CN109234460A - For detecting and/or assisting primer sets, reagent, kit and the detection method of detection I type norovirus of G - Google Patents
For detecting and/or assisting primer sets, reagent, kit and the detection method of detection I type norovirus of G Download PDFInfo
- Publication number
- CN109234460A CN109234460A CN201811337480.5A CN201811337480A CN109234460A CN 109234460 A CN109234460 A CN 109234460A CN 201811337480 A CN201811337480 A CN 201811337480A CN 109234460 A CN109234460 A CN 109234460A
- Authority
- CN
- China
- Prior art keywords
- detection
- primer sets
- type norovirus
- reagent
- kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to field of biotechnology, specifically, providing a kind of for detecting and/or assisting primer sets, reagent, kit and the detection method of detection I type norovirus of G.The present invention provides a kind of for detecting and/or assisting the primer sets of detection I type norovirus of G, including single strand dna shown in the single strand dna as shown in SEQ ID NO.1 and SEQ ID NO.2.Proved by test: primer group-specific of the invention is good, high sensitivity, detection time is short, does not need special instrument, and experimental period cost, the easy degree of operation and testing cost are substantially reduced.Reagent or kit containing the primer sets can specificity detection, identification I type norovirus of G, and the RPA detection method of the I type norovirus of G based on primer sets foundation is sensitive, accurate, easy and quick, and screening and quick diagnosis to I type norovirus of G may be implemented.
Description
Technical field
The present invention relates to field of biotechnology, more particularly, to one kind for detecting and/or assisting detection I type promise of G such as disease
Primer sets, reagent, kit and the detection method of poison.
Background technique
Norovirus (norovirus) is global acute gastroenteritis prevalence and the most common reason of Sporadic cases, and food
The main reason for source property gastroenteritis.Acute gastroenteritis caused by norovirus in China at ascendant trend, especially in school, child
Easily collective is caused to break out to the low resistance crowd massing such as garden, home for destitute.Norovirus infectiousness is very strong, can through fecal-oral transmission,
Human-to-human transmission, water, the food that can be subjected to virus pollution etc. are propagated.It is estimated that the Non-bacterial diarrhea as caused by norovirus is broken out
Account for the 50%-80% or so of sum.Its break out it is usually related with shellfish or freshly prepared veterinary antibiotics salad, usually by
In the fecal pollution water of infection or derived from the food-handler of infection.Norovirus is according to its gene RNA polymerase and master
The homology of the nucleotide sequence of capsid protein VP1 is wanted, 5 genomes: G I, G II, G III, G IV, G V can be divided into, wherein susceptible
Contaminate mainly II genome of G I and G of people.
The detection technique of norovirus mainly has reverse transcription-polymerase chain reaction (RT-PCR), fluorescent quantitation RT- at present
PCR, reverse transcription-ring mediated isothermal amplification (RT-LAMP), genetic chip, enzyme linked immunosorbent assay (ELISA) (ELISA).Reverse transcription-is poly-
It is template that synthase chain reaction technology, which is by RNA, is catalyzed with reverse transcriptase, synthesizes complementary DNA with primer, then through PCR using special
Property primer amplification, is the classical technology of qualitative detection norovirus.Real-time fluorescence quantitative RT-PCR is to utilize dyestuff or spy
Needle monitors the fluorescence signal in PCR reaction tube, to achieve the purpose that quantitative, real-time fluorescence quantitative RT-PCR gradually replaces at present
Become the method for the detection norovirus being most widely used for conventional RT-PCR.The method of traditional based on PCR is needed to be denaturalized, be moved back
Fire extends three steps, and the temperature of each step is different, needs special thermal cycler to carry out, and limits it and uses model
It encloses.Therefore many isothermal amplification techniques for not depending on PCR instrument are developed, especially most with ring mediated isothermal amplification LAMP application
To be extensive, by the way that hydroxynaphthol blue dyestuff is added before expanding, with color change judging result, it is suitable for on-site test.LAMP skill
Art presently, there are a big problem be exactly serious pollution of its product to environment, and need to complete reaction in 60-65 DEG C of high temperature, answer
With relatively limited.Also, it is existing for detecting the primer sets of I type norovirus of G, ad hoc approach is only applicable to (such as tradition
PCR), it is not particularly suited for RPA amplification, thus cannot match to reach best detection effect with testing conditions.
