CN109182310B

CN109182310B - Application of radiation-resistant Gobi deinococcus keratin gene

Info

Publication number: CN109182310B
Application number: CN201811123472.0A
Authority: CN
Inventors: 林敏�; 王劲; 周正富; 耿秀秀; 张维; 陈明
Original assignee: Biotechnology Research Institute of CAAS
Current assignee: Biotechnology Research Institute of CAAS
Priority date: 2018-09-26
Filing date: 2018-09-26
Publication date: 2021-10-08
Anticipated expiration: 2038-09-26
Also published as: CN109182310A

Abstract

The invention discloses a gene KerA with a function of degrading complex structural protein from desert environmental strains. The invention constructs a recombinant vector containing the gene and expresses the recombinant vector in prokaryotic host cells escherichia coli. Experiments prove that the gene can degrade the function of complex structural protein after being expressed in prokaryotic host cells, and can be used for protease catalytic biodegradation and related industrial production.

Description

Application of radiation-resistant Gobi deinococcus keratin gene

Technical Field

The invention belongs to the technical field of biodegradation, and relates to a radiation-resistant Gobi deinococcus keratinase gene which can degrade proteins with complex structures and exert the hydrolysis function of alkaline protease.

Background

The protease has wide application value in the industries of feed, fabric treatment, detergents, medicines and the like. Alkaline proteases refer to a class of proteases that hydrolyze peptide bonds of proteins under alkaline conditions.

The microbial alkaline protease is generally active at a pH in the range of 7 to 11, and the optimum pH is at most 9.5 to 10.5. Most microbial alkaline proteases are not thermostable, and only a few strains produce alkaline proteases that can withstand high temperatures of 70 ℃. The enzyme activity cannot be exerted under low temperature. These circumstances limit the range of use of alkaline proteases, and it is desired to find alkaline proteases having a broader pH range and temperature range for practical production.

Disclosure of Invention

The invention aims to find a novel microbial alkaline protease for degrading complex structural proteins.

Extreme environment microorganisms are microorganisms separated from various severe environments such as hot springs, deserts, icebergs, antarctic poles and the like, and often have extremely strong stress adversity resistance and ultra-strong environmental adaptability. The microorganisms are subjected to long-term pressure selection to develop a series of survival mechanisms and functional genes which are adaptive to the habitat. The genomes of the strains contain abundant functional enzyme coding genes, and are worthy of further research.

The invention discloses an alkaline protease gene for Gobi Deinococcus goniensis.

The gene KerA of deinococcus goviensis (GeneID: RS 02895; ProteinID: WP-014683986.1) was first discovered and identified for microbial catalyzed biodegradation by the following studies. The specific study work was as follows:

1. obtaining the recombinant engineering strain containing the KerA gene

1) The KerA gene is amplified from the gene group of the deinococcus Gobi by PCR, and the gene sequence number is as follows: GeneID: RS 02895. The size of the gene is 1239bp, the gene codes 412 amino acids, and the gene is cloned on a vector pJET to construct a recombinant clone plasmid pJET-KerA containing a complete KerA gene;

2) the KerA gene was ligated to pET22b plasmid containing inducible T7 promoter and leader pelB peptide to release target protein for inducible expression into the culture medium. Constructing a finished recombinant plasmid pET 22-KerA;

3) transferring the recombinant plasmid pET22-KerA introduced with the KerA gene into a receptor escherichia coli BL21(DE3) to obtain an engineering strain BL21-KerA (see example 1 for details);

2. biodegradation detection experiment and protease activity determination analysis of KerA gene-containing recombinant engineering strain

The following biodegradation detection experiments were carried out:

1) a flat plate degradation ring experiment;

2) feather degradation experiments.

The results of the plate degradation circle experiment show that the recombinant engineering strain expressing the KerA protease can grow on a skim milk plate and generate a remarkable degradation circle, while the control strain BL21-22b does not see the degradation circle (FIG. 1).

Feather degradation experiments show that the strain BL21-KerA is cultured for 24h to start to degrade feathers, and feathers are almost completely degraded after 72h, and only part of feathers are thicker. No degradation of feathers occurred in the culture of the control strain BL21-22b (see example 2 for details).

