CN109207457A - A kind of endo-xylanase and its application in xylobiose production - Google Patents
A kind of endo-xylanase and its application in xylobiose production Download PDFInfo
- Publication number
- CN109207457A CN109207457A CN201811244104.1A CN201811244104A CN109207457A CN 109207457 A CN109207457 A CN 109207457A CN 201811244104 A CN201811244104 A CN 201811244104A CN 109207457 A CN109207457 A CN 109207457A
- Authority
- CN
- China
- Prior art keywords
- sequence
- protein
- carrier
- xylobiose
- endo
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2477—Hemicellulases not provided in a preceding group
- C12N9/248—Xylanases
- C12N9/2482—Endo-1,4-beta-xylanase (3.2.1.8)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/12—Disaccharides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01008—Endo-1,4-beta-xylanase (3.2.1.8)
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to biological chemical fields, and in particular to a kind of protein RSipoEnXyn10A and its application as endo-xylanase in xylobiose production.The protein RSipoEnXyn10A, be it is following 1) or 2) shown in protein: 1) protein that the amino acid sequence shown in sequence 3 in sequence table forms；2) amino acid sequence shown in sequence 3 in sequence table is formed by one or more replacing, missing or adding for amino acid residue, and the protein with the same function as derived from 1).The present invention obtains the gene of a coding endo-xylanase from the genome sequence of sweet potato streptomyceteSipoEnXyn10A, the gene can be expressed in host cell to produce protein RSipoEnXyn10A,Protein RSipoEnXyn10A is as endo-xylanase in the production of xylobiose, the endo-xylanase is a kind of endo-xylanase for having both high temperature, neutrality, the property that hydrolysis agriculture and forestry residue xylan release xylobiose is primary product, is of great significance to the production of xylobiose.
Description
Technical field
The present invention relates to biological chemical field more particularly to a kind of endo-xylanase and its answering in xylobiose production
With a kind of, and in particular to protein RSipoEnXyn10A and its as endo-xylanase using agriculture and forestry residue as raw material
Produce the application in xylobiose.
Background technique
Xylo-oligosaccharide refers to xylose with straight chain widow's polymer made of β-(Isosorbide-5-Nitrae) xyloside key connection, it is considered that polymerization
Degree is that the molecule of 2 to 20 xyloses is xylo-oligosaccharide, and molecule of the degree of polymerization greater than 20 is xylan (Carvalho AFA, de
Oliva Neto P, da Silva DF, Pastore GM (2013) Xylo-oligosaccharides from
lignocellulosic materials: Chemical structure, health benefits and production
By chemical and enzymatic hydrolysis. Food Res Int 51:75-85.).Human body cannot digest wood
Oligosaccharides, so xylo-oligosaccharide is referred to as indigestible oligosaccharides (NDOs, non-digestible oligosaccharides).It is low
Xylan is very useful functional food, and the xylo-oligosaccharide of different polymerization degree has the function of different.The degree of polymerization is longer (being greater than 7)
Xylo-oligosaccharide can be used as dietary fiber.There are many functions for the xylo-oligosaccharide of the degree of polymerization shorter (2 to 7): 1. can be exclusively by people
Probiotic bifidobacteria in body enteron aisle utilizes, thus promote intestinal health (Gull ó n P, Moura P, Esteves MP,
Girio FM, Domínguez H, et al. (2008) Assessment on the fermentability of
xylooligosaccharides from rice husks by probiotic bacteria. J Agric Food Chem
56:7482-7487.)；2. promote calcium absorption and lipid-metabolism (Grootaert C, Delcour JA, Courtin CM,
Broekaert WF, Verstraete W, et al. (2007) Microbial metabolism and prebiotic
potency of arabinoxylan oligosaccharides in the human intestine. Trends Food
Sci Tech 18:64-71.)；3. anti-inflammatory, antiallergy and anti-oxidant, can promote skin and cardiovascular health and immune function
(Mendis M, Leclerc E, Simsek S (2016) Arabinoxylans, gut microbiota and
Immunity. Carbohyd Polym 139:159-166.)；4. as the edible substituted type sweetener of diabetic
Without causing blood glucose rise (Carvalho AFA, de Oliva Neto P, da Silva DF, Pastore GM
(2013) Xylo-oligosaccharides from lignocellulosic materials: Chemical
structure, health benefits and production by chemical and enzymatic
Hydrolysis. Food Res Int 51:75-85.).In all xylo-oligosaccharides, xylobiose is most prebiotic by enteron aisle fastly
The xylo-oligosaccharide that bacterium utilizes, have most apparent probiotic effects, thus it is of greatest concern (Moura P, Barata R,
Carvalheiro F, Gírio F, Loureiro-Dias MC, et al. (2007) In vitro fermentation
of xylo-oligosaccharides from corn cobs autohydrolysis by Bifidobacterium andLactobacillusStrains. LWT-Food Sci Technol 40:963-972.).
Xylobiose is obtained by hydrolyzed xylan.Xylan is a kind of plant polyose, only have one by xylose with β-
Main chain made of (Isosorbide-5-Nitrae) xyloside key connection, the part xylose residues on main chain are by L-arabinose, D-Glucose, D- half
Lactose, D-MANNOSE, D-Glucose aldehydic acid and the modification of D- galacturonic acid.Due to plant origin difference, for modifying xylose
Sugared difference (Deutschmann R, Dekker RFH (2012) From plant biomass to bio-based of residue
chemicals: Latest developments in xylan research. Biotechnol Adv 30: 1627–
1640.).Xylan is the second largest polysaccharide of plant cell wall, and xylan content is in the secondary cell wall of dicotyledon
20-30% contains 20-40% and 40-50%(Scheller respectively in monocotyledonous primary cell wall and secondary cell wall
HV, Ulvskov P (2010) Hemicelluloses. Annu Rev Plant Biol 61:263-289.), therefore agricultural
Industry residue can be used for producing xylobiose.
Agricultural residues refer to the organic substance given up in agricultural production, are mainly amylum crops in grain-production
Stalk or other residual fractions；Forestry residue refers to the organic substance given up in production of forestry, main in bamboo product production
To be bamboo scraps, be mainly sawdust in plate production.Since agriculture and forestry residue is easily obtained, shelf-stable, and it is used for
Production xylobiose can turn waste into wealth and reduce environmental pollution caused by due to burning, so research is worth to be used for production wood two
Sugar (Carvalho AFA, de Oliva Neto P, de Silva DF, Pastore GM (2013) Xylo-
oligosaccharides from lignocellulosic materials: Chemical structure, health
benefits and production by chemical and enzymatic hydrolysis. Food Res Int
51:75-85.).
The method that agriculture and forestry residue is used to produce xylobiose there are into 3 kinds, respectively chemical hydrolysis, certainly hydrolysis and enzyme water
Solution.Since chemical hydrolysis method is needed using high concentration chemicals (such as strong acid and strong base), therefore there are environment is unfriendly and to instrument
The high disadvantage of device equipment requirement；It needs (generally much higher than 100oC) and high pressure, therefore to there is energy consumption height using high temperature from method for hydrolysis
With the demanding disadvantage of instrument and equipment；And enzymatic hydrolysis process carries out in a mild condition, therefore be environmental-friendly and low power consuming side
Method (Mano MCR, Neri-Numa IA, da Silva JB, Paulino BN, Pessoa MG, et al. (2018)
Oligosaccharide biotechnology: an approach of prebiotic revolution on the
Industry. Appl Microbiol Biotechnol 102:17-37.).The process of enzymatic hydrolysis process is broadly divided into raw material
Processing, the hydrolysis of enzyme and three step of recovery purifying (Otieno DO, Ahring BK (2012) The potential of product
for oligosaccharide production from the hemicellulose fraction of biomasses
through pretreatment processes: xylooligosaccharides (XOS),
arabinooligosaccharides (AOS), and mannooligosaccharides (MOS). Carbohydr Res
360:84-92.).
Zytase is the general designation of the enzyme of all hydrolyzed xylans, wood in enzyme and hydrolysis removing main chain including hydrolyzing main chain
On saccharide residue modification group enzyme (Juturu V, Wu JC (2012) Microbial xylanases:Engineering,
Production and industrial applications. Biotechnol Adv 30:1219-1227.).All
In zytase, endo-xylanase (Endo-xylanase, EC:3.2.1.8) is hydrolyzed in a random basis any two on main chain
β-(Isosorbide-5-Nitrae) xylose glycosidic bond between a xylose residues, thus be most important enzyme in production xylobiose technique, or even only with this enzyme
Xylobiose (Subramaniyan S, Prema P (2002) Biotechnology of microbial can be produced
xylanases: enzymology, molecular biology, and application. Crit Rev
Biotechnol 22:33-64.).