In view of this, the present invention is specifically proposed.
Summary of the invention
The first object of the present invention is to provide a kind of for detecting and/or assisting the primer of detection I type norovirus of G
Group, the second object of the present invention are to provide a kind of for detecting and/or assisting the reagent of detection I type norovirus of G, the present invention
Third be designed to provide it is a kind of for detect and/or assist detection I type norovirus of G kit, the of the invention the 4th
It is designed to provide the application of above-mentioned primer sets, reagent and kit, the fifth object of the present invention is to provide a kind of identification G I
The detection method of type norovirus, at least to alleviate one of the technical problems existing in the prior art.
In order to realize above-mentioned purpose of the invention, the following technical scheme is adopted:
The present invention provides a kind of for detecting and/or assisting the primer sets of detection I type norovirus of G, the primer sets
Including single strand dna shown in the single strand dna as shown in SEQ ID NO.1 and SEQ ID NO.2.
The present invention also provides a kind of for detecting and/or assisting the reagent of detection I type norovirus of G, the reagent packet
Include above-mentioned primer sets.
Further, the reagent includes positive control sample；
Preferably, the positive control sample is the DNA plasmid containing sequence shown in SEQ ID NO.3；
Preferably, the final concentration of single strand dna described in the SEQ ID NO.1 and SEQ ID NO.2 in the primer sets
It independently is 0.38-0.58 μm of ol/L；
Preferably, the final concentration of 0.1-0.3ng/ μ L of the positive control sample.
The present invention also provides a kind of for detecting and/or assisting the kit of detection I type norovirus of G, the reagent
Box includes above-mentioned primer sets or reagent.
Further, the kit includes lyophozyme tube cell, rehydration buffer and magnesium acetate solution.
Further, the kit includes reverse transcription articles, is used for sample to be tested reverse transcription into cDNA.
The present invention also provides above-mentioned primer sets or reagent or kit in following a)-c) in application:
A) preparation detection and/or auxiliary detect whether the product of infection I type norovirus of G；
B) it identifies in sample to be tested and whether contains I type norovirus of G；
C) preparation identification sample to be tested in whether the product containing I type norovirus of G.
In addition, the present invention also provides a kind of detection methods for identifying I type norovirus of G, comprising the following steps: with above-mentioned
Primer sets to sample to be tested carry out RPA amplification, detect RPA amplified production size and sequence.
Further, the sample to be tested is handled by reverse transcription.
Further, the condition of the RPA amplification includes: 35-39 DEG C of amplification 30-50min.
Compared with prior art, the invention has the benefit that
The present invention provides a kind of for detecting and/or assisting the primer sets of detection I type norovirus of G, including such as SEQ ID
Single strand dna shown in single strand dna shown in NO.1 and SEQ ID NO.2.The present invention is for the conservative of I type norovirus of G
Sequence designs specificity RPA amplimer group, and the RPA detection method of I type norovirus of G is established based on the primer sets, can
Qualitative detection is carried out to I type norovirus of G.Passing through test proves: RPA amplimer group-specific of the invention is good, sensitivity
Height, detection time is short, does not need special instrument, and sensitivity is suitable with regular-PCR method, but experimental period cost, operation
Easy degree and testing cost be substantially reduced.Reagent or kit containing the primer sets can specificity detection, identification G I
Type norovirus, and the RPA detection method of the I type norovirus of G based on primer sets foundation is sensitive, accurate, easy and quick,
May be implemented not will receive the limitation of place and consersion unit to the screening and quick diagnosis of I type norovirus of G, accomplish it is accurate,
Quick on-site test, convenient for being promoted in primary care quarantine mechanism.
Detailed description of the invention
It, below will be to specific in order to illustrate more clearly of the specific embodiment of the invention or technical solution in the prior art
Embodiment or attached drawing needed to be used in the description of the prior art be briefly described, it should be apparent that, it is described below
Attached drawing is some embodiments of the present invention, for those of ordinary skill in the art, before not making the creative labor
It puts, is also possible to obtain other drawings based on these drawings.