The recombinant Escherichia coli engineering strain expressing the KerA has the capability of secreting protease, and the protease can degrade proteins with complex structures such as skim milk protein, chicken feathers and the like.

The invention also carries out protease activity determination analysis. Under the induction culture condition of 30 ℃, the engineering bacteria BL21-KerA can detect the enzyme activity of extracellular protease after being induced for 8 hours, and the enzyme activity of the crude enzyme solution is higher to 148.36U/mg (see example 3 for details). Analysis of the types and contents of amino acids in the feather degradation fermentation broth shows that the degradation products mainly produce 18 amino acids such as tyrosine, arginine, proline, cystine, glycine and the like (see example 4 for details).

Sequence Listing information

SEQ ID NO. 1: the nucleotide sequence of the KerA gene.

SEQ ID NO. 2: amino acid sequence of KerA.

Description of the drawings:

FIG. 1 shows the milk plate degradation effect of the engineering strain BL21-KerA and the control strain BL21-22 b;

FIG. 2 shows the degradation effect of the engineering strain BL21-KerA and the control strain BL21-22b on feather substrates;

Detailed Description

The plasmids, strains and objects of the catalytic degradation by microorganisms mentioned in the following examples are only used for further detailed description of the present invention and do not limit the essence of the present invention. Where specific experimental conditions are not indicated, they are in accordance with conventional conditions well known to those skilled in the art or as recommended by the manufacturer. The plasmids and strains mentioned in the examples were derived from:

cloning vector pJET: commercially available from ThermoFisher corporation;

shuttle plasmid pET-22 b: commercially available products from Novagen corporation;

coli BL21(DE 3): is a product sold in Beijing Quanjin company.

Feathers: the feather is purchased in the market for chicken feathers.

Example 1 expression of the KerA Gene sequence of Gobi deinococcus in E.coli

First, experimental material

Coli BL21(DE 3): is a product sold in Beijing Quanjin company.

PCR template DNA: gobi deinococcus genomic DNA

Second, Experimental methods

1. Designing 1 pair of PCR specific primers according to the published KerA gene sequence in the genome of the deinococcus Gobi:

KerA-F：5′ACCGGATCCGATGAACGGACGTCTTACCCT 3′

KerA-R：5′ACCCTCGAGGAAGTTCAGGGTGTACAGCA 3′

2. and amplifying the target gene sequence from the Gobi deinococcus genome DNA by a PCR method.

Reaction conditions are as follows: 10min at 94 ℃, 30sec at 60 ℃, 1.5min at 72 ℃ for 35 cycles, 10min at 72 ℃.

3, after the PCR product is recovered by glue, cloning the PCR product on a vector pJET, and naming the PCR product as pJET-KerA, and sequencing and verifying the PCR product; then, a KerA gene containing a cohesive end and a pET-22b vector containing a T7 promoter are obtained through BamH I/Xho I double enzyme digestion, the KerA gene is connected to the pET-22b vector to construct an escherichia coli high expression vector pET22-KerA, and the expression vector is transformed into escherichia coli BL21(DE 3).

Third, experimental results

The gene KerA of the deinococcus gobius is successfully cloned by utilizing a PCR technology, and a recombinant escherichia coli engineering strain for expressing the KerA is successfully constructed. The correct insertion sequence was verified by PCR, enzyme digestion, sequencing and the strain was named BL 21-KerA. E.coli BL21(DE3) containing the pET-22b control empty plasmid was named BL21-22 b.

Fourth, conclusion of experiment

And completing the construction of the recombinant escherichia coli engineering strain for expressing the KerA.

Example 2 preliminary analysis of the KerA protease Activity of Gobi deinococcus

First, experimental material

Recombinant engineering strains: BL21-KerA strain expressing KerA gene obtained in example 1

Control strain: BL21-22b strain containing empty plasmid as described in example 1.

