancer, internal ribosome entry site and other expression control elements (such as transcription stop signals, it is such as more
Polyadenylation signal and poly U sequence).In some embodiments, provided herein is the bicistronic mRNAs for sgRNA and Cas9
Carrier.In some embodiments, sgRNA and Cas9 can be started by different promoters.
In some embodiments, carrier may be designed for expressing CRISPR transcription in protokaryon or eukaryotic
Object or translation object (such as transcribed nucleic acid object, protein or enzyme).In some embodiments, using mammalian expression vector,
Carrier can drive one or more sequences to express in mammalian cells.In some embodiments, recombinant mammalian
Expression vector can instruct nucleic acid preferentially to express in particular cell types (for example, carrying out table using organizing specific type regulating element
Up to nucleic acid).Organizing specific type regulating element is as known in the art.In some embodiments, CRISPR system will be driven
One or more carriers of expression of one or more elements be introduced into host cell so that these of the CRISPR system
The formation of CRISPR compound is instructed in the expression of element in one or more target sites.In some embodiments, a carrier
Comprising one or more insertion points, two or more sgRNA can be inserted.
In some embodiments, provided herein is separation or reorganization body polynucleotides, it includes the RNA of coding sgRNA or
The various components of DNA sequence dna, sgRNA carrier.Polynucleotides can be RNA or DNA, they can be it is single-stranded or double-stranded, optionally
Ground includes synthesis, non-natural or modified nucleotide base.Polynucleotides of the present invention include but is not limited to single-stranded shape
Formula, double-stranded form, hairpin structure, loop-stem structure etc..Additionally provide the recombination multicore glycosides comprising sgRNA carrier and its different component
Acid.In some embodiments, recombinant vector may include the regulating and controlling sequence and coded sequence from separate sources, or derive from
Identical source but by be different from it is naturally occurring in a manner of the regulating and controlling sequence and coded sequence that arrange.The carrier can be used alone or
It is applied in combination with carrier.
In some embodiments, one or more sgRNA carrier as described herein can be provided in the form of expression cassette
It is expressed in different cell types.The expression cassette may include 5 ' and 3 ' regulating and controlling sequences, operationally with multicore provided herein
Thuja acid connection.
6. the method imported
In some embodiments, a variety of methods are provided, sgRNA carrier and corresponding whole components is imported into cell.It mentions herein
For method transfected using the mode of electroporation.In some embodiments, electricity can be used for the transfection in body to wear
Hole and the united mode of liposome transfection, but rotaring transfecting mode is not limited to ad hoc approach, as long as polynucleotides is made to enter host extremely
The inside of a few cell.The method that polynucleotides are imported in host cell is known in the art, including but unlimited
In virus-mediated method.Importing includes referring to nucleic acid integration into eukaryon or prokaryotic cell, can be integrated in the cell amplifying nucleic acid
Nucleic acid or albumen are supplied to cell into the genome of cell, and including referring to.In some embodiments, disease can be used
Poisonous carrier, such as slow virus or baculoviral or preferably adenovirus/adeno-associated virus (AAV) carrier is imported.In some implementations
In scheme, other delivery systems can be used, as Yeast system, microcapsule bubble, particle gun/by carrier are attached to gold nanoparticle
On.In the carrier, sgRNA or coding DNA can be operably connected to a promoter, and delivery of nucleic acids is instructed to arrive
In host cell.It in some embodiments, can be by micro-injection directly by the vector administration to subject.Some
In embodiment, such as plasmid mixture can be injected into subject's subretinal space, by extra electric field so that DNA into
Enter in the rod cell of electroporation, to complete the transfection of photoreceptor cell.
7. composition and/or kit
Provided herein is the method for using sgRNA and composition and/or kit comprising sgRNA are provided, the sgRNA works as
When introducing cell gene editing can be carried out to target gene.
SgRNA of the invention, carrier, cell can be used in pharmaceutical preparation and composition, also be can be prepared into and be facilitated application
Kit.Suitably, the compositions or agents box include medicinal solvent, such as water or salt water, diluent, carrier, salt or
Adjuvant.
The invention also includes the pharmaceutical compositions and preparation that contain nucleotide of the invention.Pharmaceutical composition of the invention can
To be used to treat disease, such as gene therapy.
In some embodiments, composition and/or kit provided herein include:
1) polynucleotide sequence and nucleic acid binding protein connected to it for encoding sgRNA identify sequence, and wherein this is more
Nucleotide sequence includes one or more sgRNA, which can hybridize on the target sequence in eukaryocyte, amplifying nucleic acid
Binding protein recognition sequence can recruit corresponding nucleic acid binding protein enrichment,
2) polynucleotide sequence of CRISPR enzyme is encoded,
3) encoding homologous recombinant protein and coding with 1) in component corresponding nucleic acid binding protein formation fusion egg
White polynucleotide sequence, wherein encoding homologous recombinant protein can be the homologous recombination protein of protokaryon or eukaryotic source, can be with
For one or more homologous recombination proteins, and
4) polynucleotide sequence of homologous reparation, wherein the polynucleotide sequence includes the sequence in site near target sequence,
And the site being mutated in genetic disease should be repaired as required sequence.
In transcription, which guides CRISPR compound in conjunction with the sequence-specific of the target sequence, wherein should
CRISPR compound includes and sgRNA the and CRISPR enzyme that hybridizes on the target sequence.
In some embodiments, composition and/or kit provided herein include nuclease or its coded sequence,
SgRNA, homologous complementary recovery template, nucleic acid binding protein such as MS2 or its coded sequence and the albumen of promotion homologous recombination are such as
RecA fusion protein or its coded sequence.In some embodiments, the sgRNA can have specific RNA hairpin structure.?
In some embodiments, for example, introducing the RNA hair clip such as MS2 hair that nucleic acid binding protein can be specifically bound in sgRNA
Folder, this kind of hairpin structure can be by nucleic acid binding protein such as MS2 binding protein institute specific recognition.In some embodiments, core
Acid binding protein specific recognition and the nucleic acid sequence of combination and sgRNA are covalently attached.Composition and/or reagent provided herein
Box includes the artificial synthesized single-stranded DNA sequence of pde6b normal sequence.In some embodiments, the polynucleotides are included in
In carrier system containing one or more carriers.