The endo-xylanase that the production technology of xylobiose needs should will have high temperature, neutrality and can be remained with agriculture and forestry
Object is the characteristic of raw material high yield xylobiose, because high temperature can prevent the loss for causing xylobiose because of microorganism growth
(Bhalla A, Bansal N, Kumar S, Bischoff KM, Sani RK (2013) Improved
lignocellulose conversion to biofuels with thermophilic bacteria and
Thermostable enzymes. Bioresour Technol 128:751-759.)；High temperature can make high temperature inscribe xylan
Enzyme plays highest enzyme activity, to improve hydrolysis efficiency, shortens the production time, improves utilization rate of equipment and installations and release additionally serves as dropping
Instrument and equipment (Viikari L, Alapuranen M, Puranen T, Vehmaanper J, the Siika-aho M of temperature
(2007) Thermostable enzymes in lignocellulose Hydrolysis. In Biofuels
Springer-Verlag Berlin Heidelberg 108:121-145.)；Strong acid and strong alkali environment can not only make xylobiose
Spontaneous hydrolysis be xylose and cause damages, can also corrode production equipment (Courtin CM, Swennen K, Verjans P,
Delcour JA (2009) Heat and pH stability of prebiotic
arabinoxylooligosaccharides, xylooligosaccharides and fructooligosaccharides.
Food Chem 112:831-837.)；Xylobiose proportion in hydrolysate is higher, the difficulty and cost being purified
Lower, the prebiotic nutritive value and sweetener of gained xylobiose product are worth higher (Otieno DO, Ahring BK
(2012) The potential for oligosaccharide production from the hemicellulose
fraction of biomasses through pretreatment processes: xylooligosaccharides
(XOS), arabinooligosaccharides (AOS), and mannooligosaccharides (MOS).
Carbohydr Res 360:84-92.).
Some high temperature, neutral endo-xylanase have had been reported for hydrolyzing the life of agriculture and forestry residue in laboratory test
Xylo-oligosaccharide is produced, but not mainly contains xylobiose in their hydrolysate.Such as the inscribe wood obtained from cow dung compost
The Substrate concentration of dextranase Xyn10CD18 is respectively 75 DEG C and 7.0, but it hydrolyzes pretreated corncob and releases
Main component is xylose in the product put, and xylo-oligosaccharide is submember, the ingredient of xylobiose it is then lower (Sun MZ,
Zheng HC, Meng LC, Sun JS, Song H, Bao YJ, Pei HS, Yan Z, Zhang XQ, Zhang JS,
Liu YH, Lu FP (2015) Direct cloning, expression of a thermostable xylanase
gene from the metagenomic DNA of cow dung compost and enzymatic production of
Xylooligosaccharides from corncob. Biotechnol Lett 37:1877-1886.)；For another example from hot spring
The Substrate concentration of the endo-xylanase rMxyl obtained in bed mud is respectively 80 DEG C and 7.0, but its hydrolysis is located in advance
Main component is not xylobiose in the product of bagasse release after reason, also more containing a large amount of xylotrioses, Xylotetrose and the degree of polymerization
High xylo-oligosaccharide (Verma D, Kawarabayasi Y, Miyazaki K, Satyanarayana T (2013)
Cloning, expression and characteristics of a novel alkalistable and
thermostable xylanase encoding gene (Mxyl) retrieved from compost-soil
Metagenome. PLoS ONE 8:e52459.).
Summary of the invention
The object of the present invention is to provide a kind of protein RSipoEnXyn10A and its as endo-xylanase in xylobiose
Application in production, the endo-xylanase are that a kind of high temperature, neutrality, hydrolysis agriculture and forestry residue xylan release xylobiose are
The endo-xylanase of primary product is of great significance to the production of xylobiose.
Protein RSipoEnXyn10A provided by the invention, be it is following 1) or 2) shown in protein:
1) protein that the amino acid sequence shown in sequence 3 in sequence table forms；
2) amino acid sequence shown in sequence 3 in sequence table passed through into the substitution of one or more amino acid residues, lack or adds
Add and formed, and the protein with the same function as derived from 1).The substitution of one or more amino acid residues
And/or deletion and/or addition is to be no more than the substitution of 10 amino acid residues in 53-382 of the sequence 3 in sequence table
And/or deletion and/or addition.
It is a further object of the present invention to provide the gene for encoding above-mentioned protein RSipoEnXyn10A, the gene
Nucleotide sequence is as shown in sequence 2 in sequence table.
A kind of expression vector containing above-mentioned protein RSipoEnXyn10A gene, the expression vector be suitable for
The carrier of expression in escherichia coli.
Protein RSipoEnXyn10A gene of the invention is inserted into pET30a(+) in carrier.
Protein RSipoEnXyn10A gene (i.e. gene described in sequence 1 in sequence table) of the invention is inserted into
PET30a(+) in carrierEcoI He of RXhoBetween I restriction enzyme site.
The carrier is aforementioned described in any item expression vectors.
A kind of bacterial strain producing protein RSipoEnXyn10A is by protein RSipoEnXyn10A gene (i.e. sequence
Gene described in sequence 1 in table) nucleotide sequence be built into recombinant expression carrier after be transformed into Escherichia coliEscherichia coliBacterial strain BL21(DE3) it obtains；
The bacterial strain of one plant of production protein RSipoEnXyn10A, preparation method include the following steps:
Sweet potato streptomycete with PCR method to extractStreptomyces ipomoeae4.1381 genome of CGMCC
DNA carries out PCR amplification as template, there is PCR product shown in sequence 1 in sequence table to be inserted into prokaryotic expression load acquisition
Body pET30a(+) in, obtain recombinant expression carrier pET30a(+)-RSipoEnXyn10A, and it is transformed into Escherichia coliEscherichia coliBacterial strain BL21(DE3) after obtain producing the protein RSipoEnXyn10A contain recombination table
Up to the recombinant strains of carrier.
The sequence of primer used in the PCR amplification are as follows:
Upstream primer is 5 '-CCGGAATTCGTGCAGCCGGCCTCCGCCCAT -3 ' (restriction enzyme containing DNAEcoRI
Restriction enzyme site GAATTC),
Downstream primer is 5 '-CCGCTCGAGCCGCCCCGCGATCAACCCCTC -3 ' (restriction enzyme containing DNAXhoI
Restriction enzyme site CTCGAG),
To extract obtained sweet potato streptomyces gene group DNA as template, 2 × Phanta is used®Master Mix reagent into
Row PCR amplification, reaction system are as follows:
The overall sequencing of this 5 steps is from 1. to 5. in PCR response procedures, and specific order is 1. step is only run 1 time,
Successively operating procedure is 2., 3. and 4. primary constitutes a circulation, continues to enter step 5. after 35 circulations, 5. step is only run
1 time.
Application of the protein RSipoEnXyn10A of the present invention as endo-xylanase in xylobiose production,
Specifically using agriculture and forestry residue as raw material produce xylobiose in application, especially with corncob, Cassava stalk, bamboo,
China fir is that the alkali extract of raw material carries out the application in xylobiose production.
The experiment proves that the present invention is from sweet potato streptomyceteStreptomyces ipomoeae CGMCC 4.1381
Genome sequence in have found one coding assume protein geneSipoEnXyn10A, can express in host cell should
Gene is to produce protein RSipoEnXyn10A,Protein RSipoEnXyn10A is used for xylobiose as endo-xylanase
Production in.Enzyme activity coherent detection is carried out to the endo-xylanase, the Optimun pH of enzymatic reaction is 6.5, most
Suitable action temperature angle value is 75-80 DEG C.(6.5,75 DEG C of pH) the endo-xylanase RSipoEnXyn10A under optimal condition
Rate activity to beech wood glycan and araboxylan is respectively 197.75 ± 1.42 U/mg and 627.30 ± 15.11 U/
Mg protein.
Endo-xylanase RSipoEnXyn10A of the invention, the endo-xylanase be one kind have both high temperature, neutrality,
The endo-xylanase for the property that agriculture and forestry residue xylan release xylobiose is primary product is hydrolyzed, this has been reported
Not available for endo-xylanase, it is of great significance to the production of xylobiose.