Second, Experimental methods

1. Plate degradation ring experiment

1) Selecting monoclonal strain, inoculating in liquid LB culture medium containing Amp, and shake culturing at 37 deg.C overnight

2) The seed liquid is transferred to a new LB culture medium and cultured to a logarithmic phase. 1% agar plates containing 1% skim milk were prepared. The strain is spotted on a flat plate, and the diameter of a hydrolysis ring and the diameter of a colony are measured every 12 hours until the strain is stable.

3) Calculating the ratio H/C of the diameter of the hydrolysis ring on the plate to the diameter of the colony, and preliminarily evaluating the protease producing capability of the strain.

2. Feather degradation experiment

Washing the feather with clear water, and drying for later use. And (3) adding 50mL of inorganic salt culture medium by taking the feathers as a unique carbon source and a unique nitrogen source, and sterilizing at high temperature. Inorganic salt culture medium: NaCl 0.05%, K₂HPO₄0.1％，KH₂PO₄0.04％，MgCl₂·7H₂O 0.01％，CaCl₂0.006％，pH7.5。

Transferring the strain seed liquid to an inorganic salt culture medium by taking feathers as a unique carbon source and a unique nitrogen source, carrying out shake cultivation at a constant temperature of 37 ℃, and observing the feather degradation condition every 12 hours.

Third, experimental results

Plate degradation circle experiment results show that the strain BL21-KerA expressing KerA protein produces obvious degradation circles on skim milk plates, H/C is 3.75, and no degradation circle is found in the control strain BL21-22b (figure 1). Feather degradation experiments show that the strain BL21-KerA is cultured for 24h to start to degrade feathers, and feathers are almost completely degraded after 72h, and only part of feathers are thicker. No degradation of feathers occurred in the culture of control strain BL21-22b (FIG. 2).

Fourth, conclusion of experiment

The recombinant escherichia coli engineering strain expressing the KerA has the capability of secreting protease, and the protease can degrade skim milk protein and chicken feathers.

Example 3 assay of the enzymatic Activity of KerA protease from Gobi deinococcus sp

First, experimental material

Second, Experimental methods

1. Protein expression and purification

1) Selecting single clone, inoculating into 50mL liquid LB culture medium containing Amp, and shake culturing at 37 deg.C overnight

2) Transferring 0.1% strain seed liquid to fresh LB culture medium, shaking culturing at 37 deg.C to OD₆₀₀Up to 0.6

3) Adding IPTG to the medium at a final concentration of 1.0mM, and inducing culture at 30 deg.C for 8h

4) Centrifuging at 12000rpm to collect thallus and culture supernatant as crude enzyme solution

5) The loading buffer was added, boiled and analyzed by SDS-PAGE.

2. Protease activity assay

The method for determining the enzyme activity of the protease in the culture medium by adopting a Folin-phenol method comprises the following specific steps:

1) the crude enzyme solution obtained by centrifugation was diluted to an appropriate ratio with 50mM Tris-HCl, pH 8.0

2) Taking 100 mu L of diluted supernatant, adding 100 mu L of 2% casein substrate, incubating at 40 ℃ for 10min, and adding 200 mu L of 0.4M trichloroacetic acid to stop reaction for 10 min.

3) Centrifuging at 12000rpm for 2min, collecting supernatant 100 μ L, adding 500 μ L0.4M Na₂CO₃100 μ L Folin reagent, mixed well, developed at 40 ℃ for 20min and then measured for absorbance at 660 nm.

4) The formation of 1. mu.g tyrosine by the hydrolysis of casein catalyzed per minute is defined as one enzyme activity unit (U). Tyrosine standard curves were prepared by plotting the absorbance at 660nm for different concentrations of tyrosine.

Third, experimental results

Research results show that under the induction culture condition of 30 ℃, the engineering bacteria BL21-KerA can detect the enzyme activity of extracellular protease after being induced for 8 hours, and the enzyme activity of crude enzyme solution is 148.36U/mg.

Fourth, conclusion of experiment

The KerA protein is successfully expressed in engineering strains, has protease activity, and has the enzyme activity of crude extracellular enzyme solution of 148.36U/mg.