Fig. 1 is in the embodiment of the present invention 4 for detecting and/or assisting the verifying knot of the kit of detection I type norovirus of G
Fruit；
Fig. 2 is in the embodiment of the present invention 5 for detecting and/or assisting the primer group-specific inspection of detection I type norovirus of G
Survey result；
Fig. 3 is in the embodiment of the present invention 6 for detecting and/or assisting the primer sets sensitivity inspection of detection I type norovirus of G
Survey result；
Fig. 4 is regular-PCR sensitivity technique result in the embodiment of the present invention 6.
Specific embodiment
Technical solution of the present invention is clearly and completely described below in conjunction with embodiment, it is clear that described reality
Applying example is a part of the embodiment of the present invention, instead of all the embodiments.Based on the embodiments of the present invention, the common skill in this field
Art personnel every other embodiment obtained without making creative work belongs to the model that the present invention protects
It encloses.
It should be understood that
Unless otherwise indicated, profession used herein and meaning phase known to scientific term and one skilled in the art
Together.In addition, any method similar to or equal to what is recorded or material can also be applied in the present invention.
According to an aspect of the invention, there is provided a kind of for detecting and/or assisting drawing for detection I type norovirus of G
Object group, the primer sets include single strand dna shown in the single strand dna as shown in SEQ ID NO.1 and SEQ ID NO.2.
Wherein, upstream primer are as follows:
RPA-NGI-F:5'-AATTCTAATACGACTCACTATAGGGCGCTGGATGCGATTCCAT-3'(SEQ ID
NO.1)；
Downstream primer are as follows:
RPA-NGI-R:5'-TCCTTAGACGCCATCATCATTTACATAATCGGGCA-3'(SEQ ID NO.2)。
The present invention is directed to the conserved sequence of I type norovirus of G, designs specificity RPA amplimer group, is demonstrate,proved by test
Bright: RPA amplimer group-specific of the invention is good, high sensitivity, detection time is short, does not need special instrument, sensitivity
It is suitable with regular-PCR method, but experimental period cost, the easy degree of operation and testing cost are substantially reduced.
The present invention also provides a kind of for detecting and/or assisting the reagent of detection I type norovirus of G, the reagent packet
Include above-mentioned primer sets.
For the reagent using the primer sets as identification substance, specificity quickly detects I type norovirus of G.
In some preferred embodiments, the reagent includes positive control sample.
By the setting of positive control sample, the accuracy of detection can be improved, and then improve the confidence level of detection, effectively
Ground carries out quality inspection to primer sets, the quality of reagent.
Preferably, the positive control sample is the DNA plasmid containing sequence shown in SEQ ID NO.3.
The positive control sample is designed according to I type norovirus conserved sequence of G, is constructed for detecting I type norovirus of G
Positive control plasmid, the plasmid include the full sequence that above-mentioned primer sets and primer sets expand.Particular sequence is as follows:
TCTACATTCCTGGTTGGCAGGCCATGTTCCGCTGGATGCGATTCCATGATCTAAGTTTGTGGACAGGA
GATCGCGATCTCCTGCCCGATTATGTAAATGATGATGGCGTCTAAGGACGCCCCAACAAACATGGATGGCACCAG
(SEQ ID NO.3)。
Preferably, the final concentration of single strand dna described in the SEQ ID NO.1 and SEQ ID NO.2 in the primer sets
It independently is 0.38-0.58 μm of ol/L.
In the range, primer sets can be with I type norovirus of qualitative detection G, and specificity is good, high-efficient, avoids reagent
Waste.The final concentration of the single strand dna of SEQ ID NO.1 in primer sets for example can be but be not limited to 0.38 μm of ol/
L, 0.43 μm of ol/L, 0.48 μm of ol/L, 0.53 μm of ol/L or 0.58 μm of ol/L, preferably 0.48 μm of ol/L；SEQ in primer sets
The final concentration of the single strand dna of ID NO.2 for example can be but be not limited to 0.38 μm of ol/L, 0.43 μm of ol/L, 0.48 μm of ol/
L, 0.53 μm of ol/L or 0.58 μm of ol/L, preferably 0.48 μm of ol/L.