Detailed description of the invention
Fig. 1 is the agarose gel electrophoresis figure of the genomic DNA of sweet potato streptomycete CGMCC 4.1381；
Fig. 2 is that the PCR for one section of nucleotide sequence that coding assumes protein in 4.1381 genome of sweet potato streptomycete CGMCC is produced
The agarose gel electrophoresis figure of object；
Fig. 3 is recombinant expression carrier pET30a (+)-RSipoEnXyn10AStructure figures；
The SDS-PAGE analysis that Fig. 4 is the recombined endo zytase RSipoEnXyn10A of purifying；
Fig. 5 is the HPLC map of the recombined endo zytase RSipoEnXyn10A hydrolysis beech wood glycan of purifying；
Fig. 6 is the most suitable action pH curve of the recombined endo zytase RSipoEnXyn10A of purifying；
Fig. 7 is the optimum temperature curve of the recombined endo zytase RSipoEnXyn10A of purifying；
Fig. 8 is the pH tolerability curves of the recombined endo zytase RSipoEnXyn10A of purifying；
Fig. 9 is the temperature tolerance curve of the recombined endo zytase RSipoEnXyn10A of purifying；
Figure 10 is the HPLC figure of the product of the recombined endo zytase RSipoEnXyn10A hydrolysis of corncob alkali extract of purifying
Spectrum；
Figure 11 is the HPLC figure of the product of the recombined endo zytase RSipoEnXyn10A hydrolysis Cassava stalk alkali extract of purifying
Spectrum；
Figure 12 is the HPLC figure of the product of the recombined endo zytase RSipoEnXyn10A hydrolysis bamboo alkali extract of purifying
Spectrum；
Figure 13 is the HPLC figure of the product of the recombined endo zytase RSipoEnXyn10A hydrolysis China fir alkali extract of purifying
Spectrum.
Specific embodiment
Unless otherwise specified, then experimental method used in all embodiments be conventional method, material used and
Reagent etc. is commercially available, the percentage (%) is mass percentage.Quantitative test in all embodiments
Three repeated experiments are respectively provided with, the result presented is to be averaged or average value ± standard deviation.
1, bacterial strain, carrier, restriction enzyme, antibiotic and kit
Sweet potato streptomyceteStreptomyces ipomoeaeCGMCC 4.1381 is purchased from China General Microbiological culture presevation pipe
Reason center (China General Microbiological Culture Collection Center, CGMCC).It is restricted
Restriction endonucleaseEcoR I (catalog number 1040S) andXhoI (catalog number 1094S) purchased from TaKaRa company (Liaoning, in
State).T4 DNA ligase (catalog number 2011A) is purchased from TaKaRa company (Liaoning, China).Escherichia coli
(Escherichia coli) bacterial strain Trans 1T1 and BL21(DE3) and chemical method competent cell be purchased from Quan Shi King Company
(Beijing, China), catalog number is respectively CD501-02 and CD601-02.Expression vector pET30a (+) is purchased from Merck company
(Darmstadt, Germany), catalog number 69909-3.Kanamycin sulfate (Kanamycin A sulfate) (produces
Product catalog number (Cat.No.) is K8020-5g), IPTG(isopropyl-β-D-thiogalactoside) (catalog number I8070) be purchased from
Solarbio company (Beijing, China).2 × Phanta®Master Mix kit (catalog number P511-02) and
Green Taq Mix kit (catalog number P131-01) is purchased from Nuo Weizan company (Jiangsu, China).DNA purification and recovery
Kit (catalog number DP214-03) and the small extraction reagent kit (catalog number DP103-02) of plasmid are public purchased from Tiangeng
Department (Beijing, China).Genomic DNA Rapid extraction kit (catalog number SK8230) is purchased from raw work bioengineering share
Co., Ltd (Shanghai, China).BCA kit (catalog number 23225) is purchased from Pierce company (Rockford, USA).
Ni-Agarose Resin filler (catalog number CW0010) is ShiJi Co., Ltd (Beijing, China) purchased from health.
2, polysaccharide and oligosaccharides
Beech wood glycan (catalog number P-XYLNBE-10G), araboxylan (catalog number P-
WAXYRS), β-barley (catalog number P-BGBL), mannosan (catalog number P-MANIV), lichens are more
Sugar (catalog number P-LICHN), xyloglucan (catalog number P-XYGLN), chitin (catalog number P-
CHITN), starch (catalog number P-AMYL), polygalacturonic acid (catalog number P-PGACT) are purchased from Megazyme
Company (Wicklow, Ireland).Sodium carboxymethylcellulose (catalog number C-5678) is purchased from Sigma company.Xylobiose
(catalog number O-XBI), xylotriose (catalog number O-XTR), Xylotetrose (catalog number O-XTE) are purchased from
Megazyme company (Wicklow, Ireland).
3, culture medium
The culture of sweet potato streptomycete is formulated using improvement Gause I culture medium as (g/L): soluble starch 20, beef extract
2, peptone 5, KNO31, K2HPO4•3H2O 0.5, MgSO4•7H2O 0.5, NaCl 0.5, FeSO4•7H2O 0.01, pH
7.2-7.4.Plate is that 3% agar powder is added in liquid culture medium with solid medium.
The culture of Escherichia coli uses LB culture medium, is formulated as (g/L): yeast extract 5, tryptone 10, chlorination
Sodium 10, pH 7.0.Plate is that 3% agar powder is added in liquid culture medium with solid medium.
4, the measurement of endo-xylanase enzyme activity
Enzyme activity is measured using DNS method, measures protein content with BCA method.It is described in detail below:
(1), the measurement of enzyme activity
1. the production of xylose standard curve
The xylose standard solution that 1 mg/mL is prepared with deionized water, with the standard solution and deionized water in 1.5 mL centrifuge tubes
It is middle to prepare the xylose solution that 9 volumes are the 400 continuous concentration of μ L, respectively 0 mg/mL(, that is, deionized water itself), 0.125
Mg/mL, 0.25 mg/mL, 0.375 mg/mL, 0.5 mg/mL, 0.625 mg/mL, 0.75 mg/mL, 0.875 mg/mL and 10
Mg/mL, each sample concentration are all provided with three in parallel.The DNS reagent of 800 μ L is added in all samples, boiling water bath 5 after mixing
Minute, it is placed in tap water and is cooled to room temperature, each sample takes 200 μ L to be added in 96 hole serum plates, is measured with microplate reader
Absorbance value at 540 nm.Using xylose concentration as horizontal axis (X-axis) in Excel software, made using absorbance value as the longitudinal axis (Y-axis)
Scatter plot, it is y=3.5321x-0.0325(coefficient R that addition Trendline, which obtains standard curve,2For 0.999).
The formula of DNS reagent is shown in document (Xian L, Wang F, Luo X, Feng YL, Feng JX (2015)
Purification and characterization of a highly efficient calcium-independent
α-amylase from Talaromyces pinophilus1-95. PLoS ONE 10:e0121531.).
2. the measurement detailed rules and regulations of enzyme activity
The measurement reaction of enzyme activity is divided into reaction group and control group.Reaction group is that 350 μ L are added in the centrifuge tube of 1.5 mL to contain
The buffer (pH value is needed according to experiment different in the present invention and set) of 0.5 % beech wood glycan, in steady temperature
After preheating 3 minutes in water-bath (temperature is needed according to experiment different in the present invention and set), it is 0.01 that 50 μ L concentration, which are added,
The enzyme solution of g/L simultaneously quickly mixes.The DNS reagent that 800 μ L are added in insulation reaction after ten minutes terminates reaction and boiling water bath 5 minutes
Keep colour developing abundant.Control group be by after enzyme solution boiling water bath 5min inactivation with react group and make same processing, as control.Reaction group and
Control group is placed in tap water be cooled to room temperature after, take 200 μ L test solutions to be added in 96 hole serum plates, with microplate reader measurement 540
Absorbance value at nm.The absorbance value for not inactivating enzyme solution group is subtracted to the absorbance value of inactivation enzyme solution control group, gained difference
It substitutes into xylose standard curve and the amount for generating reduced sugar in reaction system is calculated, and then enzyme activity is calculated.One inscribe
The unit of activity (U) of zytase is defined as: under the determination condition of setting, hydrolyzed xylan releases 1 μm of ol also per minute
Enzyme amount needed for raw sugar.
Specific activity of enzyme is defined as: under the determination condition of setting, enzyme activity (U/mg) possessed by every mg protein.
(2), the measurement of protein content
The measurement of protein uses BCA method (Smith PK, Krohn RI, Hermanson GT, Mallia AK, Gartner
FH, Provenzano MD, Fujimoto EK, Goeke NM, Olson BJ, Klenk DC(1985) Measurement
Of protein using bicinchoninic acid.Analytical Biochemistry, 150:76-85).Measurement side
Method is carried out according to product description.Using Bovine serum albumin concentration as horizontal axis (X-axis), using 562 nm absorbance values as the longitudinal axis (Y
Axis) make scatter plot, it is y=0.9074x+0.0521(coefficient R that addition Trendline, which obtains standard curve,2For 0.9939).