6. application method
In some embodiments, provided herein is the methods for the treatment of retinitis pigmentosa, and the method includes to cell
The sgRNA sequence, the DNA sequence dna and/or the carrier are introduced, and cultivates the cell and makes sgRNA by nuclease
It is directed to target gene.In some embodiments, method of the invention restores the expression of target gene, thus treats pigmentosa view
Film is scorching.In some embodiments, the present invention provides the method adjusted as restored mutation pde6b gene expression.In some implementations
In scheme, method provided herein includes: offer 1) polynucleotide sequence of coding sgRNA, the wherein polynucleotide sequence packet
Can be hybridized on target sequence containing one or more sgRNA, the sgRNA, 2) coding CRISPR enzyme polynucleotide sequence, should
CRISPR enzyme optionally includes at least one or more nuclear localization sequence.In transcription, sgRNA guides CRISPR compound and target
The sequence-specific of sequence combines, and wherein the CRISPR compound includes and sgRNA the and CRISPR enzyme that hybridizes on target sequence.
In some embodiments, the polynucleotide sequence for encoding CRISPR enzyme is DNA or RNA.In some embodiments, it encodes
The polynucleotide sequence of CRISPR enzyme, sgRNA any one or all can be RNA.In some embodiments, CRISPR is encoded
The sequence of enzyme, sgRNA can be RNA and can be delivered via liposome, nanoparticle, microcapsule bubble or particle gun.?
In some embodiments, method provided herein is (invivo), external (in vitro) and/or in vitro (ex in vivo
Vivo it carries out).In some embodiments, the method includes inducing expressions.In some embodiments, the carrier
It is viral vectors, including AAV or slow virus carrier.In some embodiments, the CRISPR enzyme is Cas9.
In some embodiments, the method comprise the steps that
1) (i) at least one CRISPR enzyme comprising at least one nuclear localization signal is introduced to cell or coding is at least one
The nucleic acid of CRISPR enzyme comprising at least one nuclear localization signal, RNA of at least one sgRNA of (ii) at least one coding or
DNA, and
2) cultivating the cell makes sgRNA that CRISPR enzyme is directed to the target site in chromosome sequence, wherein described
Fracture is introduced the target site by CRISPR enzyme, and the fracture is repaired by DNA repair process so that the chromosome sequence
It is modified.In some embodiments, the CRISPR enzyme comes from Cas9.In some embodiments, the CRISPR enzyme is
The enzyme of modification e.g. generates the mutant of single incision.In some embodiments, the nucleic acid for encoding the CRISPR enzyme is
mRNA.In some embodiments, the nucleic acid for encoding the CRISPR enzyme is DNA.In some embodiments, the DNA is
A part of carrier, the carrier further include the sequence of coding sgRNA.In some embodiments, the cell includes
Eukaryocyte, such as people's cell and nonhuman mammalian cells, stem cell.In some embodiments, subject includes that lactation is dynamic
Object, such as people, monkey, horse, ox, dog, cat, mouse, rat and pig etc..
Embodiment 1 designs the sgRNA with MS2 targeting hairpin structure for carrying selectively targeted pde6b gene
For a nonsense mutation (TAC → TAA) on the 7th exon that body repairs pde6b, and to a certain degree
On functional rehabilitation, selectively targeted pde6b gene (Genbank NC_000071.6) is designed near this mutational site
SgRNA, the sgRNA particular sequence are SEQ ID NO 2.
Embodiment 2 designs homologous complementary recovery template, and template selects the single stranded DNA mould of mutational site pde6b normal sequence
Plate, particular sequence are SEQ ID NO 5.
Embodiment 3 constructs targeting MS2-recA fusion protein, and particular sequence is SEQ ID NO 10.
The building breeding fluorescent reporter gene mouse of embodiment 4 system
Apoptosis can occur for rd1 mouse rod cell, in order to intuitively observe the generation of this process, use Nrl- in experiment
EGFP mouse is (referring to 2006, PNAS, Targeting ofGFP to newbornrods by Nrl promoter and
Temporal expression profiling of flow-sortedphotoreceptors) come to complete in Mouse Retina
Portion's rod cell is marked, and after two kinds of mouse are hybridized, then with resulting F1 generation goes backcrossing rd1 mouse (rd1 mouse is
The existing gene mutation of nature Central Plains hair tonic, is widely used in the research of RP, referring to Invest Ophthalmol Vis
Sci.2006, Genotype-phenotype correlation of mouse pde6b mutations.MolecularVi
sion.2014Different effects of valproic acid on photoreceptor loss in Rd1and
Rd10retinal degeneration mice.), screening rd1 gene mutation is homozygous, and has the mouse conduct of Nrl-eGFP
The case where female parent of subsequent experimental, observation mouse post-coitum generates vaginal plug, and select to carry out after the birth of P0 or P3 young rat
Body reparative experiment.
Embodiment 5 is in body electroporation transfection mouse photoreceptor cell
SpCas9 expression vector plasmid (plasmid map is referring to attached drawing 14) is transferred in experimental group, and (final concentration 3-5ug/ul is left
It is right), carry sgRNA the and MS2-recA fusion protein with MS2 targeting hairpin structure of selectively targeted pde6b gene
Expression vector plasmid (plasmid map is referring to attached drawing 15) (final concentration 3-5ug/ul or so), homologous recovery template (50uM)；Control
The band for being transferred to spCas9 expression vector plasmid (final concentration 3-5ug/ul or so) in group, carrying selectively targeted pde6b gene
There is MS2 to target the expression vector plasmid (final concentration 3-5ug/ul or so) of the sgRNA and MS2 albumen of hairpin structure, homologous reparation
Template (50uM).Plasmid mixture is injected into Mouse Retina cavity of resorption, by additional by Hamilton micro-injection needle by experiment
Electric field carries out 80V, 1Hz, the unidirectional electric pulse of duty ratio 5%, so that electronegative DNA enters in the rod cell of electroporation
(Fig. 2), to complete the transfection of photoreceptor cell.
The pigmentosa retina mouse of embodiment 6 repairs situation detection in body
1) genomic level detect: experimental group and control group mice are raised to P31 days, execution mouse win eyeball and
It is laid in PBS after removing entire retina under Stereo microscope, the rod cell of green is drawn using glass electrode, and will
20-30 cell carries out few cellular genome and extracts after collecting, carrying out the digestion of DdeI to genome, (DdeI can dash forward rdl
Cut at the site of change) processing after (Fig. 3), for repair site around carry out PCR amplification restoring area, send sequencing analysis
Effect (Fig. 4).