Preferably, the final concentration of 0.1-0.3ng/ μ L of the positive control sample.
The final concentration of positive control sample it is typical but non-limiting for 0.1ng/ μ L, 0.15ng/ μ L, 0.2ng/ μ L,
0.25ng/ μ L or 0.3ng/ μ L, preferably 0.2ng/ μ L.Not only it can guarantee the recall rate of positive control sample under the concentration, but also
Avoid the waste of reagent.
The present invention also provides a kind of for detecting and/or assisting the kit of detection I type norovirus of G, the reagent
Box includes above-mentioned primer sets or reagent.
The kit is detection basis with above-mentioned primer sets, quickly can specifically detect I type norovirus of G.
In some preferred embodiments, the kit includes lyophozyme tube cell, rehydration buffer and magnesium acetate
Solution.
Wherein, the concentration of magnesium acetate solution is preferably 280mmol/L, above-mentioned lyophozyme tube cell, rehydration buffer
(Rehydration Buffer) and magnesium acetate solution can be commercially available finished product on the market.
In some preferred embodiments, the kit includes reverse transcription articles, is used for sample to be tested reverse transcription
At cDNA.
The inhereditary material of virus is RNA, when detecting to sample to be tested, is needed RNA reverse transcription at cDNA, to cDNA
It is detected, it is also preferable to include can be by RNA reverse transcription at the reagent and consumptive material of cDNA for the kit.
The present invention also provides above-mentioned primer sets or reagent or kit in following a)-c) in application:
A) preparation detection and/or auxiliary detect whether the product of infection I type norovirus of G；
B) it identifies in sample to be tested and whether contains I type norovirus of G；
C) preparation identification sample to be tested in whether the product containing I type norovirus of G.
In addition, the present invention also provides a kind of detection methods for identifying I type norovirus of G, comprising the following steps: with above-mentioned
Primer sets to sample to be tested carry out RPA amplification, detect RPA amplified production size and sequence.
The RPA detection method of I type norovirus of G is established based on above-mentioned primer sets, I type norovirus of G can be determined
Property detection.The detection method is sensitive, accurate, easy and quick, and screening and quick diagnosis to I type norovirus of G may be implemented,
Accurately and rapidly on-site test is accomplished in the limitation that not will receive place and consersion unit, convenient for pushing away in primary care quarantine mechanism
Extensively.
In some preferred embodiments, the sample to be tested is handled by reverse transcription.
In some preferred embodiments, the condition of the RPA amplification includes: 35-39 DEG C of amplification 30-50min.
It is 35 DEG C, 36 DEG C, 37 DEG C, 38 DEG C or 39 DEG C, preferably 37 DEG C that it is typical but non-limiting, which to expand temperature,；When amplification
Between it is typical but non-limiting be 30min, 35min, 40min, 45min or 50min, preferably 40min.RPA detection only needs
Amplification can be completed in pair of primers, avoids complicated design of primers process, and reaction temperature is constant, at a lower temperature into
Row, does not need special heat circulating equipment, and the simultaneous reactions time is short, quickly result out.
Present invention will be further explained by specific examples below, it should be understood, however, that, these embodiments are only
It is used, is but should not be understood as present invention is limited in any form for being described in more detail.
Experimental method used in following embodiments is conventional method unless otherwise specified.Material used, reagent
Deng being commercially available unless otherwise specified.
RPA amplification kit TwistAmp Basic kits in following embodiments is the product of TwistDX company, is produced
Product catalog number (Cat.No.) is TABAS03KIT；I type norovirus of G in following embodiments provides for Panjin Municipal Disease Control and Prevention Center.
1 primer sets of embodiment, the design of positive control sample
For the conserved sequence of I type norovirus of G, design detects the RPA primer sets of I type norovirus of G, and primer size is
112bp is the DNA plasmid containing positive control for primer sets and amplified fragments design positive control sample.Specific primer sets
It is as follows with the sequence of the positive control contained in positive control sample:
The sequence of table 1 primer sets and positive control
Embodiment 2 is used to detect and/or assist the kit of detection I type norovirus of G
The kit includes upstream primer RPA-NGI-F in embodiment 1, the I type promise of downstream primer RPA-NGI-R, G such as disease
Malicious positive control sample (0.2ng/ μ L), tube cell containing lyophozyme, rehydration buffer (Rehydration Buffer), magnesium acetate
Solution (280mmol/L).Above-mentioned tube cell containing lyophozyme, rehydration buffer (Rehydration Buffer) and magnesium acetate solution
(280mmol/L) derives from RPA amplification kit TwistAmp Basic kits.
The detection method of the identification I type norovirus of G of embodiment 3
(a) RPA is expanded
Using the cDNA of sample to be tested as template, using the kit in embodiment 2, RPA-NGI-F and RPA-NGI-R are utilized
Primer sets carry out RPA amplification, obtain RPA amplified production.Blank control (DNA profiling is nuclease-free water) is set simultaneously.
The preparation method of RPA amplification system is as follows: being added into the 0.2mL TwistAmp reaction tube containing freeze-drying enzyme powder
Rehydration buffer (Rehydration Buffer) 29.5 μ L, 12.5 μ L of deionized water, each 2.4 μ L (primer of upstream and downstream primer
Final concentration be 0.48 μm of ol/L), 1 μ L of template DNA or positive control sample finally adds 2.5 μ L of magnesium acetate solution
(280mmol/L)。
RPA amplification reaction condition: above-mentioned RPA amplification system is mixed well, and is placed on 37 DEG C of metal bath or water-bath
40min is reacted, RPA amplified production is obtained.
(b) electrophoresis detection of RPA amplified production
RPA after reaction, is added 50 μ L phenol/chloroform (1:1) solution into RPA amplified production respectively, mixes well,
12000rpm is centrifuged 2min, and 5 μ L supernatants is taken to carry out agarose gel electrophoresis, using 3% Ago-Gel, 120V, 50min,
Gel imaging system observes result.
(c) RPA amplified production is sequenced.Thermo biotech firm is entrusted to carry out sequencing.
The verifying for the kit that embodiment 4 is used to detect and/or assist detection to cause I type norovirus of G
The extraction of RNA and the synthesis of cDNA:
I type norovirus of G is extracted referring to kit operation (RNeasy Mini Kit, article No. 74104, QIAGEN)
RNA.And referring to kit (GoScript Reverse Transcription System, article No. A5001, Promega)
Operation, using the RNA of acquisition as template, reverse transcription obtains cDNA.By the cDNA of acquisition be stored in -20 DEG C it is spare.
RPA amplification:
Using the cDNA of above-mentioned acquisition as template, RPA amplification is carried out using RPA-NGI-F and RPA-NGI-R primer, is obtained
RPA amplified production.Negative control (DNA profiling is nuclease-free water) is set simultaneously.
The preparation method of RPA amplification system is as follows:
Rehydration buffer (Rehydration is added into the 0.2mL TwistAmp reaction tube containing freeze-drying enzyme powder
Buffer) 29.5 μ L, 12.5 μ L of deionized water, each 2.4 μ L of upstream and downstream primer (final concentration of primer is 0.48 μm of ol/L),
1 μ L of template DNA or positive control sample finally adds 2.5 μ L (280mmol/L) of magnesium acetate solution.
RPA amplification reaction condition:
Above-mentioned RPA amplification system is mixed well, is placed on 37 DEG C of metal bath or water-bath and reacts 40min, obtain RPA
Amplified production.
The electrophoresis detection of RPA amplified production:
RPA after reaction, is added 50 μ L phenol/chloroform (1:1) solution into RPA amplified production respectively, mixes well,
12000rpm is centrifuged 2min, and 5 μ L supernatants is taken to carry out agarose gel electrophoresis, using 3% Ago-Gel, 120V, 50min,
Gel imaging system observes result.
As a result such as Fig. 1 (M:maker；1: positive control sample；I type norovirus of 2:G；3: negative control) shown in: I type of G
The RPA amplified production of norovirus contains 1 band, size 112bp, and negative control is without band.
Illustrate primer sets, reagent and the reagent provided by the present invention for detecting and/or assisting detection I type norovirus of G
Box can effectively detect I type norovirus of G.