Embodiment 1, geneSipoEnXyn10AAcquisition
(1), the extraction of sweet potato streptomyces gene group DNA
By sweet potato streptomycete be seeded to improvement Gause I solid medium plate, 28 DEG C stationary culture 5 days, newly rarely had
The spore of vigor.By spore inoculating to Gause I liquid culture medium (in the triangular flask of 250 mL specifications liquid amount be 50 mL),
Be placed in 28 DEG C, 180 rpm shaking table culture is after 2 days, the mycelium of growth can be used for extracting genomic DNA.
The genomic DNA of sweet potato streptomycete is extracted using genomic DNA Rapid extraction kit, operation is used according to product
Specification carries out.Resulting DNA solution will be extracted and carry out the agarose gel electrophoresis that concentration is 0.8 %, as a result as shown in Figure 1.
The sample of swimming lane 1 is 1 kb ladder in Fig. 1, contains 7 DNA fragmentations, from big to small respectively 15,10,7.5,5,2.5,1
With 0.25 kb；The sample of swimming lane 2 is the genomic DNA of sweet potato streptomycete.There is an obvious item in swimming lane 2 above 15 kb
Band shows successfully to extract to obtain the genomic DNA of sweet potato streptomycete.
(2), geneSipoEnXyn10AAcquisition
It designs pair of primers and is used for PCR amplification geneSipoEnXyn10A, 5 '-CCG of upstream primerGAATTC
GTGCAGCCGGCCTCCGCCCAT -3 ' (restriction enzyme containing DNAEcoThe restriction enzyme site GAATTC of RI), downstream primer is
5’- CCGCTCGAGCCGCCCCGCGATCAACCCCTC -3 ' (restriction enzyme containing DNAXhoThe restriction enzyme site of I
CTCGAG), to extract obtained sweet potato streptomyces gene group DNA as template, 2 × Phanta is used®Master Mix examination
Agent carries out PCR amplification, and reaction system is as follows:
The overall sequencing of this 5 steps is from 1. to 5. in PCR response procedures, and specific order is 1. step is only run 1 time,
Successively operating procedure is 2., 3. and 4. primary constitutes a circulation, continues to enter step 5. after 35 circulations, 5. step is only run
1 time.
The product that PCR is obtained carries out the agarose gel electrophoresis that concentration is 0.8 %, as a result as shown in Figure 2.It swims in Fig. 2
The sample in road 1 is 1 kb DNA ladder, contains 14 bands, be followed successively by 10 from big to small, 8,6,5,4,3.5,3,2.5,2,
1.5,1,0.75,0.5 and 0.25 kb；The sample of swimming lane 2 is geneSipoEnXyn10APCR product.Electrophoresis result is swimming lane
2 have band at about 1 kb, which meets the length of expected product.PCR product is sent into the prosperous measurement of Beijing AudioCodes
Its DNA sequence dna, measurement result show that the segment is target gene, and nucleotides sequence is classified as sequence 1.
The functional verification of embodiment 2, recombinant protein RSipoEnXyn10A
One, recombinant expression carrier pET30a(+)-RSipoEnXyn10ABuilding
Carrier pET30a(+) is used into restriction enzymeEcoI He of RXhoI carries out double digestion, and double enzyme digestion product DNA is purified back
0.8% agarose gel electrophoresis inspection is carried out after receiving kit recycling, the carrier ribbon (figure of only 5.4 kb long in swimming lane
3A, the sample of swimming lane 1 are 1 kb DNA ladder, contain 14 DNA fragmentations, from big to small respectively 10,8,6,5,4,3.5,
3,2.5,2,1.5,1,0.75,0.5 and 0.25 kb；The sample of swimming lane 2 is to use restriction enzymeEcoI He of RXhoI will be unloaded
Body pET30a(+) carry out the product recycled again with DNA purification and recovery kit after double digestion).
By what embodiment 1 obtained there is PCR product shown in sequence 1 to carry out 0.8% agarose gel electrophoresis, by band institute
It cuts in blob of viscose, is recycled with DNA purification and recovery kit.It recycles obtained product and equally uses restriction enzyme againEcoI He of RXhoI carries out double digestion, and double enzyme digestion product is recycled with DNA purification and recovery kit.Recovery product is solidifying by 0.8% agarose
Gel electrophoresis is examined, and obtaining the exogenous DNA band of about 1 kb long, (Fig. 3 B, the sample of swimming lane 1 are 1 kb DNA ladder, contain 14
A DNA fragmentation, the from big to small kb of respectively 10,8,6,5,4,3.5,3,2.5,2,1.5,1,0.75,0.5 and 0.25；Swimming lane 2
Sample be use restriction enzymeEcoI He of RXhoPCR product shown in sequence 1 is carried out recycling, double digestion, again after electrophoresis by I
The product recycled).
The double digestion carrier pET30a(+ of the double digestion genetic fragment of recycling and recycling) T4 DNA ligase is connected
(being carried out according to specification), connection product with chemical method convert Escherichia coli (Escherichia coli) bacterial strain Trans 1T1
Competent cell, obtain the conversion bacterial strain containing not verified carrier.Not testing for conversion bacterial strain is extracted with the small extraction reagent kit of plasmid
The carrier of card, then using not verified carrier as template, with 5 '-TAATACGACTCACTATAGGG -3 ' of T7 upstream primer under
Primer 5 '-TGCTAGTTATTGCTCAGCGG-3 ' is swum, carries out PCR amplification according to system described in embodiment 1 and step.Amplification produces
Object obtains the band of about 1.2 kb long through 0.8% agarose gel electrophoresis.According to described in carrier specification, the length of the band subtracts
After going the length with upper carrier sub-sequence, (sample of Fig. 3 C, swimming lane 1 is for the length of the extremely approximate exogenous DNA of gained size
1 kb DNA ladder contains 14 DNA fragmentations, from big to small respectively 10,8,6,5,4,3.5,3,2.5,2,1.5,1,
0.75,0.5 and 0.25 kb；The sample of swimming lane 2 is the product obtained using extracting obtained not verified carrier as template amplification).
The carrier restriction enzyme verified by PCR amplificationEcoI He of RXhoI carries out double digestion, and double enzyme digestion product is through 0.8% agar
Sugared gel electrophoresis obtains the pET30a(+ of 5.4 kb of a treaty) the exogenous DNA band of 1 kb long of carrier ribbon and a treaty, table
The bright carrier by PCR amplification verifying contains the foreign gene of estimated size, and (Fig. 3 D, the sample of swimming lane 1 are 1 kb DNA
Ladder contains 14 DNA fragmentations, from big to small respectively 10,8,6,5,4,3.5,3,2.5,2,1.5,1,0.75,0.5 and
0.25 kb；The sample of swimming lane 2 is not verified carrier restriction enzymeEcoI He of RXhoThe production that I progress double digestion obtains
Object).It will contain and pass through PCR amplification inspection and double digestion inspection recombinant vectorEscherichia coliTrans 1T1 conversion
Bacterial strain send Beijing AudioCodes prosperous company, with 5 '-TAATACGACTCACTATAGGG -3 ' of T7 upstream primer and downstream primer 5 ' -
TGCTAGTTATTGCTCAGCGG-3 ' sequencing, sequencing result show that be inserted into sequence is sequence 1, recombinant expression carrier building
Success.
Using carrier pET30a(+)EcoI He of RXhoWhen I restriction enzyme site expression alien gene, due to using carrier
PET30a(+ the promoter carried on), so that the N-terminal of recombinant protein can additionally have more 52 amino acid residues；Due to making
The terminator carried with carrier, so the C-terminal of recombinant protein can additionally have more 8 amino acid residues, (details are shown in load
Body pET30a(+) product manual).The sequence of initiation codon to terminator on carrier is the new of encoding recombinant protein
Gene, for convenience by the gene of encoding recombinant protein and script geneSipoEnXyn10AIt distinguishes, building is successfully heavy
Group expression vector is named as pET30a(+)-RSipoEnXyn10A, the unnamed gene of encoding recombinant protein isRSipoEnXyn10A, it is English word recombinant that encoded recombinant protein, which is named as RSipoEnXyn10A(" R ",
Initial, mean " recombination ").GeneRSipoEnXyn10AComplete sequence see sequence 2, encoded recombinant protein
The complete amino acid sequence of RSipoEnXyn10A is shown in sequence 3.