2) transcriptional level detects: experimental group and control group mice being raised to P31 days, mouse is put to death and wins eyeball and in body
It is laid in PBS after removing entire retina under formula microscope, the rod cell of green is drawn using glass electrode, and by 20-
30 cells carry out the unicellular reverse transcription (referring to smart seq2) of single hose after collecting, and to obtained cDNA for prominent
The cDNA for becoming location proximate carries out PCR, after PCR product is carried out DdeI digestion processing, carries out secondary PCR (Fig. 3) and send sequencing
Analytical effect (Fig. 5).
3) protein level detects: experimental group and control group mice being raised to P21 days, mouse is put to death and wins eyeball and in body
Entire retina is removed under formula microscope, and cracks retina and obtains retina total protein progress western blot, and detection is repaired
Whether complete pde6b protein expression (Fig. 6) is had in diplopia nethike embrane.
4) morphologic detection: experimental group and control group mice were raised to P31 days, were put to death mouse and were put into after winning eyeball
2 hours or more are fixed in 4%PFA, are cut off after eyeball peels off cornea, crystalline lens and are dehydrated under Stereo microscope after being cleaned with PBS
And frozen section is carried out, the rod cell residual amount of observation green fluorescence label simultaneously counts.Retinal slice is immunized
Histochemical staining marks the form and quantity (Fig. 7, Fig. 8) of blue and green cone cell using the antibody of sw/mwOpn.
5) physiological level detects: experimental group and control group mice being raised to P14 days, mouse is put to death and wins eyeball and in body
It is laid in PBS after removing entire retina under formula microscope, after AP5, CNQX and DL-AP4 processing is added, utilizes electro physiology system
System record isolated retina electrograph (Fig. 9).
6) behavior level detects: experimental group and control group mice being raised to P31 days, the good cranium of mouse head heeling-in is followed closely
Afterwards, mention the previous day starts dark adaptation at night, adapt to second day 10 points start to carry out flash ranging machine and video record mouse to mouse
The size of pupil carries out pupil light reflex measurement (Figure 10).
In conclusion the gene editing composition that the present invention uses efficiently is realized in body colour disposition retina mouse
The reparation of nonsense mutation (TAC → TAA) on 7th exon of pde6b gene.Experimental mice is by increasing homologous recombination
Efficiency is developed to the rod cell for having remained about 6 times of quantity for P31 days, while but also cone cell relative to control group mice
Residual increases about 4 times (Fig. 9)；Sequencing result is found, is detected on gene level and transcriptional level really in reparation group sample
The sequence of the normal pde6b occurred；Western b1ot's the result shows that expressing the pde6b of a small amount of normal size in reparation group
Albumen；The result of isolated retina electrograph also shows that the photoreceptor cell of reparation group mouse has certain sensitization function,
And control group mice absolutely not sensitization function；The behaviouristics of pupil light reflex goes out as the result is shown, and control group mice is for flash of light
There is no reactions for stimulation, and experimental mice whole animal has certain photoperceptivity, light stimulus can be generated obvious
Pupillary light reflex behavior.
The Applicant declares that the present invention is explained by the above embodiments method detailed of the invention, but the present invention not office
Be limited to above-mentioned method detailed, that is, do not mean that the invention must rely on the above detailed methods to implement.Technical field