Embodiment 5 is used to detect and/or assist the primer sets specific detection of detection I type norovirus of G
Using the reverse transcription method in embodiment 4, I type norovirus of G, II type norovirus of G and A/B/C type colyliform are obtained
The cDNA of virus extracts secondary haemolysis arc referring to kit operation (QIAamp DNA Mini Kit, article No. 51304, QIAGEN)
The DNA of bacterium.Using I type norovirus of detection method RPA augmentation detection G, the II type norovirus of G, A/B/C type in embodiment 3
Rotavirus and vibrio parahaemolytious.
As a result such as Fig. 2 (M:maker；I type norovirus sample of 1:G；II type norovirus sample of 2:G；3:A type colyliform disease
Poison；4:B type rotavirus；5:C type rotavirus；6: vibrio parahaemolytious；7: negative control) shown in: it can be seen from the figure that only
There is the amplified production of I type norovirus of G to contain the band that 1 size is 112bp, II type norovirus of G, A/B/C type colyliform disease
Poison, vibrio parahaemolytious are without band.Illustrate that RPA primer specificity of the invention is high.
Embodiment 6 be used for detect and/or assist detection I type norovirus of G primer sets sensitivity and with regular-PCR spirit
The comparison of sensitivity
The cDNA of I type norovirus of G in embodiment 5 is subjected to gradient dilution, respectively obtains dilution 1,10,102、103、
104、105The cDNA of I type norovirus of G again.
RPA amplification: respectively with dilution 1,10,10 obtained above2、103、104、105The cDNA of I type norovirus of G again
For template, RPA amplification is carried out according to the detection method in embodiment 3 using RPA-NGI-F and RPA-NGI-R primer sets.
PCR amplification: respectively with dilution 1,10,10 obtained above2、103、104、105The cDNA of I type norovirus of G again
For template, PCR amplification is carried out using NGI-F and NGI-R primer.Referring to 2 × PrimeSTAR HS (Premix) product description
(Takara, R040A), each 50 μ L of PCR system, including 2 × PrimeSTAR HS (Premix), 25 μ L, upstream and downstream primer each 1
μ L (10 μm of ol/L), 2 μ L of cDNA, benefit are filled with water to 50 μ L, and PCR amplification condition is shown in Table 2, and PCR amplification primer sequence is shown in Table 3.
Table 2.PCR amplification condition
Table 3.PCR amplimer sequence
| Title | Sequence (5 ' -3 ') | Sequence number |
| NGI-F | TCTACATTCCTGGTTGGCAG | SEQ ID NO.4 |
| NGI-R | CTGGTGCCATCCATGTTTGT | SEQ ID NO.5 |
RPA after reaction, is added 50 μ L phenol/chloroform (1:1) solution into RPA amplified production respectively, mixes well,
12000rpm is centrifuged 2min, and 5 μ L supernatants is taken to carry out agarose gel electrophoresis, using 3% Ago-Gel, 120V, 50min,
Gel imaging system observes result.RPA electrophoresis result (M:maker as shown in Figure 3；1-6 swimming lane is successively are as follows: template cDNA difference
Dilution 1,10,102、103、104、105Times).
PCR after reaction, takes the pcr amplification product of 5 μ L in 3% agarose gel electrophoresis, 120V, 50min, in gel
Result is observed in imaging system.PCR electrophoresis result (M:maker as shown in Figure 4；1-6 swimming lane is successively are as follows: template cDNA difference is dilute
Release 1,10,102、103、104、105Times).
As can be seen that RPA method high sensitivity of the invention is in regular-PCR from Fig. 3 and Fig. 4.
Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention., rather than its limitations；To the greatest extent
Pipe present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that: its according to
So be possible to modify the technical solutions described in the foregoing embodiments, or to some or all of the technical features into
Row equivalent replacement；And these are modified or replaceed, various embodiments of the present invention technology that it does not separate the essence of the corresponding technical solution
The range of scheme.
SEQUENCE LISTING
<110>the vast and boundless Biotechnology Co., Ltd in Liaoning one hundred
<120>for detecting and/or assisting primer sets, reagent, kit and the detection method of detection I type norovirus of G
<160> 5
<170> PatentIn version 3.5
<210> 1
<211> 43
<212> DNA
<213>artificial sequence
<400> 1
aattctaata cgactcacta tagggcgctg gatgcgattc cat 43
<210> 2
<211> 35
<212> DNA
<213>artificial sequence
<400> 2
tccttagacg ccatcatcat ttacataatc gggca 35
<210> 3
<211> 143
<212> DNA
<213>artificial sequence
<400> 3
tctacattcc tggttggcag gccatgttcc gctggatgcg attccatgat ctaagtttgt 60
ggacaggaga tcgcgatctc ctgcccgatt atgtaaatga tgatggcgtc taaggacgcc 120
ccaacaaaca tggatggcac cag 143
<210> 4
<211> 20
<212> DNA
<213>artificial sequence
<400> 4
tctacattcc tggttggcag 20
<210> 5
<211> 20
<212> DNA
<213>artificial sequence
<400> 5
ctggtgccat ccatgtttgt 20
Claims (10)
1. a kind of for detecting and/or assisting the primer sets of detection I type norovirus of G, which is characterized in that the primer sets include
Single strand dna shown in the single strand dna as shown in SEQ ID NO.1 and SEQ ID NO.2.
2. a kind of for detecting and/or assisting the reagent of detection I type norovirus of G, which is characterized in that the reagent includes right
It is required that primer sets described in 1.
3. reagent according to claim 2, which is characterized in that the reagent includes positive control sample；
Preferably, the positive control sample is the DNA plasmid containing sequence shown in SEQ ID NO.3；
Preferably, the final concentration of single strand dna described in the SEQ ID NO.1 and SEQ ID NO.2 in the primer sets is only
It is on the spot 0.38-0.58 μm of ol/L；
Preferably, the final concentration of 0.1-0.3ng/ μ L of the positive control sample.
4. a kind of for detecting and/or assisting the kit of detection I type norovirus of G, which is characterized in that the kit includes
Primer sets described in claim 1 or reagent described in claim 2 or 3.
5. kit according to claim 4, which is characterized in that the kit includes that lyophozyme tube cell, rehydration are slow
Fliud flushing and magnesium acetate solution.
6. kit according to claim 4 or 5, which is characterized in that the kit includes reverse transcription articles, and being used for will
Sample to be tested reverse transcription is at cDNA.
7. primer sets described in claim 1 or reagent described in claim 2 or 3 or claim 4-6 are described in any item
Kit is in following a)-c) in application:
A) preparation detection and/or auxiliary detect whether the product of infection I type norovirus of G；
B) it identifies in sample to be tested and whether contains I type norovirus of G；
C) preparation identification sample to be tested in whether the product containing I type norovirus of G.
8. a kind of detection method for identifying I type norovirus of G, which comprises the following steps: described in claim 1
Primer sets to sample to be tested carry out RPA amplification, detect RPA amplified production size and sequence.
9. detection method according to claim 8, which is characterized in that the sample to be tested is handled by reverse transcription.
10. detection method according to claim 8 or claim 9, which is characterized in that the condition of the RPA amplification includes: 35-39
DEG C amplification 30-50min.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811337480.5A CN109234460A (en) | 2018-11-09 | 2018-11-09 | For detecting and/or assisting primer sets, reagent, kit and the detection method of detection I type norovirus of G |
| CN201910890604.0A CN110512029A (en) | 2018-11-09 | 2019-09-20 | For detecting primer sets, reagent, kit and the application of norovirus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811337480.5A CN109234460A (en) | 2018-11-09 | 2018-11-09 | For detecting and/or assisting primer sets, reagent, kit and the detection method of detection I type norovirus of G |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109234460A true CN109234460A (en) | 2019-01-18 |
Family
ID=65077979
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811337480.5A Withdrawn CN109234460A (en) | 2018-11-09 | 2018-11-09 | For detecting and/or assisting primer sets, reagent, kit and the detection method of detection I type norovirus of G |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109234460A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109762944A (en) * | 2019-03-29 | 2019-05-17 | 山东时进检测服务有限公司 | A kind of method of I type norovirus of G in detection marine food |
| CN110791589A (en) * | 2019-10-18 | 2020-02-14 | 张家口健垣科技有限公司 | Primer, probe, kit and detection method for RNA isothermal amplification detection of norovirus |
| CN113186354A (en) * | 2021-05-28 | 2021-07-30 | 中国科学院微生物研究所 | Kit and special primer for detecting GI.1 type norovirus in clinical sample |
-
2018
- 2018-11-09 CN CN201811337480.5A patent/CN109234460A/en not_active Withdrawn
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109762944A (en) * | 2019-03-29 | 2019-05-17 | 山东时进检测服务有限公司 | A kind of method of I type norovirus of G in detection marine food |
| CN110791589A (en) * | 2019-10-18 | 2020-02-14 | 张家口健垣科技有限公司 | Primer, probe, kit and detection method for RNA isothermal amplification detection of norovirus |
| CN113186354A (en) * | 2021-05-28 | 2021-07-30 | 中国科学院微生物研究所 | Kit and special primer for detecting GI.1 type norovirus in clinical sample |
| CN113186354B (en) * | 2021-05-28 | 2023-01-24 | 中国科学院微生物研究所 | Kit and special primer for detecting GI.1 type norovirus in clinical sample |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113817868B (en) | Primer, probe composition and kit for detecting novel coronavirus and variant strain thereof | |
| CN109234460A (en) | For detecting and/or assisting primer sets, reagent, kit and the detection method of detection I type norovirus of G | |
| CN108060269B (en) | DPO primer group for detecting porcine epidemic diarrhea virus, porcine transmissible gastroenteritis virus and porcine rotavirus and application thereof | |
| CN112280895A (en) | Kit for detecting novel coronavirus by adopting loop-mediated transcription isothermal amplification method | |
| CN107177700A (en) | A kind of LAMP primer group, kit and detection method for detecting cucumber mosaic virus | |
| CN107236826A (en) | A kind of LAMP primer group, kit and detection method for detecting lily asymptomatic virus | |
| CN107164566B (en) | LAMP primer group, kit and detection method for detecting lily mottle virus | |
| CN112831605A (en) | Multienzyme isothermal amplification detection kit and application thereof | |
| CN110512029A (en) | For detecting primer sets, reagent, kit and the application of norovirus | |
| CN109234459A (en) | For detecting and/or assisting primer sets, reagent, kit and the detection method of detection II type norovirus of G | |
| CN113293236A (en) | Porcine reproductive and respiratory syndrome virus RT-LAMP (reverse transcription loop-mediated isothermal amplification) detection primer group and kit | |
| CN111534603B (en) | Method for identifying aedes albopictus by using fluorescent RPA | |
| CN107858453A (en) | Porcine encephalomyocarditis virus LAMP detection primer is to, detection method and application | |
| CN106755598A (en) | Fluorescence LAMP primer and its detection method for detecting shrimp cream head disease virus | |
| CN112410465A (en) | Novel coronavirus SARS-CoV-2ORF1ab and N gene constant temperature amplification primer group and kit | |
| Kobayashi et al. | Development of a RT-LAMP assay for real-time detection of criniviruses infecting tomato | |
| Momenifar et al. | Development of an optimized RT-LAMP test for the detection of SARS-CoV-2 | |
| CN108315499A (en) | A kind of RT-LAMP Primer compositions and its application based on PEDV M genes | |
| CN114015809A (en) | ERA method, composition and kit for rapidly detecting GI group norovirus | |
| CN112662794A (en) | Fluorescence recombinase mediated isothermal amplification detection kit for wilting bacteria in China in corn | |
| CN112980844A (en) | Detection kit for SARS-CoV-2 with transcription activity and use method | |
| CN113337641A (en) | Porcine circovirus type 2 LAMP (loop-mediated isothermal amplification) detection primer group and kit | |
| CN112063757A (en) | Primer and kit for detecting African swine fever virus and application of primer and kit | |
| CN112029829A (en) | Nucleic acid isothermal amplification method based on hairpin structure and application of kit thereof | |
| CN104762414A (en) | Reverse transcription loop-mediated isothermal amplification (RT-LAMP) kit for fluorescent visual fast detection of Japanese encephalitis B virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20190118 |
|
| WW01 | Invention patent application withdrawn after publication |