2 overall length of sequence is 1173 bp.In sequence 2,1-156 bit base is carrier pET30a(+) sequence that itself has
Column (1-3 bit base is carrier pET30a(+) are initiation codon used in expression insertion gene, and 151-156 areEcoR
I restriction enzyme site), 157-1146 bit base isSipoEnXyn10AGene order, 1147-1173 are carrier pET30a(+)
Sequence (1147-1152 areXhoI restriction enzyme site, 1171-1173 are terminator codon).1-52 of sequence 3
For coded by carrier pET30a(+) itself institute carrying base sequence (the 1-156 bit base of sequence 2), wherein 2-7 is just
In 6 histidines purified with nickel column filler (coded by the 4-21 bit base of sequence 2)；53-382 areSipoEnXyn10ACoded by said gene (the 157-1146 bit base of sequence 2)；383-390 are carrier pET30a(+) from
Coded by body institute carrying base sequence (the 1147-1170 bit base of sequence 2), wherein 385-390 are convenient for being filled out with nickel column
Expect 6 histidines of purifying (coded by the 1153-1170 bit base of sequence 2).By line computation (https: //
Web.expasy.org/protparam/), the theoretical molecular weight of the recombinant protein RSipoEnXyn10A of sequence 3 is 43.46
kDa。
Two, the acquisition of recombinant protein RSipoEnXyn10A
By recombinant expression carrier pET30a(+)-RSipoEnXyn10AEscherichia coli are converted by chemical transformation
(Escherichia coli) expression bacterial strain BL21(DE3) and chemical method competent cell (to specifications carry out), contained
There are the recombinant strains of recombinant expression carrier.The empty carrier pET30a(+ of foreign gene will be also free of simultaneously) turned by chemistry
Change method conversion Escherichia coli (Escherichia coli) expression bacterial strain BL21(DE3) chemical method competent cell, contained
There are the recombinant strains of empty carrier, for comparing experiment.
OD of the recombinant strains containing recombinant expression carrier or empty carrier in culture solution600Final concentration is added when being 0.8
For the IPTG(isopropyl-β-D-thiogalactoside of 1 mM) it is induced, in the constant-temperature table for being set as 20 DEG C, 100 rpm
Middle expression recombinant protein 16 hours.After induction, culture solution is centrifuged 5 minutes at 6000 × g, obtains recombinant strains
Cell.Cell is hanged again using suspension (start buffer when being also using nickel column filler purification of recombinant proteins matter)
It is floating, suspension formulation are as follows: NaH2PO4300 mM of 50 mM, NaCl, imidazoles 10 mM, pH 8.0.It will using ultrasonic fragmentation
Clasmatosis in suspension, the parameter of ultrasonic wave are as follows: 250 hertz work 4 seconds, interval 6 seconds, and every task and interval constitute one
A circulation carries out 150 circulations, whole to keep low temperature to prevent protein heat inactivation suspension cell ice water.It is broken to finish
Afterwards, it is crushed liquid and measures Xylanase activity, be crushed in liquid obtained by the recombinant strains as a result containing carrier pET30a(+) without wood
Glycan enzyme activity, and contain recombinant expression carrier pET30a(+)-RSipoEnXyn10ARecombinant strains obtained by be crushed liquid
In have Xylanase activity, illustrate inducing expression success.
Broken liquid is centrifuged the precipitating of removal in 5 minutes at 6000 × g, and supernatant removes impurity with 0.45 μm of water phase filter membrane, so
Affinity chromatography is carried out to recombinant protein RSipoEnXyn10A using the Ni-Agarose Resin filler that health is ShiJi Co., Ltd afterwards
Purifying.Eluent used is that start buffer contains 500 mM imidazoles, by start buffer and elution buffer according to different proportion
It mixes to get the buffer of the imidazoles containing various concentration is arrived, for carrying out the elution of varying strength to recombinant protein.Purification step
It is as follows:
(1) the Ni-Agarose Resin filler of 10 mL is added into the void column of dispatching, it is to be saved with after dried liquid stream, it is added 5
The deionized water of times column volume flows through filler, achievees the purpose that thoroughly to clean；
(2) it drains off to deionized water, the start buffer balance filler of 2 times of column volumes is added；
(3) filler is poured into equipped in the above-mentioned centrifuge tube containing recombinant protein RSipoEnXyn10A supernatant of 100 mL, is incited somebody to action
Centrifuge tube is embedded in ice, in quick oscillation 1 hour on shaking table to reach sufficiently absorption purpose；
(4) supernatant is transferred together together with filler into void column, flows to end liquid naturally；
(5) filler is washed with the start buffer of 5 times of column volumes, flows to end liquid naturally；
(6) it is successively washed respectively with 50 mM of 5 times of column volumes, 100 mM, 200 mM, 300 mM, 400 mM, 500 mM imidazoles
Filler, collect eluent be stored in 4 DEG C it is spare.
With lipidated protein (the 1970. Cleavage of of Laemmli UK. in SDS-PAGE method detection eluent
structural proteins during the assembly of the head of bacteriophage T4.
Nature 227:680-685), as a result as shown in Figure 4.Swimming lane 1 and 5 in Fig. 4 is molecular weight protein marker, includes 7
Band is followed successively by 97,66.5,45,35,25,18.4 and 14.4 kDa from top to bottom；Swimming lane 2 is to contain empty carrier pET30a's)
Liquid is crushed obtained by recombinant strains, swimming lane 3 is to contain recombinant vector pET30a(+)-RSipoEnXyn10ARecombinant expression bacterium
Strain gained is crushed liquid, and swimming lane 4 is the eluent of 200 mM imidazoles.From fig. 4 it can be seen that than the sample of swimming lane 2 in the sample of swimming lane 3
An apparent protein band, the band very high purity in swimming lane 4 are had more in product, and corresponding molecular weight is about 44
KDa, with the recombinant protein by being obtained in line computation (https: //web.expasy.org/protparam/)
43.46 kDa of theoretical molecular weight of RSipoEnXyn10A is consistent, and shows to have obtained recombination egg according to above method successful purification
White matter RSipoEnXyn10A.
It purifies obtained recombinant protein RSipoEnXyn10A and passes through the centrifugal type ultrafiltration for being 10 kDa with molecular cut off
Pipe concentration, is added after concentration and deionized water desalination and is concentrated, and repeats deionized water desalination is added and be concentrated and obtains desalination and dense for 3 times
The RSipoEnXyn10A of contracting, for measuring the experiment of following all zymologic properties in this specification.
Three, the zymologic property of recombinant protein RSipoEnXyn10A
1, the mode of recombinant protein RSipoEnXyn10A hydrolyzed xylan
Beech wood glycan is dissolved in 0.1 M citric acid-Na2HPO4In (pH 6.5) buffer, concentration 1%.
The dosage of RSipoEnXyn10A be every gram of xylan of 0.8 mg, 70 DEG C of 0,30 min of hydrolysis, 2 h, 4 h, 12 h, 24 h and
48 h.The product of hydrolysis release is detected with high performance liquid chromatography, and instrument is 1260 infinity liquid chromatograph of Agilent
(California, the U.S.), Hypersil NH2(column No. E2918007, Dalian Yi Lite analysis instrument are limited for nh 2 column
Company, Dalian, China) and Alltech ELSD 2000ES evaporative light scattering detector (Illinois, the U.S.).Hydrolysate sample
The sample volume of product is 20 μ L, and the column temperature of nh 2 column is 30 DEG C, and mobile phase is acetonitrile: water=75:25(volume ratio), flow velocity 1
ML/min, Gas drift tube temperature degree are 90 DEG C, and gas velocity is 2 L/min.Testing result is shown in Fig. 5.
Fig. 5 A is standard sample, contains xylose, xylobiose, xylotriose, Xylotetrose, concentration is 1 g/L；Fig. 5 B, C, D, E,
F, G, H are respectively to hydrolyze 0,30 min, 2 h, 4 h, 12 h, 24 h and 48 h gained hydrolysate.It can see from the figure
RSipoEnXyn10A hydrolysis beech wood glycan releases xylobiose, xylotriose, Xylotetrose, as hydrolysis time extends, wood two
Sugared, xylotriose content gradually increases, until final product is mainly xylobiose and a small amount of xylose and xylotriose.This hydrolysis side
Formula meet restriction endonuclease mode (Juturu V, Wu JC (2012) Microbial xylanases:Engineering,
Production and industrial applications. Biotechnol Adv 30:1219-1227.), therefore
RSipoEnXyn10A is endo-xylanase.