Example 4 analysis of feather degradation products of KerA protease from deinococcus Gobi

First, experimental material

Second, Experimental methods

1. The crude enzyme solution obtained by centrifugation was diluted to an appropriate ratio with 50mM Tris-HCl, pH 8.0

2. Taking 3mL of diluted supernatant, adding 10mg of feather powder, incubating at 40 ℃ for 60min, and adding 2mL of 0.4M trichloroacetic acid to terminate the reaction for 10 min.

3.12000rpm for 10min, and collecting the supernatant. 2mL of 0.4M trichloroacetic acid was added before the reaction in the control group

4. Adding 5mL of supernatant sample into a rotary evaporator, evaporating to 1mL, recovering into an EP tube, and analyzing the content of free amino acid in the degradation product by using an amino acid analyzer.

Third, experimental results

The results of the study show the following:

the results show that the analysis of the types and the contents of the amino acids in the feather degradation fermentation liquor shows that the degradation products mainly generate 18 amino acids such as tyrosine, arginine, proline, cystine, glycine and the like

Fourth, conclusion of experiment

Analysis of the amino acid content in the feather degradation fermentation broth of the KerA protein shows that the degradation products mainly produce 18 amino acids such as tyrosine, arginine, proline, cystine, glycine and the like.

Sequence listing

<110> institute of biotechnology of Chinese academy of agricultural sciences

<120> application of radiation-resistant Gobi deinococcus keratinase gene

<160> 2

<170> PatentIn version 3.1

<210> 1

<211> 1239

<212> DNA

<213> Deinococcus gobius (Deinococcus gobiensis)

<400> 1

atgaacggac gtcttaccct cggtgttctg gccctttccc tcgccctcgc ggcctgcgga 60

acctcgacta cccccatggc ccagacgccg gcccagggca gcgccccggc cgccgacagc 120

ggtctggccc ccctgcgcgg caccgacaac cccagcgcca tcgccgggca gtacatcgtg 180

gtcctcaagg aaggcaccca gagcgccctg agcgcccaga gcgccggcgg cctgatcggc 240

agcctgggtc tggacccgca gggcatcacg gtcctgagcg tgtacggtca ggccattgag 300

ggcttcgccg ccaagctcag cgcccagaac ctggagaagg tgcgcgccaa cgcgaacgtc 360

gcctacgtcg agcaggacgg catgatgtac gcctccgcca cgcagtcgag cgccacctgg 420

ggcctggacc gcatcgacca gcgcaacctg cccctgaacg gcacctacgt ctacaacaag 480

accggctcgg gcgtgaaggc gttcatcatc gacacgggca tcaacacctc gcacaccagc 540

ttcggcgggc gcgcggtctg gggcacgaac accacgggtg acggccgcaa caccgactgc 600

cagggccacg gcacccacgt cgccggcacg gtcgggtcct cgacctgggg cgtcgccaag 660

agcaccagcc tgatcgccgt gaaggtgctg gactgcaacg gatcgggcag caactccggg 720

gtcatcagcg gcatcaactg ggcgctgaac aacaagggca gtgccaccgc cgtcgccaac 780

atgagcttgg gcggcccggc cagctcggcc gtggacgacg ccgtgaacaa cgcgggcagc 840

cgcggcctcg tgatggtggt cgccgccggc aacgagaacc aggacgcctg caacgtcagc 900

ccggcgcgtg ccagcggcag cggcgtgatc acggtggggg ccaccacccg cagcgacgtg 960

cgcgccagct acagcaacta cggctcgtgc gtggacctct tcgcgcccgg cagcgacatc 1020

acgagcgcct ggatcggcag cacgaccgcc accaacacca tcagcggcac cagcatggcg 1080

accccgcacg tggccggcgc ggtggccctg ctgctccagg gcaacaccgg catcagcgcc 1140

agcaccgccc gctcgacggt cctgaacaac accaccaacg gcgtggtgag cagcgagaac 1200

ggcagccccg acaagctgct gtacaccctg aacttctga 1239

<210> 2

<211> 412

<212> PRT

<213> Deinococcus gobius (Deinococcus gobiensis)

<400> 2

MET Asn Gly Arg Leu Thr Leu Gly Val Leu Ala Leu Ser Leu Ala Leu

1 5 10 15

Ala Ala Cys Gly Thr Ser Thr Thr Pro MET Ala Gln Thr Pro Ala Gln

20 25 30

Gly Ser Ala Pro Ala Ala Asp Ser Gly Leu Ala Pro Leu Arg Gly Thr

35 40 45

Asp Asn Pro Ser Ala Ile Ala Gly Gln Tyr Ile Val Val Leu Lys Glu

50 55 60

Gly Thr Gln Ser Ala Leu Ser Ala Gln Ser Ala Gly Gly Leu Ile Gly

65 70 75 80

Ser Leu Gly Leu Asp Pro Gln Gly Ile Thr Val Leu Ser Val Tyr Gly

85 90 95

Gln Ala Ile Glu Gly Phe Ala Ala Lys Leu Ser Ala Gln Asn Leu Glu

100 105 110

Lys Val Arg Ala Asn Ala Asn Val Ala Tyr Val Glu Gln Asp Gly MET

115 120 125

MET Tyr Ala Ser Ala Thr Gln Ser Ser Ala Thr Trp Gly Leu Asp Arg

130 135 140

Ile Asp Gln Arg Asn Leu Pro Leu Asn Gly Thr Tyr Val Tyr Asn Lys

145 150 155 160

Thr Gly Ser Gly Val Lys Ala Phe Ile Ile Asp Thr Gly Ile Asn Thr

165 170 175

Ser His Thr Ser Phe Gly Gly Arg Ala Val Trp Gly Thr Asn Thr Thr

180 185 190

Gly Asp Gly Arg Asn Thr Asp Cys Gln Gly His Gly Thr His Val Ala

195 200 205

Gly Thr Val Gly Ser Ser Thr Trp Gly Val Ala Lys Ser Thr Ser Leu

210 215 220

Ile Ala Val Lys Val Leu Asp Cys Asn Gly Ser Gly Ser Asn Ser Gly

225 230 235 240

Val Ile Ser Gly Ile Asn Trp Ala Leu Asn Asn Lys Gly Ser Ala Thr

245 250 255

Ala Val Ala Asn MET Ser Leu Gly Gly Pro Ala Ser Ser Ala Val Asp

260 265 270

Asp Ala Val Asn Asn Ala Gly Ser Arg Gly Leu Val MET Val Val Ala

275 280 285

Ala Gly Asn Glu Asn Gln Asp Ala Cys Asn Val Ser Pro Ala Arg Ala

290 295 300

Ser Gly Ser Gly Val Ile Thr Val Gly Ala Thr Thr Arg Ser Asp Val

305 310 315 320

Arg Ala Ser Tyr Ser Asn Tyr Gly Ser Cys Val Asp Leu Phe Ala Pro

325 330 335

Gly Ser Asp Ile Thr Ser Ala Trp Ile Gly Ser Thr Thr Ala Thr Asn

340 345 350

Thr Ile Ser Gly Thr Ser MET Ala Thr Pro His Val Ala Gly Ala Val

355 360 365

Ala Leu Leu Leu Gln Gly Asn Thr Gly Ile Ser Ala Ser Thr Ala Arg

370 375 380

Ser Thr Val Leu Asn Asn Thr Thr Asn Gly Val Val Ser Ser Glu Asn

385 390 395 400

Gly Ser Pro Asp Lys Leu Leu Tyr Thr Leu Asn Phe

405 410

Claims

1, the application of the gene of the sequence shown in SEQ ID NO.1 in the microbial catalytic biodegradation, wherein the application is that the protease coded by the gene is used for degrading the protein with a complex structure in the biodegradation.

2. The use of claim 1, wherein the degradation of the protein is a catalytic reaction that degrades the protein into a polypeptide or an amino acid.

3. The plasmid containing the sequence gene shown in SEQ ID NO.1 is applied to protein degradation.

4. The recombinant engineering strain containing the sequence gene shown in SEQ ID NO.1 is applied to protein degradation.