Technical staff it will be clearly understood that any improvement in the present invention, equivalence replacement and auxiliary element to each raw material of product of the present invention
Addition, selection of concrete mode etc., all of which fall within the scope of protection and disclosure of the present invention.
Sequence table
The pde6b gene location of sgRNA targeting SEQ ID NO:l of the invention
GCTGATCACTGGGCCCTGG
SgRNA sequence (underscore PAM) SEQ ID NO:2 of the invention
CCAGGGCCCAGUGAUCAGCCGG
The hairpin that the identification of SEQ ID NO:3MS2 protein-specific combines
GCCAACAUGAGGAUCACCCAUGUCUGCAGGGCC
The 7th exon sequence of SEQ ID NO:4pde6b gene (sequence is A at rd1 mouse underscore)
CACACCCCCGGCTGATCACTGGGCCCTGGCCAGTGGCCTTCCAACCTACGTAGCAGAAAGTGGCTTT
SEQ ID NO:5 template DNA sequence
CTTTTCCCACAGCACACCCCCGGCTGATCACTGGGCCCTGGCCAGTGGCCTTCCAACCTACGTAGCAGA
AAGTGGCTTTGTGAGTGTCCCTCTCCAGGCCTTGGCCTCTACTGGCCAGTG
SEQ ID NO:6MS2 coded sequence
ATGGCTTCAAACTTTACTCAGTTCGTGCTCGTGGACAATGGTGGGACAGGGGATGTGACAGTGGCTCC
TTCTAATTTCGCTAATGGGGTGGCAGAGTGGATCAGCTCCAACTCACGGAGCCAGGCCTACAAGGTGACATGCAGC
GTCAGGCAGTCTAGTGCCCAGAAgAGAAAGTATACCATCAAGGTGGAGGTCCCCAAAGTGGCTACCCAGACAGTGG
GCGGAGTCGAACTGCCTGTCGCCGCTTGGAGGTCC
SEQ ID NO:7RecA coded sequence
TACCTGAACATGGAGCTCACTATCCCAATTTTCGCTACCAATTCTGACTGTGAACTCATCGTGAAGGC
AATGCAGGGGCTCCTCAAAGACGGTAATCCTATCCCTTCCGCCATCGCCGCTAACTCAGGTATCTACagcgctGGA
GGAGGTGGAAGCGGAGGAGGAGGAAGCGGAGGAGGAGGTAGCggacctaagaaaaagaggaaggtggcggccgctg
GATCTATGGTCCCAAAAAAGAAAAGGAAGGTGGCTATTGACGAGAACAAACAGAAAGCACTGGCAGCAGCACTGGG
GCAGATTGAGAAACAGTTCGGGAAGGGATCCATTATGAGGCTGGGGGAAGACCGCTCAATGGATGTGGAGACTATC
AGCACCGGATCTCTGAGTCTGGACATTGCTCTGGGAGCAGGAGGACTGCCAATGGGACGAATCGTGGAAATCTACG
GACCTGAGAGCTCCGGCAAGACCACACTGACCCTGCAGGTCATCGCCGCTGCACAGAGAGAGGGCAAAACATGCGC
CTTCATCGACGCCGAACACGCTCTGGATCCAATCTACGCTAGGAAGCTGGGCGTGGACATCGATAACCTGCTGTGC
TCTCAGCCCGACACTGGGGAACAGGCCCTGGAGATTTGTGATGCACTGGCTAGGTCCGGAGCTGTGGACGTGATCG
TGGTCGATTCTGTGGCCGCTCTGACCCCCAAAGCCGAGATCGAAGGGGAGATTGGAGACAGTCATATGGGCCTGGC
AGCCCGAATGATGTCACAGGCAATGCGGAAGCTGGCCGGCAACCTGAAACAGAGCAATACACTGCTGATCTTCATT
AACCAGATCCGCATGAAGATTGGCGTGATGTTTGGGAACCCCGAGACTACCACAGGAGGCAATGCTCTGAAGTTCT
ACGCAAGCGTGCGCCTGGACATCCGGAGAATTGGGGCCGTCAAAGAAGGAGAGAACGTGGTCGGCTCCGAGACCCG
AGTGAAGGTGGTCAAGAACAAGATCGCTGCACCTTTCAAACAGGCCGAATTTCAGATCCTGTACGGCGAGGGCATC
AACTTCTACGGGGAACTGGTGGACCTGGGAGTCAAGGAAAAACTGATTGAGAAGGCAGGAGCCTGGTACTCTTATA
AGGGCGAGAAAATCGGACAGGGCAAAGCTAACGCAACAGCCTGGCTGAAGGATAATCCTGAGACTGCCAAAGAAAT
CGAGAAGAAAGTGAGAGAACTGCTGCTGAGTAACCCAAATTCAACCCCCGATTTTTCAGTGGATGATTCCGAAGGC
GTCGCAGAGACTAATGAGGATTTTAGCCCCAAGAAGAAGAGAAAGGTGGAGGCCAGCGCTAGCAg
SEQ ID NO:8EFla promoter sequence
AATTCctagcgtgcccgtcagtgggcagagcgcacatcgcccacagtccccgagaagttggggggagg
ggtcggcaattgaaccggtgcctagagaaggtggcgcggggtaaactgggaaagtgatgtcgtgtactggctccgc
ctttttcccgagggtgggggagaaccgtatataagtgcagtagtcgccgtgaacgttctttttcgcaacgggtttg
ccgccagaacacaggtaagtgccgtgtgtggttcccgcgggcctggcctctttacgggttatggcccttgcgtgcc
ttgaattacttccacctggctgcagtacgtgattcttgatcccgagcttcgggttggaagtgggtgggagagttcg
aggccttgcgcttaaggagccccttcgcctcgtgcttgagttgaggcctggcctgggcgctggggccgccgcgtgc
gaatctggtggcaccttcgcgcctgtctcgctgctttcgataagtctctagccatttaaaatttttgatgacctgc
tgcgacgctttttttctggcaagatagtcttgtaaatgcgggccaagatctgcacactggtatttcggtttttggg
gccgcgggcggcgacggggcccgtgcgtcccagcgcacatgttcggcgaggcggggcctgcgagcgcggccaccga
gaatcggacgggggtagtctcaagctggccggcctgctctggtgcctggcctcgcgccgccgtgtatcgccccgcc
ctgggcggcaaggctggcccggtcggcaccagttgcgtgagcggaaagatggccgcttcccggccctgctgcaggg
agctcaaaatggaggacgcggcgctcgggagagcgggcgggtgagtcacccacacaaaggaaaagggcctttccgt
cctcagccgtcgcttcatgtgactccacggagtaccgggcgccgtccaggcacctcgattagttctcgagcttttg
gagtacgtcgtctttaggttggggggaggggttttatgcgatggagtttccccacactgagtgggtggagactgaa
gttaggccagcttggcacttgatgtaattctccttggaatttgccctttttgagtttggatcttggttcattctca
agcctcagacagtggttcaaagtttttttcttccatttcaggtgtcgtgaggtgtcgtgagcgCc
SEQ ID NO:9polyA sequence
Atcttagccactttctagagtcggggcggccggccgcttcgagcagacatgataagatacattgatga
gtttggacaaaccacaactagaatgcagtgaaaaaaatgctttatttgtgaaatttgtgatgctattgctttattt
gtaaccattataagctgcaataaacaagttaacaacaacaattgcattcattttatgtttcaggttcagggggagg
tgtgggaggttttttaaagcaagtaaaacctctacaaatgtggtaaaatcgataaggatccg
SEQ ID NO:10MS2-RecA complete sequence
AATTCctagcgtgcccgtcagtgggcagagcgcacatcgcccacagtccccgagaagttggggggagg
ggtcggcaattgaaccggtgcctagagaaggtggcgcggggtaaactgggaaagtgatgtcgtgtactggctccgc
ctttttcccgagggtgggggagaaccgtatataagtgcagtagtcgccgtgaacgttctttttcgcaacgggtttg
ccgccagaacacaggtaagtgccgtgtgtggttcccgcgggcctggcctctttacgggttatggcccttgcgtgcc
ttgaattacttccacctggctgcagtacgtgattcttgatcccgagcttcgggttggaagtgggtgggagagttcg
aggccttgcgcttaaggagccccttcgcctcgtgcttgagttgaggcctggcctgggcgctggggccgccgcgtgc
gaatctggtggcaccttcgcgcctgtctcgctgctttcgataagtctctagccatttaaaatttttgatgacctgc
tgcgacgctttttttctggcaagatagtcttgtaaatgcgggccaagatctgcacactggtatttcggtttttggg
gccgcgggcggcgacggggcccgtgcgtcccagcgcacatgttcggcgaggcggggcctgcgagcgcggccaccga
gaatcggacgggggtagtctcaagctggccggcctgctctggtgcctggcctcgcgccgccgtgtatcgccccgcc
ctgggcggcaaggctggcccggtcggcaccagttgcgtgagcggaaagatggccgcttcccggccctgctgcaggg
agctcaaaatggaggacgcggcgctcgggagagcgggcgggtgagtcacccacacaaaggaaaagggcctttccgt
cctcagccgtcgcttcatgtgactccacggagtaccgggcgccgtccaggcacctcgattagttctcgagcttttg
gagtacgtcgtctttaggttggggggaggggttttatgcgatggagtttccccacactgagtgggtggagactgaa
gttaggccagcttggcacttgatgtaattctccttggaatttgccctttttgagtttggatcttggttcattctca
agcctcagacagtggttcaaagtttttttcttccatttcaggtgtcgtgaggtgtcgtgagcgCcATGGCTTCAAA
CTTTACTCAGTTCGTGCTCGTGGACAATGGTGGGACAGGGGATGTGACAGTGGCTCCTTCTAATTTCGCTAATGGG
GTGGCAGAGTGGATCAGCTCCAACTCACGGAGCCAGGCCTACAAGGTGACATGCAGCGTCAGGCAGTCTAGTGCCC
AGAAgAGAAAGTATACCATCAAGGTGGAGGTCCCCAAAGTGGCTACCCAGACAGTGGGCGGAGTCGAACTGCCTGT
CGCCGCTTGGAGGTCCTACCTGAACATGGAGCTCACTATCCCAATTTTCGCTACCAATTCTGACTGTGAACTCATC
GTGAAGGCAATGCAGGGGCTCCTCAAAGACGGTAATCCTATCCCTTCCGCCATCGCCGCTAACTCAGGTATCTACa
gcgctGGAGGAGGTGGAAGCGGAGGAGGAGGAAGCGGAGGAGGAGGTAGCggacctaagaaaaagaggaaggtggc
ggccgctgGATCTATGGTCCCAAAAAAGAAAAGGAAGGTGGCTATTGACGAGAACAAACAGAAAGCACTGGCAGCA
GCACTGGGGCAGATTGAGAAACAGTTCGGGAAGGGATCCATTATGAGGCTGGGGGAAGACCGCTCAATGGATGTGG
AGACTATCAGCACCGGATCTCTGAGTCTGGACATTGCTCTGGGAGCAGGAGGACTGCCAATGGGACGAATCGTGGA
AATCTACGGACCTGAGAGCTCCGGCAAGACCACACTGACCCTGCAGGTCATCGCCGCTGCACAGAGAGAGGGCAAA
ACATGCGCCTTCATCGACGCCGAACACGCTCTGGATCCAATCTACGCTAGGAAGCTGGGCGTGGACATCGATAACC
TGCTGTGCTCTCAGCCCGACACTGGGGAACAGGCCCTGGAGATTTGTGATGCACTGGCTAGGTCCGGAGCTGTGGA
CGTGATCGTGGTCGATTCTGTGGCCGCTCTGACCCCCAAAGCCGAGATCGAAGGGGAGATTGGAGACAGTCATATG
GGCCTGGCAGCCCGAATGATGTCACAGGCAATGCGGAAGCTGGCCGGCAACCTGAAACAGAGCAATACACTGCTGA
TCTTCATTAACCAGATCCGCATGAAGATTGGCGTGATGTTTGGGAACCCCGAGACTACCACAGGAGGCAATGCTCT
GAAGTTCTACGCAAGCGTGCGCCTGGACATCCGGAGAATTGGGGCCGTCAAAGAAGGAGAGAACGTGGTCGGCTCC
GAGACCCGAGTGAAGGTGGTCAAGAACAAGATCGCTGCACCTTTCAAACAGGCCGAATTTCAGATCCTGTACGGCG
AGGGCATCAACTTCTACGGGGAACTGGTGGACCTGGGAGTCAAGGAAAAACTGATTGAGAAGGCAGGAGCCTGGTA
CTCTTATAAGGGCGAGAAAATCGGACAGGGCAAAGCTAACGCAACAGCCTGGCTGAAGGATAATCCTGAGACTGCC
AAAGAAATCGAGAAGAAAGTGAGAGAACTGCTGCTGAGTAACCCAAATTCAACCCCCGATTTTTCAGTGGATGATT
CCGAAGGCGTCGCAGAGACTAATGAGGATTTTAGCCCCAAGAAGAAGAGAAAGGTGGAGGCCAGCGCTAGCAgatc
ttagccactttctagagtcggggcggccggccgcttcgagcagacatgataagatacattgatgagtttggacaaa
ccacaactagaatgcagtgaaaaaaatgctttatttgtgaaatttgtgatgctattgctttatttgtaaccattat
aagctgcaataaacaagttaacaacaacaattgcattcattttatgtttcaggttcagggggaggtgtgggaggtt
ttttaaagcaagtaaaacctctacaaatgtggtaaaatcgataaggatccg
SEQ ID NO:ll SpCas9 coded sequence
GACAAGAAGTACAGCATCGGCCTGGACATCGGCACCAACTCTGTGGGCTGGGCCGTGATCACCGACGAG
TACAAGGTGCCCAGCAAGAAATTCAAGGTGCTGGGCAACACCGACCGGCACAGCATCAAGAAGAACCTGATCGGAGC
CCTGCTGTTCGACAGCGGCGAAACAGCCGAGGCCACCCGGCTGAAGAGAACCGCCAGAAGAAGATACACCAGACGGA
AGAACCGGATCTGCTATCTGCAAGAGATCTTCAGCAACGAGATGGCCAAGGTGGACGACAGCTTCTTCCACAGACTG
GAAGAGTCCTTCCTGGTGGAAGAGGATAAGAAGCACGAGCGGCACCCCATCTTCGGCAACATCGTGGACGAGGTGGC
CTACCACGAGAAGTACCCCACCATCTACCACCTGAGAAAGAAACTGGTGGACAGCACCGACAAGGCCGACCTGCGGC
TGATCTATCTGGCCCTGGCCCACATGATCAAGTTCCGGGGCCACTTCCTGATCGAGGGCGACCTGAACCCCGACAAC
AGCGACGTGGACAAGCTGTTCATCCAGCTGGTGCAGACCTACAACCAGCTGTTCGAGGAAAACCCCATCAACGCCAG
CGGCGTGGACGCCAAGGCCATCCTGTCTGCCAGACTGAGCAAGAGCAGACGGCTGGAAAATCTGATCGCCCAGCTGC
CCGGCGAGAAGAAGAATGGCCTGTTCGGAAACCTGATTGCCCTGAGCCTGGGCCTGACCCCCAACTTCAAGAGCAAC
TTCGACCTGGCCGAGGATGCCAAACTGCAGCTGAGCAAGGACACCTACGACGACGACCTGGACAACCTGCTGGCCCA
GATCGGCGACCAGTACGCCGACCTGTTTCTGGCCGCCAAGAACCTGTCCGACGCCATCCTGCTGAGCGACATCCTGA
GAGTGAACACCGAGATCACCAAGGCCCCCCTGAGCGCCTCTATGATCAAGAGATACGACGAGCACCACCAGGACCTG
ACCCTGCTGAAAGCTCTCGTGCGGCAGCAGCTGCCTGAGAAGTACAAAGAGATTTTCTTCGACCAGAGCAAGAACGG
CTACGCCGGCTACATTGACGGCGGAGCCAGCCAGGAAGAGTTCTACAAGTTCATCAAGCCCATCCTGGAAAAGATGG
ACGGCACCGAGGAACTGCTCGTGAAGCTGAACAGAGAGGACCTGCTGCGGAAGCAGCGGACCTTCGACAACGGCAGC
ATCCCCCACCAGATCCACCTGGGAGAGCTGCACGCCATTCTGCGGCGGCAGGAAGATTTTTACCCATTCCTGAAGGA
CAACCGGGAAAAGATCGAGAAGATCCTGACCTTCCGCATCCCCTACTACGTGGGCCCTCTGGCCAGGGGAAACAGCA
GATTCGCCTGGATGACCAGAAAGAGCGAGGAAACCATCACCCCCTGGAACTTCGAGGAAGTGGTGGACAAGGGCGCT
TCCGCCCAGAGCTTCATCGAGCGGATGACCAACTTCGATAAGAACCTGCCCAACGAGAAGGTGCTGCCCAAGCACAG
CCTGCTGTACGAGTACTTCACCGTGTATAACGAGCTGACCAAAGTGAAATACGTGACCGAGGGAATGAGAAAGCCCG
CCTTCCTGAGCGGCGAGCAGAAAAAGGCCATCGTGGACCTGCTGTTCAAGACCAACCGGAAAGTGACCGTGAAGCAG
CTGAAAGAGGACTACTTCAAGAAAATCGAGTGCTTCGACTCCGTGGAAATCTCCGGCGTGGAAGATCGGTTCAACGC
CTCCCTGGGCACATACCACGATCTGCTGAAAATTATCAAGGACAAGGACTTCCTGGACAATGAGGAAAACGAGGACA
TTCTGGAAGATATCGTGCTGACCCTGACACTGTTTGAGGACAGAGAGATGATCGAGGAACGGCTGAAAACCTATGCC
CACCTGTTCGACGACAAAGTGATGAAGCAGCTGAAGCGGCGGAGATACACCGGCTGGGGCAGGCTGAGCCGGAAGCT
GATCAACGGCATCCGGGACAAGCAGTCCGGCAAGACAATCCTGGATTTCCTGAAGTCCGACGGCTTCGCCAACAGAA
ACTTCATGCAGCTGATCCACGACGACAGCCTGACCTTTAAAGAGGACATCCAGAAAGCCCAGGTGTCCGGCCAGGGC
GATAGCCTGCACGAGCACATTGCCAATCTGGCCGGCAGCCCCGCCATTAAGAAGGGCATCCTGCAGACAGTGAAGGT
GGTGGACGAGCTCGTGAAAGTGATGGGCCGGCACAAGCCCGAGAACATCGTGATCGAAATGGCCAGAGAGAACCAGA
CCACCCAGAAGGGACAGAAGAACAGCCGCGAGAGAATGAAGCGGATCGAAGAGGGCATCAAAGAGCTGGGCAGCCAG
ATCCTGAAAGAACACCCCGTGGAAAACACCCAGCTGCAGAACGAGAAGCTGTACCTGTACTACCTGCAGAATGGGCG
GGATATGTACGTGGACCAGGAACTGGACATCAACCGGCTGTCCGACTACGATGTGGACCATATCGTGCCTCAGAGCT
TTCTGAAGGACGACTCCATCGACAACAAGGTGCTGACCAGAAGCGACAAGAACCGGGGCAAGAGCGACAACGTGCCC
TCCGAAGAGGTCGTGAAGAAGATGAAGAACTACTGGCGGCAGCTGCTGAACGCCAAGCTGATTACCCAGAGAAAGTT
CGACAATCTGACCAAGGCCGAGAGAGGCGGCCTGAGCGAACTGGATAAGGCCGGCTTCATCAAGAGACAGCTGGTGG
AAACCCGGCAGATCACAAAGCACGTGGCACAGATCCTGGACTCCCGGATGAACACTAAGTACGACGAGAATGACAAG
CTGATCCGGGAAGTGAAAGTGATCACCCTGAAGTCCAAGCTGGTGTCCGATTTCCGGAAGGATTTCCAGTTTTACAA
AGTGCGCGAGATCAACAACTACCACCACGCCCACGACGCCTACCTGAACGCCGTCGTGGGAACCGCCCTGATCAAAA
AGTACCCTAAGCTGGAAAGCGAGTTCGTGTACGGCGACTACAAGGTGTACGACGTGCGGAAGATGATCGCCAAGAGC
GAGCAGGAAATCGGCAAGGCTACCGCCAAGTACTTCTTCTACAGCAACATCATGAACTTTTTCAAGACCGAGATTAC
CCTGGCCAACGGCGAGATCCGGAAGCGGCCTCTGATCGAGACAAACGGCGAAACCGGGGAGATCGTGTGGGATAAGG
GCCGGGATTTTGCCACCGTGCGGAAAGTGCTGAGCATGCCCCAAGTGAATATCGTGAAAAAGACCGAGGTGCAGACA
GGCGGCTTCAGCAAAGAGTCTATCCTGCCCAAGAGGAACAGCGATAAGCTGATCGCCAGAAAGAAGGACTGGGACCC
TAAGAAGTACGGCGGCTTCGACAGCCCCACCGTGGCCTATTCTGTGCTGGTGGTGGCCAAAGTGGAAAAGGGCAAGT
CCAAGAAACTGAAGAGTGTGAAAGAGCTGCTGGGGATCACCATCATGGAAAGAAGCAGCTTCGAGAAGAATCCCATC
GACTTTCTGGAAGCCAAGGGCTACAAAGAAGTGAAAAAGGACCTGATCATCAAGCTGCCTAAGTACTCCCTGTTCGA
GCTGGAAAACGGCCGGAAGAGAATGCTGGCCTCTGCCGGCGAACTGCAGAAGGGAAACGAACTGGCCCTGCCCTCCA
AATATGTGAACTTCCTGTACCTGGCCAGCCACTATGAGAAGCTGAAGGGCTCCCCCGAGGATAATGAGCAGAAACAG
CTGTTTGTGGAACAGCACAAGCACTACCTGGACGAGATCATCGAGCAGATCAGCGAGTTCTCCAAGAGAGTGATCCT
GGCCGACGCTAATCTGGACAAAGTGCTGTCCGCCTACAACAAGCACCGGGATAAGCCCATCAGAGAGCAGGCCGAGA
ATATCATCCACCTGTTTACCCTGACCAATCTGGGAGCCCCTGCCGCCTTCAAGTACTTTGACACCACCATCGACCGG
AAGAGGTACACCAGCACCAAAGAGGTGCTGGACGCCACCCTGATCCACCAGAGCATCACCGGCCTGTACGAGACACG
GATCGACCTGTCTCAGCTGGGAGGCGAC
Claims (9)
1. a kind of gene editing compositions or agents box, it includes 1) target dividing with protein-bonded nucleic acid for purpose mutated gene
The sgRNA or its coded sequence of son connection, 2) template nucleic acid or its coded sequence of purpose mutated gene are repaired, 3) sgRNA draws
The nuclease led or its coded sequence, 4) albumen or its coded sequence of the promotion homologous recombination merged with nucleic acid binding protein,
Wherein the nucleic acid binding protein can with it is above-mentioned 1) in nucleic acid molecules in conjunction with.
2. compositions or agents box described in claim 1, wherein the purpose mutated gene can be for example due to its mutation
Lead to the gene of disease such as genetic disease, such as Pde6b gene, Fah gene, dystrophin gene, the sgRNA is target
To the sgRNA of the purpose mutated gene, such as the sgRNA comprising sequence shown in SEQ ID NO:2.
3. compositions or agents box of any of claims 1 or 2, wherein the albumen for promoting homologous recombination includes protokaryon and true
Promote the albumen of homologous recombination, such as RecA, Rad51, Rad52 and Brcal in nucleus.
4. compositions or agents box as claimed in claim 3, wherein the nucleic acid binding protein includes MS2 albumen, RPA-4 is sub-
Base, BRCA2, XRCC2, XRCC3, RadA, HNRNPA1, NABP2 (SSB1), NABPI (SSB2) and UHRF1, the binding protein
Nucleic acid molecules include such as the nucleic acid sequence that can be identified by above-mentioned protein-specific, such as hairpin, such as by MS2 egg
Hairpin shown in the SEQ ID NO:3 of white specific recognition.
5. the described in any item compositions or agents boxes of claim 1-4, the wherein ingredient 1 of compositions or agents box), 2), 3)
With optional 4) it is present in one or more carriers.
6. the described in any item compositions or agents boxes of claim 1-5, wherein the template core for repairing purpose mutated gene
Acid is the homologous complementary recovery template that the target gene of mutation is reverted to wildtype gene sequence or required sequence, such as single-stranded mould
Plate nucleic acid or double stranded template nucleic acid, such as single-stranded DNA templates, double-stranded DNA template or ring plasmid template.
7. compositions or agents box described in any one of claims 1-6, wherein the nuclease of sgRNA guidance includes
CRISPR enzyme, such as Cas9, such as spCas9, saCas9.
It include the sgRNA sequence or its coded sequence 8. a kind of sgRNA molecule encodes the nucleic acid sequence of the sgRNA sequence
Carrier, and/or the cell comprising the carrier, wherein the sgRNA molecule is any one of claim 1-7 definition
SgRNA, such as the sgRNA comprising SEQ ID NO:2 for Pde6b gene.
9. the composition or sgRNA molecule according to any one of claims 8 of any one of claim 1-7 definition, encode the sgRNA sequence
The nucleic acid sequence of column, the carrier comprising the sgRNA sequence or its coded sequence, and/or the cell comprising the carrier are being made
Disease such as genetic disease such as heredity retinitis pigmentosa, genetic muscle caused by therapeutic gene is mutated is ready for use on to harden
Purposes in the drug of disease, hereditary tyrosinemia etc..
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811144025.3A CN109266648B (en) | 2018-09-26 | 2018-09-26 | Gene editing composition or kit for in vivo gene therapy |
| PCT/CN2019/100809 WO2020063178A1 (en) | 2018-09-26 | 2019-08-15 | Gene editing composition or kit used for in vivo gene therapy |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811144025.3A CN109266648B (en) | 2018-09-26 | 2018-09-26 | Gene editing composition or kit for in vivo gene therapy |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109266648A true CN109266648A (en) | 2019-01-25 |
| CN109266648B CN109266648B (en) | 2021-10-19 |
Family
ID=65199155
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811144025.3A Active CN109266648B (en) | 2018-09-26 | 2018-09-26 | Gene editing composition or kit for in vivo gene therapy |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN109266648B (en) |
| WO (1) | WO2020063178A1 (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108998406A (en) * | 2018-08-03 | 2018-12-14 | 福州大学 | A kind of human primary cultured cells' genome editor, fixed point gene knock-in method |
| WO2020063178A1 (en) * | 2018-09-26 | 2020-04-02 | 中国科学技术大学 | Gene editing composition or kit used for in vivo gene therapy |
| CN111850044A (en) * | 2020-07-16 | 2020-10-30 | 中国科学技术大学 | Method for constructing rhesus monkey model for retinitis pigmentosa based on in-vivo gene knockout |
| CN112813063A (en) * | 2019-11-15 | 2021-05-18 | 中国科学院分子细胞科学卓越创新中心 | Construction of animal model for lipid metabolism disorder and repair by AAV-CRISPR/CAS9 |
| CN112979821A (en) * | 2019-12-18 | 2021-06-18 | 华东师范大学 | Fusion protein for improving gene editing efficiency and application thereof |
| CN114096667A (en) * | 2019-07-08 | 2022-02-25 | 因思科瑞普特公司 | Increasing nucleic acid-directed cell editing via LexA-Rad51 fusion proteins |
| WO2024051850A1 (en) * | 2022-09-09 | 2024-03-14 | 中国科学院遗传与发育生物学研究所 | Dna polymerase-based genome editing system and method |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20190062734A1 (en) * | 2016-04-13 | 2019-02-28 | Editas Medicine, Inc. | Grna fusion molecules, gene editing systems, and methods of use thereof |
| CN106282228A (en) * | 2016-08-19 | 2017-01-04 | 苏州兰希亚生物科技有限公司 | A kind of method that point mutation is repaired |
| CN109266648B (en) * | 2018-09-26 | 2021-10-19 | 中国科学技术大学 | Gene editing composition or kit for in vivo gene therapy |
-
2018
- 2018-09-26 CN CN201811144025.3A patent/CN109266648B/en active Active
-
2019
- 2019-08-15 WO PCT/CN2019/100809 patent/WO2020063178A1/en active Application Filing
Non-Patent Citations (4)
| Title |
|---|
| JUN NISHIYAMA等: "Virus-Mediated Genome Editing via Homology-Directed Repair in Mitotic and Postmitotic Cells in Mammalian Brain", 《NEURO》 * |
| SIMIN SHAO等: "Enhancing CRISPR/Cas9-mediated homology-directed repair in mammalian cells by expressing Saccharomyces cerevisiae Rad52", 《INTERNATIONAL JOURNAL OF BIOCHEMISTRY AND CELL BIOLOGY》 * |
| SIYUAN WANG等: "An RNA-aptamer-based two-color CRISPR labeling system", 《SCIENTIFIC REPORTS》 * |
| WEN-HSUAN WU等: "CRISPR Repair Reveals Causative Mutation in a Preclinical Model of Retinitis Pigmentosa", 《MOLECULAR THERAPY》 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108998406A (en) * | 2018-08-03 | 2018-12-14 | 福州大学 | A kind of human primary cultured cells' genome editor, fixed point gene knock-in method |
| WO2020063178A1 (en) * | 2018-09-26 | 2020-04-02 | 中国科学技术大学 | Gene editing composition or kit used for in vivo gene therapy |
| CN114096667A (en) * | 2019-07-08 | 2022-02-25 | 因思科瑞普特公司 | Increasing nucleic acid-directed cell editing via LexA-Rad51 fusion proteins |
| CN112813063A (en) * | 2019-11-15 | 2021-05-18 | 中国科学院分子细胞科学卓越创新中心 | Construction of animal model for lipid metabolism disorder and repair by AAV-CRISPR/CAS9 |
| CN112979821A (en) * | 2019-12-18 | 2021-06-18 | 华东师范大学 | Fusion protein for improving gene editing efficiency and application thereof |
| CN111850044A (en) * | 2020-07-16 | 2020-10-30 | 中国科学技术大学 | Method for constructing rhesus monkey model for retinitis pigmentosa based on in-vivo gene knockout |
| WO2024051850A1 (en) * | 2022-09-09 | 2024-03-14 | 中国科学院遗传与发育生物学研究所 | Dna polymerase-based genome editing system and method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109266648B (en) | 2021-10-19 |
| WO2020063178A1 (en) | 2020-04-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109266648A (en) | For the gene editing compositions or agents box in body gene therapy | |
| CN108610399B (en) | The method that specificity enhancing CRISPR-CAS system carries out gene editing efficiency in epidermal stem cells | |
| US20220015342A1 (en) | Gene editing of reproductive hormones to reduce fertility in ictalurus punctatus | |
| US20200299661A1 (en) | Cpf1-related methods and compositions for gene editing | |
| US20080182331A1 (en) | Procedure for specific replacement of a copy of a gene present in the recipient genome by the integration of a gene different from that where the integration is made | |
| US20140038292A1 (en) | Tol1 FACTOR TRANSPOSASE AND DNA INTRODUCTION SYSTEM USING THE SAME | |
| JP2019511240A (en) | Genome Editing of Human Neural Stem Cells Using Nuclease | |
| CN110730823A (en) | Tissue-selective transgene expression | |
| CN109982710A (en) | Target the DNA demethylation of enhancing | |
| CN112662674B (en) | gRNA for targeted editing of VEGFA gene exon region and application thereof | |
| CN109295053A (en) | Pass through induction splice site base mutation or the method for poly pyrimidine area's base replacement rna regulation montage | |
| CN106754949B (en) | Pig flesh chalone gene editing site 864-883 and its application | |
| KR20040018356A (en) | Gene therapy with chimeric oligonucleotides delivered by a method comprising a step of iontophoresis | |
| CN110862988B (en) | sgRNA and CREBRF point mutant Bama pig constructed by same and application thereof | |
| Mao et al. | CRISPR/Cas9‐mediated efficient and precise targeted integration of donor DNA harboring double cleavage sites in Xenopus tropicalis | |
| WO2021212686A1 (en) | Method for rho-adrp based on gene editing, and composition | |
| CN111133110A (en) | Genome editing system for repeat amplification mutations | |
| JP2024506040A (en) | sgRNA targeting Aqp1 RNA and its use with vectors | |
| CN112111511B (en) | Knockout vector, targeting vector, kit, animal model for Prdm16 detection, detection method and application | |
| CN115851706A (en) | Base editing system and application thereof | |
| CN115125268B (en) | Construction method and application of Mexico salamander animal model capable of conditionally inducing proliferation of neural stem cells | |
| Ma et al. | PhiC31 integrase induces efficient site-specific recombination in the Capra hircus genome | |
| CN115322993B (en) | Safety site for site-directed integration of exogenous genes in pig genome and method for constructing pig breeding group by using safety site | |
| US20230234906A1 (en) | Use of 2-pentanone and specific receptor thereof in manufacture of products regulating cell functions | |
| KR101636885B1 (en) | Method for preparing bio-pharmaceutical protein fused to bovine beta-casein |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Xue Tian Inventor after: Cai Yuan Inventor before: Xue Tian Inventor before: Chou Zilong Inventor before: Cai Yuan Inventor before: Cheng Tianlin |
|
| CB03 | Change of inventor or designer information | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20220330 Address after: 230001 embedded R & D building 103-a6, Institute of advanced technology, University of science and technology of China, No. 5089, Wangjiang West Road, high tech Zone, Hefei, Anhui Province Patentee after: Hefei Xingmou Biotechnology Co.,Ltd. Address before: 230026 Jinzhai Road, Baohe District, Hefei, Anhui Province, No. 96 Patentee before: University of Science and Technology of China |
|
| TR01 | Transfer of patent right |