2, the Optimun pH of recombinant protein RSipoEnXyn10A
Prepare respectively pH 3.0,3.5,4.0,4.5,5.0,5.5,6.0,6.5,7.0,7.5,8.0,8.5,9.0,9.5,10,
10.5,11.0 buffer containing 0.5 % xylan, wherein pH 3.0-7.0 uses 0.1 M citric acid-Na2HPO4Buffer, pH
6.0-8.0 uses 0.1 M Na2HPO4-NaH2PO4Buffer, pH 7.0-9.0 use 0.1 M Tris-HCl buffer, pH
8.5-11.0 using 0.1 M glycine-NaOH buffer.RSipoEnXyn10A after desalination, concentration is diluted to 0.01 g/
L, at 70 DEG C, by the enzyme activity of preceding method measurement RSipoEnXyn10A at various ph values.It will measurement gained highest enzyme activity
Power is set as 100 %, by the enzyme activity under other pH value compared with highest enzyme activity, converts as enzyme activity.It is X with pH value
Axis is mapped by Y-axis of enzyme activity, as a result as shown in fig. 6, showing that the Optimun pH of RSipoEnXyn10A is 6.5.
3, the optimum temperature of recombinant protein RSipoEnXyn10A
With the citric acid-Na of 0.1 M of pH 6.52HPO4Buffer configures 0.5 %(W/V) xylan solution, by desalination, dense
RSipoEnXyn10A after contracting is diluted to 0.01 g/L, exists according to the method measurement RSipoEnXyn10A of aforementioned measurement enzyme activity
Enzyme activity at 40 DEG C, 45 DEG C, 50 DEG C, 55 DEG C, 60 DEG C, 65 DEG C, 70 DEG C, 75 DEG C, 80 DEG C, 85 DEG C, 90 DEG C, 95 DEG C.By highest
Enzyme activity is set as 100 %, and the enzyme activity at other temperature is converted compared with highest enzyme activity as enzyme activity.It is X with temperature
Axis is mapped by Y-axis of enzyme activity, as a result as shown in fig. 7, showing that the optimum temperature value of RSipoEnXyn10A is 75-
80℃。
4, the pH tolerance of recombinant protein RSipoEnXyn10A
Prepare 0.1 M pH 3.0,3.5,4.0,4.5,5.0,5.5,6.0,6.5,7.0,7.5,8.0,8.5,9.0,9.5,10,
10.5,11.0 buffer, wherein pH 3.0-7.0 uses 0.1 M citric acid-Na2HPO4Buffer, pH 6.0-8.0 are used
0.1 M Na2HPO4-NaH2PO4Buffer, pH 7.0-9.0 use 0.1 M Tris-HCl buffer, and pH 8.5-11.0 is used
0.1 M glycine-NaOH buffer, RSipoEnXyn10A is stored in the buffer of different pH value (and make
The concentration of RSipoEnXyn10A is 0.01 g/L), after 4 DEG C are placed 24 hours, it is slow that each pH is measured in the case where 6.5,75 DEG C of pH
Residual enzyme activity in fliud flushing.Enzyme activity not do the preservation enzyme solution as above handled saves liquid for 100 % under each pH value
Enzyme activity conversion is enzyme activity.Using pH value as X-axis, map by Y-axis of enzyme activity, as a result as shown in Figure 8.As a result table
Bright, between pH 4.0-11.0, the enzyme activity of RSipoEnXyn10A is in 90 % or more, the tolerance within the scope of the pH
Well.
5, the temperature tolerance of recombinant protein RSipoEnXyn10A
By the citric acid-Na of the 0.1 M pH 6.5 of RSipoEnXyn10A after desalination and concentration2HPO4Buffer (contains 0.5%
Xylan, W/V) concentration is diluted to as 0.01 g/L, 15 are kept the temperature at different temperature (65 DEG C, 70 DEG C, 75 DEG C, 80 DEG C) respectively
It is min, 30 min, 45 min and 1 hours, cooling with ice water immediately after soaking time, it is surveyed later in the case where 6.5,75 DEG C of pH
Determine enzyme activity.The enzyme activity for not doing as above processing enzyme solution is set as 100 %, the residual enzyme activity conversion after heat preservation is opposite enzyme activity
Power.Using temperature as X-axis, enzyme activity is Y-axis mapping, as a result sees Fig. 9.The result shows that RSipoEnXyn10A is being lower than 65 DEG C
When have good stability.
6, the substrate specificity of recombinant protein RSipoEnXyn10A
Be respectively configured containing 0.5 %(W/V) beech wood glycan, β-barley, chitin, lichenin, mannosan,
Sodium carboxymethylcellulose, polygalacturonic acid, starch, araboxylan, xyloglucan 0.1 M Na2HPO4-NaH2PO4
Buffer, (6.5,75 DEG C of pH) measures recombinant protein RSipoEnXyn10A(0.01 g/L under optimal condition) to not
With the enzyme activity of substrate.The results are shown in Table 1, RSipoEnXyn10A only has enzyme activity to xylan, and RSipoEnXyn10A is to mountain hair
The Rate activity of beech glycan and araboxylan is respectively 197.75 ± 1.42 U/mg and 627.30 ± 15.11 U/mg.
7, recombinant protein RSipoEnXyn10A hydrolyzes agriculture and forestry and remains produce xylobiose
Agricultural residues used in the present invention are corncob, cassava stalk, and forestry residue is bamboo, China fir.Various remnants
It is as follows that object acquires information: corncob (Zea maysL.) acquisition is fresh picking corn stripping machine from the western campus food market of Guangxi University
It removes niblet, with kitchen knife prune niblet root again；Cassava (Manihot esculentaCrantz) stalk is acquired from Guangxi
University's agricultural Experimental Base, defoliation are peeled；Bamboo (Phyllostachys heterocycla) clast acquisition is from Guangxi Wuzhou
Bamboo stick factory, the residue after being used to produce barbecue bamboo stick for stalk part；China fir clast is acquired from Guangxi Wuzhou board mill, is
Trunk is for producing the residue after plate.
At 60 DEG C, drying to constant weight after various residue acquisitions back, is then crushed, is used with small plant tissue pulverizer
The separating obtained powder of 60 mesh sieve is used to prepare alkali extract.10 grams of residue flours are taken to be suspended in 8% sodium hydroxide of 100 mL
In, it is centrifuged 5 minutes after standing 12 hours at 30 DEG C in 8000 × g, separates supernatant.The pH value of supernatant is adjusted to concentrated hydrochloric acid
After 6.0,4 times of volume dehydrated alcohols are added, mix, mixture stands 12 hours at 4 DEG C, to precipitate sufficiently.Mixture is in 4 DEG C
It is centrifuged 5 minutes under 8000 × g, discards supernatant liquid, drying to constant weight at 60 DEG C for sediment, grinds, with 60 mesh sieve point
From alkali extract is obtained, xylo-oligosaccharide is produced for RSipoEnXyn10A hydrolysis.
Alkali extract is dissolved in 0.1 M citric acid-Na2HPO4In (pH 6.5) buffer, concentration 1%(W/V).
RSipoEnXyn10A dosage be every gram of alkali extract of 0.8 mg, 70 DEG C hydrolyze 0,30 minute, 2 h, 4 h, 12 h, 24 h and
48 h.Each hydrolysis time point takes hydrolysate samples boiling water bath 5 minutes for enzyme-deactivating, detects hydrolysis release with high performance liquid chromatography
Product.The content of each ingredient is calculated with peak area method in product.
The present invention extracted respectively from 10 grams of corncobs, Cassava stalk, bamboo, China fir obtain alkali extract 3.71,2.20,
1.60,0.28 gram, respectively obtained after RSipoEnXyn10A is hydrolyzed 48 hours xylobiose 1.123,0.083,0.229,
0.027 gram (table 2).
As can be known from Table 3, xylobiose is uniquely to detect after hydrolysis of corncob, Cassava stalk, bamboo, China fir alkali extract
The xylo-oligosaccharide arrived, and xylobiose account for total reducing sugar (the sum of xylose, xylobiose, xylotriose, Xylotetrose) ratio be up to 85.99%,
87.76%, 86.99%, 84.52%, it can thus be appreciated that RSipoEnXyn10A is excellent xylobiose production enzyme (table 3).
The HPLC figure that product changes in the hydrolysis process of enzyme is shown in Figure 10,11,12,13, each to scheme specifically:
Figure 10 is the HPLC testing result of RSipoEnXyn10A hydrolysis of corncob alkali extract.Figure 10 A is standard sample, containing wood
Sugar, xylobiose, xylotriose, Xylotetrose, concentration are 1 g/L；Figure 10 B, C, D, E, F, G, H are respectively to hydrolyze 0 minute, 30 points
Clock, 2 hours, 4 hours, 12 hours, 24 hours, 48 hours hydrolysates.
Figure 11 is the HPLC testing result that RSipoEnXyn10A hydrolyzes Cassava stalk alkali extract.Figure 11 A is standard sample,
Containing xylose, xylobiose, xylotriose, Xylotetrose, concentration is 1 g/L；Figure 11 B, C, D, E, F, G, H are respectively to hydrolyze 0 minute, 30
The hydrolysate of minute, 2 hours, 4 hours, 12 hours, 24 hours, 48 hours.
Figure 12 is the HPLC testing result that RSipoEnXyn10A hydrolyzes bamboo alkali extract.Figure 12 A is standard sample, is contained
Xylose, xylobiose, xylotriose, Xylotetrose, concentration are 1 g/L；Figure 12 B, C, D, E, F, G, H are respectively to hydrolyze 0 minute, 30 points
Clock, 2 hours, 4 hours, 12 hours, 24 hours, 48 hours hydrolysates.
Figure 13 is the HPLC testing result that RSipoEnXyn10A hydrolyzes China fir alkali extract.Figure 13 A is standard sample, is contained
Xylose, xylobiose, xylotriose, Xylotetrose, concentration are 1 g/L；Figure 13 B, C, D, E, F, G, H are respectively to hydrolyze 0 minute, 30 points
Clock, 2 hours, 4 hours, 12 hours, 24 hours, 48 hours hydrolysates.
Sequence table
<110>Guangxi University
<120>a kind of endo-xylanase and its application in xylobiose production
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 990
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
gtgcagccgg cctccgccca tggcccgtcc ctgcgggcgc tggccgaccg ggcgggcgta 60
cgcatcggca cggccgtcga catggcggcg ctggcggacg acacgacgta ccggagaacg 120
acggcccgcg agttcaactc ggtgaccgcc gagaacgtca tgaagtggga gtcggtggag 180
ccgcagcgcg gcgtgtacga ctggaagccg gccgacgacc tggtccgcta cgcgcgggcc 240
cacggccagg tggtccgggg ccacaccctg gtctggcaca gccagctgcc gggctggttg 300
acgtcggggg tggcggacgg gtcgatcgac gcgacggagc tgcggggcat cctgcgggac 360
cacatcacca ccgaggtgaa gcggtacaag gggcggatcc agcagtggga cgtggtgaac 420
gaggtcttcg aggaggacgg cagcctgcgg aactcgatct ggctgcagca gctcggcccg 480
tcgtacatcg ccgacgcctt ccgctgggcc cacgccgccg accccagggc caagctcttc 540
ctcaacgact acaacgtgga gggcgtcaac gcgaagtcca cggcgtacta cgaactcgcc 600
aagcggctga gggcggaggg tgtgccggtg cagggcttcg gcatacaggg gcatctggcg 660
atccagtacg gcttcccggg gcaggtcgcg gagaacctgg cgcgtttcga ggcgctgggg 720
atgcagacgg cgttcacgga ggtggacgtg cggatgctgc tgccggtgga cgaggcgaag 780
ctggcgaccc aggcgtcgta cttccggagg ctgctggacg cctgcctcgg cacccggagc 840
tgcaggtcct tcaccgcgtg gggctacacg gaccggtact cgtgggttcc gggggtgttc 900
gaggggcagg gcgcggccac gcccatggac gaggggtacg ggcggaagcc ggcgtatggg 960
aagctgcggg aggggttgat cgcggggcgg 990
<210> 2
<211> 1173
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
atgcaccatc atcatcatca ttcttctggt ctggtgccac gcggttctgg tatgaaagaa 60
accgctgctg ctaaattcga acgccagcac atggacagcc cagatctggg taccgacgac 120
gacgacaagg ccatggctga tatcggatcc gaattcgtgc agccggcctc cgcccatggc 180
ccgtccctgc gggcgctggc cgaccgggcg ggcgtacgca tcggcacggc cgtcgacatg 240
gcggcgctgg cggacgacac gacgtaccgg agaacgacgg cccgcgagtt caactcggtg 300
accgccgaga acgtcatgaa gtgggagtcg gtggagccgc agcgcggcgt gtacgactgg 360
aagccggccg acgacctggt ccgctacgcg cgggcccacg gccaggtggt ccggggccac 420
accctggtct ggcacagcca gctgccgggc tggttgacgt cgggggtggc ggacgggtcg 480
atcgacgcga cggagctgcg gggcatcctg cgggaccaca tcaccaccga ggtgaagcgg 540
tacaaggggc ggatccagca gtgggacgtg gtgaacgagg tcttcgagga ggacggcagc 600
ctgcggaact cgatctggct gcagcagctc ggcccgtcgt acatcgccga cgccttccgc 660
tgggcccacg ccgccgaccc cagggccaag ctcttcctca acgactacaa cgtggagggc 720
gtcaacgcga agtccacggc gtactacgaa ctcgccaagc ggctgagggc ggagggtgtg 780
ccggtgcagg gcttcggcat acaggggcat ctggcgatcc agtacggctt cccggggcag 840
gtcgcggaga acctggcgcg tttcgaggcg ctggggatgc agacggcgtt cacggaggtg 900
gacgtgcgga tgctgctgcc ggtggacgag gcgaagctgg cgacccaggc gtcgtacttc 960
cggaggctgc tggacgcctg cctcggcacc cggagctgca ggtccttcac cgcgtggggc 1020
tacacggacc ggtactcgtg ggttccgggg gtgttcgagg ggcagggcgc ggccacgccc 1080
atggacgagg ggtacgggcg gaagccggcg tatgggaagc tgcgggaggg gttgatcgcg 1140
gggcggctcg agcaccacca ccaccaccac tga 1173
<210> 3
<211> 390
<212> PRT
<213>artificial sequence (Artificial Sequence)
<400> 3
Met His His His His His His Ser Ser Gly Leu Val Pro Ala Gly Ser
1 5 10 15
Gly Met Leu Gly Thr Ala Ala Ala Leu Pro Gly Ala Gly His Met Ala
20 25 30
Ser Pro Ala Leu Gly Thr Ala Ala Ala Ala Leu Ala Met Ala Ala Ile
35 40 45
Gly Ser Gly Pro Val Gly Pro Ala Ser Ala His Gly Pro Ser Leu Ala
50 55 60
Ala Leu Ala Ala Ala Ala Gly Val Ala Ile Gly Thr Ala Val Ala Met
65 70 75 80
Ala Ala Leu Ala Ala Ala Thr Thr Thr Ala Ala Thr Thr Ala Ala Gly
85 90 95
Pro Ala Ser Val Thr Ala Gly Ala Val Met Leu Thr Gly Ser Val Gly
100 105 110
Pro Gly Ala Gly Val Thr Ala Thr Leu Pro Ala Ala Ala Leu Val Ala
115 120 125
Thr Ala Ala Ala His Gly Gly Val Val Ala Gly His Thr Leu Val Thr
130 135 140
His Ser Gly Leu Pro Gly Thr Leu Thr Ser Gly Val Ala Ala Gly Ser
145 150 155 160
Ile Ala Ala Thr Gly Leu Ala Gly Ile Leu Ala Ala His Ile Thr Thr
165 170 175
Gly Val Leu Ala Thr Leu Gly Ala Ile Gly Gly Thr Ala Val Val Ala
180 185 190
Gly Val Pro Gly Gly Ala Gly Ser Leu Ala Ala Ser Ile Thr Leu Gly
195 200 205
Gly Leu Gly Pro Ser Thr Ile Ala Ala Ala Pro Ala Thr Ala His Ala
210 215 220
Ala Ala Pro Ala Ala Leu Leu Pro Leu Ala Ala Thr Ala Val Gly Gly
225 230 235 240
Val Ala Ala Leu Ser Thr Ala Thr Thr Gly Leu Ala Leu Ala Leu Ala
245 250 255
Ala Gly Gly Val Pro Val Gly Gly Pro Gly Ile Gly Gly His Leu Ala
260 265 270
Ile Gly Thr Gly Pro Pro Gly Gly Val Ala Gly Ala Leu Ala Ala Pro
275 280 285
Gly Ala Leu Gly Met Gly Thr Ala Pro Thr Gly Val Ala Val Ala Met
290 295 300
Leu Leu Pro Val Ala Gly Ala Leu Leu Ala Thr Gly Ala Ser Thr Pro
305 310 315 320
Ala Ala Leu Leu Ala Ala Cys Leu Gly Thr Ala Ser Cys Ala Ser Pro
325 330 335
Thr Ala Thr Gly Thr Thr Ala Ala Thr Ser Thr Val Pro Gly Val Pro
340 345 350
Gly Gly Gly Gly Ala Ala Thr Pro Met Ala Gly Gly Thr Gly Ala Leu
355 360 365
Pro Ala Thr Gly Leu Leu Ala Gly Gly Leu Ile Ala Gly Ala Leu Gly
370 375 380
His His His His His His
385 390
Claims (10)
1. a kind of protein RSipoEnXyn10A, it is characterised in that: be it is following 1) or 2) shown in protein:
1) protein that the amino acid sequence shown in sequence 3 in sequence table forms；
2) amino acid sequence shown in sequence 3 in sequence table passed through into the substitution of one or more amino acid residues, lack or adds
Add and formed, and the protein with the same function as derived from 1).
2. encoding the gene of protein RSipoEnXyn10A described in claim 1, it is characterised in that: the core of the gene
Nucleotide sequence is as shown in sequence 2 in sequence table.
3. a kind of recombinant expression carrier containing gene as claimed in claim 2.
4. recombinant expression carrier according to claim 3, it is characterised in that: the expression vector is suitable in large intestine bar
The carrier expressed in bacterium.
5. recombinant expression carrier according to claim 4, it is characterised in that: gene described in sequence 1 is inserted in sequence table
Enter into pET30a(+) carrier.
6. recombinant expression carrier according to claim 5, it is characterised in that: gene described in sequence 1 is inserted in sequence table
Enter into pET30a(+) carrierEcoI He of RXhoBetween I restriction enzyme site.
7. a kind of bacterial strain for producing protein RSipoEnXyn10A, it is characterised in that: be by base described in sequence 1 in sequence table
The nucleotide sequence of cause is transformed into Escherichia coli after being built into recombinant expression carrierEscherichia coliBacterial strain BL21(DE3)
It obtains.
8. the bacterial strain of production protein RSipoEnXyn10A according to claim 7, it is characterised in that: the carrier
For the described in any item recombinant expression carriers of claim 3~5.
9. the bacterial strain of production protein RSipoEnXyn10A according to claim 7 or 8, it is characterised in that including as follows
Step: the sweet potato streptomycete with PCR method to extractStreptomyces ipomoeae4.1381 genome of CGMCC
DNA carries out PCR amplification as template, there is PCR product shown in sequence 1 in sequence table to be inserted into prokaryotic expression load acquisition
Body pET30a(+) in, obtain recombinant expression carrier pET30a(+)-RSipoEnXyn10A, and it is transformed into Escherichia coliEscherichia coliBacterial strain BL21(DE3), obtain producing the protein RSipoEnXyn10A containing recombinant expression
The recombinant strains of carrier.
10. protein RSipoEnXyn10A described in claim 1 answering in xylobiose production as endo-xylanase
With.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811244104.1A CN109207457B (en) | 2018-10-24 | 2018-10-24 | Endo-xylanase and application thereof in production of xylobiose |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811244104.1A CN109207457B (en) | 2018-10-24 | 2018-10-24 | Endo-xylanase and application thereof in production of xylobiose |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109207457A true CN109207457A (en) | 2019-01-15 |
| CN109207457B CN109207457B (en) | 2021-03-30 |
Family
ID=64997094
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811244104.1A Active CN109207457B (en) | 2018-10-24 | 2018-10-24 | Endo-xylanase and application thereof in production of xylobiose |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109207457B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112831486A (en) * | 2020-11-21 | 2021-05-25 | 中国林业科学研究院林产化学工业研究所 | Endoxylosidase and application thereof in preparation of xylo-oligosaccharide |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20070068949A (en) * | 2005-12-27 | 2007-07-02 | 애경산업(주) | A method of producing xylooligosaccharide using the novel bacteria bacillus substilis x2 |
| CN107129976A (en) * | 2017-06-02 | 2017-09-05 | 中国农业科学院饲料研究所 | A kind of neutral high-temperature xylanase and its encoding gene and its application |
| CN107354165A (en) * | 2017-06-09 | 2017-11-17 | 北京工商大学 | The xylanase improved gene and its engineering bacteria of a kind of high yield specific product prepare the application of xylo-oligosaccharide |
-
2018
- 2018-10-24 CN CN201811244104.1A patent/CN109207457B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20070068949A (en) * | 2005-12-27 | 2007-07-02 | 애경산업(주) | A method of producing xylooligosaccharide using the novel bacteria bacillus substilis x2 |
| CN107129976A (en) * | 2017-06-02 | 2017-09-05 | 中国农业科学院饲料研究所 | A kind of neutral high-temperature xylanase and its encoding gene and its application |
| CN107354165A (en) * | 2017-06-09 | 2017-11-17 | 北京工商大学 | The xylanase improved gene and its engineering bacteria of a kind of high yield specific product prepare the application of xylo-oligosaccharide |
Non-Patent Citations (3)
| Title |
|---|
| NCBI: "endo-1,4-beta-xylanase [Streptomyces ipomoeae]", 《GENBANK DATABASE》 * |
| ZHENGQIANG JIANG 等: "Characterisation of a thermostable xylanase from Chaetomium sp. and its application in Chinese steamed bread", 《FOOD CHEMISTRY》 * |
| 王月皎 等: "嗜热木聚糖酶的克隆表达及其在酶解生产低聚木糖中的应用", 《食品工业科技》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112831486A (en) * | 2020-11-21 | 2021-05-25 | 中国林业科学研究院林产化学工业研究所 | Endoxylosidase and application thereof in preparation of xylo-oligosaccharide |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109207457B (en) | 2021-03-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Mathew et al. | Extraction of soluble arabinoxylan from enzymatically pretreated wheat bran and production of short xylo-oligosaccharides and arabinoxylo-oligosaccharides from arabinoxylan by glycoside hydrolase family 10 and 11 endoxylanases | |
| WO2017197546A1 (en) | Β-mannanase mrmman5a and encoding gene and application thereof | |
| Sanjivkumar et al. | Biosynthesis, purification and characterization of β-1, 4-xylanase from a novel mangrove associated actinobacterium Streptomyces olivaceus (MSU3) and its applications | |
| WO2009033071A2 (en) | Novel fungal enzymes | |
| JPWO2017170918A1 (en) | Trichoderma fungus having mutant BXL1 gene and method for producing xylooligosaccharide and glucose using the same | |
| Mirande et al. | Characterization of Xyn10A, a highly active xylanase from the human gut bacterium Bacteroides xylanisolvens XB1A | |
| WO2023004901A1 (en) | A group of gh10 family high-temperature-resistant xylanase mutants and use thereof | |
| CN102864161A (en) | Extremely heat-resistant xylanase gene and expression protein as well as application thereof | |
| Fu et al. | Purification and characterization of an endo-xylanase from Trichoderma sp., with xylobiose as the main product from xylan hydrolysis | |
| JP6689487B2 (en) | Endoxylanase mutant, enzyme composition for decomposing biomass, and method for producing sugar solution | |
| CN114410596A (en) | Lytic polysaccharide monooxygenase and application thereof | |
| CN109207457A (en) | A kind of endo-xylanase and its application in xylobiose production | |
| KR20110092511A (en) | Novel xylanase produced from cellulosimicrobium funkei hy-13 strain | |
| WO2024016397A1 (en) | Lytic polysaccharide monooxygenase from bacillus subtilis and use thereof | |
| CN106148369B (en) | High-temperature alkaline transelminase Pel-863 and its encoding gene and application | |
| CN101481696B (en) | Cold adapted endo beta-xylanase gene XynA and use | |
| Xiao et al. | Cloning and characterization of the first GH10 and GH11 xylanases from Rhizopus oryzae | |
| CN107236692B (en) | Paenibacillus cellulolyticus NP1 and xylanase PtXyn1 as well as encoding gene and application thereof | |
| CN102174494B (en) | Marine cryophilic endo beta-xylanase XynB as well as expressing gene xynB and application thereof | |
| CN104928306A (en) | Expression and application of high-temperature-resistant xylanase gene and protein thereof | |
| Xu et al. | Expression of recombinant Bacillus amyloliquefaciens xylanase A in Escherichia coli and potential application in xylan hydrolysis | |
| KR101472993B1 (en) | Novel xylanase containing a novel alkali resistance glycoside hydrolase family, GH family 10 from Microbacterium sp. strain HY-17 | |
| LU505634B1 (en) | Lytic polysaccharide monooxygenase from bacillus subtilis and application thereof | |
| US20200002695A1 (en) | Xylanase variant and enzyme composition for decomposing biomass | |
| CA2555063C (en) | Xylanase gene sequences from the genomic dna of unpurified rumen microorganisms |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |