CN109161610A - It is a kind of detect beet seed graininess SSR molecular marker BvRE016 and its application - Google Patents
It is a kind of detect beet seed graininess SSR molecular marker BvRE016 and its application Download PDFInfo
- Publication number
- CN109161610A CN109161610A CN201811320458.XA CN201811320458A CN109161610A CN 109161610 A CN109161610 A CN 109161610A CN 201811320458 A CN201811320458 A CN 201811320458A CN 109161610 A CN109161610 A CN 109161610A
- Authority
- CN
- China
- Prior art keywords
- graininess
- seed
- beet
- bvre016
- band
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
It is a kind of detect beet seed graininess SSR molecular marker BvRE016 and its application, belong to molecular marking technique field, be related to it is a kind of detect beet seed graininess SSR molecular marker and its application.It is to solve the problem of that the relevant molecular labeling of existing shortage beet seed graininess is not easy to identification seed graininess.Primer pair for the PCR amplification molecular labeling is BvRE016A and BvRE016S.For molecular labeling BvRE016 of the invention in all individuals, the consistency of label testing result and seed graininess trait expression reaches 76.76%, respectively reaches 93.33% and 60% in simple grain and more individuals.The present invention is detected for beet seed graininess.
Description
Technical field
The invention belongs to molecular marking technique field, be related to a kind of SSR molecular marker for detecting beet seed graininess and its
Using.
Background technique
The fruit expoeridium of beet (Beta Vulgaris) the lignifying calyx harbored, form more special " kind
Ball " structure: being single achene in bulb when spending single life, and when multiple stockless little Hua consor are at cyme, in bulb
Multiple fruits are closely coupled to form the collective fruits for containing multiple achenes.When describing Beet Germplasm Resources, with " seed graininess " character
It is described, is divided into single seed (also known as single semina) and more kinds (also known as polyembryony kind).
More kind emergence rates are high, and conducive to keeping a full stand of seedings, single seed is then conducive to mechanized farming, and saves thinning workload.Meanwhile
The easily controllable spacing in the rows of single seed, helps to improve yielding ability and uniformity.With sowing, management mechanization degree raising, with
And the progress of seed pelleting and pelletized technology, the demand in production to sweet single-grain kind are being continuously improved.
Currently, the beet monogerm germplasm in China largely passes through introduction and introduces a fine variety acquisition, a small number of lists have also independently been cultivated
Grain kind, but the research of beet seed graininess related molecular marker, gene and molecule mechanism there is no report.
Seed graininess label is developed, is applied to seed graininess and predicts, be conducive to the identification of China's sweet single-grain kind germplasm, open
Hair and utilization are also beneficial to improve the efficiency of single seed cultivation work, while helping to find graininess related gene, answer for breeding
With with molecular mechanism research.
Summary of the invention
The present invention is to solve the relevant molecular labelings of existing shortage beet seed graininess, are not easy to identification seed graininess
Problem, provide it is a kind of detect beet seed graininess SSR molecular marker BvRE016 and its application.
The present invention using high throughput sequencing technologies develop simple sequence repeats (simple sequence repeat,
SSR) candidates utilize F2Segregating population has been screened out from it SSR molecular marker relevant to beet seed graininess
BvRE016 obtains the sequence of label amplification region and has carried out genome positioning.The molecular labeling can be used for detecting beet kind
Sub- simple grain/more individuals.
The present invention detects the SSR molecular marker BvRE016 of beet seed graininess, for drawing for the PCR amplification molecular labeling
Object is to for BvRE016A and BvRE016S, particular sequence are as follows:
BvRE016A:5'-TCCTTCCAACAATCCTCCTG-3'
BvRE016S:5'-CAAACTGCTCGAGTTTGGGT-3'.
The application of the SSR molecular marker BvRE016 of above-mentioned detection beet seed graininess, it is for detecting seed graininess.
Specific detection method are as follows:
One, the separation and Extraction total DNA from beet tender tissue；The tender tissue be young leaflet tablet, immature inflorescence, children it is tender
Petiole, the tender colored a kind of sedge of children, germination period seed, Seedling Stage root or whole strain seedling；
Two, the DNA obtained using step 1 carries out PCR amplification using primer BvRE016A and BvRE016S as template,
Three, the pcr amplification product for obtaining step 2 polyacrylamide gel electrophoresis (polyacrylamide gel
Electrophoresis, PAGE) it is separated, determined according to amplified production size as a result, if only detecting the item of 227bp
Band is then determined as beet seed simple grain；If other than the band for detecting 227bp, also detect 383bp band and
The band of 467bp is then determined as beet seed more.
Primer BvRE016 A described in step 2 is 5'-TCCTTCCAACAATCCTCCTG-3', and primer BvRE016 S is
5'-CAAACTGCTCGAGTTTGGGT-3'。
Further, the condition of pcr amplification reaction described in step 2 are as follows: 94 DEG C of initial denaturations 5min, 94 DEG C of denaturation 30s,
56 DEG C of annealing 1min, 72 DEG C of extension 1min carry out 30 circulations altogether, and last 72 DEG C re-extend 5min.
Beneficial effects of the present invention:
Present invention obtains SSR molecular marker BvRE016 relevant to beet seed graininess, can be used alone or and its
Its primers in combination use, detected by PCR, can the seed graininess to beet prejudge；It can be in any growth of beet
Phase takes beet young leaflet tablet or other tender tissues to extract genomic DNA as material, reduces workload, shorten seed graininess
The period of judgement；More plants of beet individuals can be detected, judge homozygosity of the germplasm in graininess character.
The present invention carries out Genotyping, verification mark and seed graininess to more kinds of segregating generation and single seed individual respectively
The consistency of performance.It was found that molecular labeling BvRE016 of the invention marks testing result and seed graininess in all individuals
The consistency of shape performance reaches 76.76%, respectively reaches 93.33% and 60% in simple grain and more individuals, shows BvRE016
There is linkage relationship with seed graininess, can be used for the detection of seed graininess.
The sequence of amplification region will be marked to be compared with Beta vulgaris gene group, genome positioning is carried out to label.As a result table
The region 30888225-30887980 of bright BvRE016 Molecular mapping No. 9 chromosome in Beta vulgaris gene group.
BvRE016 molecular labeling is for the assisted Selection and beet individual of the kind germplasm of sweet single-grain kind/more and offspring's grain
The prediction of property, and beet is assisted to bloom the theoretical research with corm forming and the excavation of beet seed graininess related gene.
Detailed description of the invention
Fig. 1 is the genotypic results of beet seed simple grain individual；
Fig. 2 is more individual genotypic results of beet seed.
Specific embodiment
The technical solution of the present invention is not limited to the following list, further includes between each specific embodiment
Any combination.
Specific embodiment 1: the SSR molecular marker BvRE016 of present embodiment detection beet seed graininess, is used for PCR
The primer pair for expanding the molecular labeling is BvRE016 A and BvRE016 S, particular sequence are as follows:
BvRE016 A:5'-TCCTTCCAACAATCCTCCTG-3'
BvRE016 S:5'-CAAACTGCTCGAGTTTGGGT-3'.
The molecular labeling of present embodiment can be used for judging the seed graininess of beet germplasm or individual.When in use, directly
It takes annual plant young leaflet tablet or other tender tissues to carry out DNA to extract and mark detection, does not need to carry out time-consuming 2 years
Sowing-mother's root cultivation-mother's root plant-biennial tree characteristics investigation work；Also biennial plant young leaflet tablet, the tender flower of children be can use
Sequence or other tender tissues carry out DNA and extract and label detection.It, can be directly according to PCR when for judging the graininess of entire germplasm
As a result it combines statistical analysis to be judged, or character investigation is carried out as supplement, without to complete to wherein emphasis individual
Portion's individual is detected.It, can also be according to PCR result in annual stage or biennial pumping when for judging the fertility of beet individual
A kind of sedge initial stage, early squaring take young leaflet tablet, immature inflorescence or other tender tissues to be prejudged, and reduce character investigation individual
Range eliminates unwanted simple grain/more individuals in advance.
Specific embodiment 2: the application of the SSR molecular marker BvRE016 of present embodiment detection beet seed graininess,
It is for detecting seed graininess.
Specific embodiment 3: present embodiment is unlike specific embodiment two: specific detection method are as follows:
One, the separation and Extraction total DNA from beet tender tissue；
Two, the DNA obtained using step 1 carries out PCR amplification using primer BvRE016 A and BvRE016 S as template,
Three, the pcr amplification product for obtaining step 2 is separated with polyacrylamide gel electrophoresis, according to amplified production
Size determines to be determined as beet seed simple grain as a result, if only detecting the band of 227bp；If in addition to detecting 227bp
Band outside, also detect the band of 383bp and the band of 467bp, be then determined as beet seed more.Other and specific implementation
Mode two is identical.
Specific embodiment 4: present embodiment is unlike specific embodiment three: tender group of children described in step 1
It is woven to young leaflet tablet, immature inflorescence, young tender leaf handle, the tender colored a kind of sedge of children, germination period seed, Seedling Stage root or whole strain seedling.It is other with
Specific embodiment three is identical.
Specific embodiment 5: unlike one of present embodiment and specific embodiment two to four: described in step 2
Primer BvRE016 A is 5'-TCCTTCCAACAATCCTCCTG-3', and primer BvRE016 S is 5'-
CAAACTGCTCGAGTTTGGGT-3'.It is other identical as one of specific embodiment two to four.
Specific embodiment 6: unlike one of present embodiment and specific embodiment two to five: described in step 2
Pcr amplification reaction condition are as follows: 94 DEG C of initial denaturations 5min, 94 DEG C of denaturation 30s, 56 DEG C of annealing 1min, 72 DEG C of extension 1min, altogether
30 circulations are carried out, last 72 DEG C re-extend 5min.It is other identical as one of specific embodiment two to five.
Elaborate below to the embodiment of the present invention, following embodiment under the premise of the technical scheme of the present invention into
Row is implemented, and gives detailed embodiment and specific operating process, but protection scope of the present invention is not limited to following realities
Apply example.
Embodiment 1:
A large amount of beet sequences are obtained by high-flux sequence, the SSR marker without report has therefrom been excavated, has filtered out
Quality and the good candidates of polymorphism more than 100, while constructing the F of beet seed graininess2Segregating population.
More kinds are chosen from segregating generation and single seed individual constructs mixed pond, analyze (bulked with group's hybrid separation
Segregation analysis, BSA) method candidates are screened, obtain and show polymorphism between mixed pond
SSR marker.And SSR molecular marker relevant to beet seed graininess has therefrom been selected, it is named as BvRE016.
(1) detection of the label to seed graininess
One, the DNA of 30 plants of beet young leaflet tablets is extracted respectively；
Two, the DNA obtained using step 1 carries out PCR amplification, PCR using primer BvRE016A and BvRE016S as template
Reaction system is as shown in table 1:
Primer BvRE016 A:TCCTTCCAACAATCCTCCTG
Primer BvRE016 S:CAAACTGCTCGAGTTTGGGT
Table 1
The condition of pcr amplification reaction are as follows:
94 DEG C of initial denaturations 5min, 94 DEG C of denaturation 30s, 56 DEG C of annealing 1min, 72 DEG C of extension 1min carry out 30 circulations altogether,
Last 72 DEG C re-extend 5min.
Three, the detection method of result:
The pcr amplification product that step 2 is obtained is separated with polyacrylamide gel electrophoresis, gel cross-linkage degree 8%,
Voltage 100V when electrophoresis, time 5h.15~20min is dyed with 10mg/L ethidium bromide (EB) solution after electrophoresis.
After investigating segregating generation seed graininess, respectively to simple grain and each 30 plants of bases marked of more individuals
Because of parting.The genotypic results of simple grain are as shown in Figure 1, wherein M indicates DNA 50bp marker, P1Indicate maternal (simple grain),
P2It indicates male parent (more), number 1-30 is 30 simple grain individuals.More genotypic results are as shown in Fig. 2, wherein M is indicated
DNA 50bp marker, P1Indicate maternal (simple grain), P2It indicates male parent (more), number 1-30 is 30 more individuals.
Genotyping, verification mark and seed grain sex expression are carried out to more kinds of segregating generation and single seed individual respectively
Consistency.It was found that molecular labeling BvRE016 marks the consistency of testing result and seed graininess trait expression in all individuals
Reach 76.76%, respectively reaches 93.33% and 60% in simple grain and more individuals.Show that BvRE016 and seed graininess have company
Lock relationship can be used for the detection of seed graininess.
Testing result of the 2 seed graininess mark of correlation of table to different graininess plant
Determined to be determined as beet seed list as a result, if only detecting the band of 227bp according to amplified production size
Grain；If also detecting the band of 383bp and the band of 467bp other than the band for detecting 227bp, being then determined as beet
More, seed.
(2) acquisition of amplification region sequence is marked
By PCR product recycling, T-A clone and sanger sequencing, the extension increasing sequence of label is obtained.
Through being sequenced, BvRE016 extension increasing sequence is following (dashed part is SSR repetitive unit):
Simple grain correlation band: 227bp
TTGACTATGATTTAATGGATCAACTGTTAAATGAAGGGTGTTGGTTACAAACAGCTGATGGATCAAACC
TTCTGCAGTTGAGTCAGGGTCCTGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAG
GGTTCGAGTCCACCCACCTCTCGCGGTTTAAGCTACCCATCTTTTCCCTTCCTTGGTTCGGACCCAAACTCGAGCAG
TTTG
More related band 1:383bp
TTGACTATGATTTAATGGATCAACTGTTAAATGAAGGGTGTTGGTTACAAACAGCTGATGGATCAAACC
TTCTGCAGTTGAGTCAGGGTCCTGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAG GGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCA GGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTC AGGGTTCGAGTCCACCCACCTCTCGCGGTTTAAGCTACCCATCTTTTCCCTTCCTTGGTTCGGACCCAAACTCGAGC
AGTTTG
More related band 2:467bp
TTGACTATGATTTAATGGATCAACTGTTAAATGAAGGGTGTTGGTTACAAACAGCTGATGGATCAAACC
TTCTGCAGTTGAGTCAGGGTCCTGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAG GGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCA GGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTC AGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGT CAGGGTCAGGGTTCGAGTCCACCCACCTCTCGCGGTTTAAGCTACCCATCTTTTCCCTTCCTTGGTTCGGACCCAAA
CTCGAGCAGTTTG
(3) analysis and genome for marking amplification region sequence position
Amplified production and plant nonredundancy nucleic acid database are subjected to BlastN and compare analysis, the results showed that BvRE016's
Amplified production is similar to the sequence of cytotoxic protein that beet one is predicted, similar portion is the 1-137bp of amplified fragments, should
Partial sequence similarity is 99%.
It will be marked according to sequence similarity and positioned in Beta vulgaris gene group, the results showed that BvRE016 is positioned at beet
The region 30888225-30887980 of No. 9 chromosome in genome.
Sequence table
<110>Heilongjiang University
<120>a kind of SSR molecular marker BvRE016 for detecting beet seed graininess and its application
<160> 5
<210> 1
<211> 20
<212> DNA
<213>artificial sequence
<220>
<223>primer BvRE016 S
<400> 1
caaactgctcgagtttgggt 20
<210> 2
<211> 20
<212> DNA
<213>artificial sequence
<220>
<223>primer BvRE016 A
<400> 2
tccttccaacaatcctcctg 20
<210> 3
<211> 227
<212> DNA
<213>artificial sequence
<220>
<223>simple grain correlation band corresponds to extension increasing sequence
<400> 3
ttgactatga tttaatggat caactgttaa atgaagggtg ttggttacaa acagctgatg 60
gatcaaacct tctgcagttg agtcagggtc ctggtcaggg tcagggtcag ggtcagggtc 120
agggtcaggg tcagggtcag ggtcagggtt cgagtccacc cacctctcgc ggtttaagct 180
acccatcttt tcccttcctt ggttcggacc caaactcgag cagtttg 227
<210> 4
<211> 383
<212> DNA
<213>artificial sequence
<220>
<223>the more related corresponding extension increasing sequences of band 1
<400> 4
ttgactatga tttaatggat caactgttaa atgaagggtg ttggttacaa acagctgatg 60
gatcaaacct tctgcagttg agtcagggtc ctggtcaggg tcagggtcag ggtcagggtc 120
agggtcaggg tcagggtcag ggtcagggtc agggtcaggg tcagggtcag ggtcagggtc 180
agggtcaggg tcagggtcag ggtcagggtc agggtcaggg tcagggtcag ggtcagggtc 240
agggtcaggg tcagggtcag ggtcagggtc agggtcaggg tcagggtcag ggtcagggtc 300
agggttcgag tccacccacc tctcgcggtt taagctaccc atcttttccc ttccttggtt 360
cggacccaaa ctcgagcagt ttg 383
<210> 5
<211> 467
<212> DNA
<213>artificial sequence
<220>
<223>the more related corresponding extension increasing sequences of band 2
<400> 5
ttgactatga tttaatggat caactgttaa atgaagggtg ttggttacaa acagctgatg 60
gatcaaacct tctgcagttg agtcagggtc ctggtcaggg tcagggtcag ggtcagggtc 120
agggtcaggg tcagggtcag ggtcagggtc agggtcaggg tcagggtcag ggtcagggtc 180
agggtcaggg tcagggtcag ggtcagggtc agggtcaggg tcagggtcag ggtcagggtc 240
agggtcaggg tcagggtcag ggtcagggtc agggtcaggg tcagggtcag ggtcagggtc 300
agggtcaggg tcagggtcag ggtcagggtc agggtcaggg tcagggtcag ggtcagggtc 360
agggtcaggg tcagggtcag ggtcagggtt cgagtccacc cacctctcgc ggtttaagct 420
acccatcttt tcccttcctt ggttcggacc caaactcgag cagtttg 467
Claims (6)
1. a kind of SSR molecular marker BvRE016 for detecting beet seed graininess, it is characterised in that be used for the PCR amplification molecule mark
The primer pair of note is BvRE016A and BvRE016S, particular sequence are as follows:
BvRE016A:5'-TCCTTCCAACAATCCTCCTG-3'
BvRE016S:5'-CAAACTGCTCGAGTTTGGGT-3'.
2. the application of the SSR molecular marker BvRE016 of detection beet seed graininess as described in claim 1, it is characterised in that use
In detection seed graininess.
3. application according to claim 2, it is characterised in that specific detection method are as follows:
One, the separation and Extraction total DNA from beet tender tissue；
Two, the DNA obtained using step 1 carries out PCR amplification using primer BvRE016A and BvRE016S as template,
Three, the pcr amplification product for obtaining step 2 is separated with polyacrylamide gel electrophoresis, according to amplified production size
Determine as a result, being determined as beet seed simple grain if only detecting the band of 227bp；If the item in addition to detecting 227bp
Band is outer, also detects the band of 383bp and the band of 467bp, is then determined as beet seed more.
4. application according to claim 3, it is characterised in that tender tissue described in step 1 is young leaflet tablet, the tender flower of children
Sequence, young tender leaf handle, the tender colored a kind of sedge of children, germination period seed, Seedling Stage root or whole strain seedling.
5. application according to claim 3, it is characterised in that primer BvRE016A described in step 2 is 5'-
TCCTTCCAACAATCCTCCTG-3', primer BvRE016S are 5'-CAAACTGCTCGAGTTTGGGT-3'.
6. application according to claim 3, it is characterised in that the condition of pcr amplification reaction described in step 2 are as follows: 94 DEG C
Initial denaturation 5min, 94 DEG C of denaturation 30s, 56 DEG C of annealing 1min, 72 DEG C of extension 1min carry out 30 circulations altogether, and last 72 DEG C are prolonged again
Stretch 5min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811320458.XA CN109161610B (en) | 2018-11-07 | 2018-11-07 | SSR molecular marker BvRE016 for detecting granularity of beet seeds and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811320458.XA CN109161610B (en) | 2018-11-07 | 2018-11-07 | SSR molecular marker BvRE016 for detecting granularity of beet seeds and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109161610A true CN109161610A (en) | 2019-01-08 |
| CN109161610B CN109161610B (en) | 2021-06-29 |
Family
ID=64875598
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811320458.XA Active CN109161610B (en) | 2018-11-07 | 2018-11-07 | SSR molecular marker BvRE016 for detecting granularity of beet seeds and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109161610B (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030115624A1 (en) * | 2000-03-10 | 2003-06-19 | Terry L. Irene | Quantitative trait loci for insect resistance in soybeans |
| CN102461460A (en) * | 2010-12-03 | 2012-05-23 | 黑龙江大学 | Creation of beet novel cytoplasmic male sterile (P-CMS) line |
| CN102461461A (en) * | 2010-12-03 | 2012-05-23 | 黑龙江大学 | Creation of beet novel cytoplasmic male sterile (M-CMS) line |
| CN105603096A (en) * | 2016-02-25 | 2016-05-25 | 华中农业大学 | Co-dominance InDel molecular marker for identifying single embryo and multiple embryos of citrus and application thereof |
| CN107267660A (en) * | 2017-08-21 | 2017-10-20 | 黑龙江大学 | Detect SSR molecular marker and its application of beet stamen fertility |
| CN108291234A (en) * | 2015-09-04 | 2018-07-17 | 主基因有限公司 | Multiple sporinite forms gene |
-
2018
- 2018-11-07 CN CN201811320458.XA patent/CN109161610B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030115624A1 (en) * | 2000-03-10 | 2003-06-19 | Terry L. Irene | Quantitative trait loci for insect resistance in soybeans |
| CN102461460A (en) * | 2010-12-03 | 2012-05-23 | 黑龙江大学 | Creation of beet novel cytoplasmic male sterile (P-CMS) line |
| CN102461461A (en) * | 2010-12-03 | 2012-05-23 | 黑龙江大学 | Creation of beet novel cytoplasmic male sterile (M-CMS) line |
| CN108291234A (en) * | 2015-09-04 | 2018-07-17 | 主基因有限公司 | Multiple sporinite forms gene |
| CN105603096A (en) * | 2016-02-25 | 2016-05-25 | 华中农业大学 | Co-dominance InDel molecular marker for identifying single embryo and multiple embryos of citrus and application thereof |
| CN107267660A (en) * | 2017-08-21 | 2017-10-20 | 黑龙江大学 | Detect SSR molecular marker and its application of beet stamen fertility |
Non-Patent Citations (3)
| Title |
|---|
| KATHERINE C DENT 等: "Molecular profiling of microbial communities associated with seeds of Beta vulgaris subsp. Vulgaris (sugar beet)", 《J MICROBIOL METHODS》 * |
| MÖRCHEN M 等: "Abundance and length polymorphism of microsatellite repeats in Beta vulgaris L", 《THEORETICAL AND APPLIED GENETICS》 * |
| 王希 等: "表型与分子标记相结合分析130份糖用甜菜种质的遗传多样性", 《中国农学通报》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109161610B (en) | 2021-06-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Koussao et al. | Diversity analysis of sweet potato (Ipomoea batatas [L.] Lam) germplasm from Burkina Faso using morphological and simple sequence repeats markers | |
| CN107201404A (en) | A kind of molecular biology identification method and its application for Asparagus dioecian plant sex | |
| CN113151532B (en) | Molecular marker Indel-LNT-36 closely linked with cucumber fruit multi-ventricular trait | |
| CN102703586B (en) | Method for constructing Prunus mume Sieb.et Zucc SSR (simple sequence repeat) genetic map | |
| CN109897909A (en) | One kind molecular labeling relevant to corn kernel size and its application | |
| CN105543222B (en) | The molecular labeling InDeL_33 of soybean 100-grain weight main effect QTL and its application | |
| CN114032332B (en) | Molecular marker cm17-16 for rapidly detecting pumpkin naked kernel characteristics and application thereof | |
| CN105803094B (en) | A kind of SCAR mark and its application identified or assist identification potato maturity | |
| CN113789408B (en) | Screening and application of SSR molecular marker primers for identifying variety of non-heading Chinese cabbage | |
| CN109136400B (en) | QTLs (quantitative trait loci) for related characters of fleshy roots of radishes and positioning method thereof | |
| CN109811074A (en) | A kind of label and its application for assisting detection wheat Gao Dansui spikelet number character | |
| Matsuoka | Origin matters: Lessons from the search for the wild ancestor of maize | |
| CN109207629A (en) | It is a kind of detect beet seed graininess SSR molecular marker BvRE049 and its application | |
| CN108384873A (en) | SSR marker and method for the green phoenix hybrid seed purity identification of watermelon | |
| CN108977573B (en) | Method for identifying purity of seven-star radish hybrid by using SSR molecular marker | |
| CN113462813B (en) | Site linked with pear peel red character, molecular marker and application thereof | |
| CN109161610A (en) | It is a kind of detect beet seed graininess SSR molecular marker BvRE016 and its application | |
| CN114875168A (en) | InDel marker for identifying existence of granuloma on surface of bitter gourd fruit as well as detection primer and application thereof | |
| CN109321676A (en) | It is a kind of detect beet seed graininess SSR molecular marker BvRE105 and its application | |
| CN108531636A (en) | A kind of molecular marked compound TJcM01 and its application for identifying muskmelon unisexual flower | |
| CN111363844B (en) | Water chestnut SSR primer group and application thereof | |
| Sevilleno et al. | The role of cytogenetic tools in orchid breeding | |
| CN108239675A (en) | A kind of molecular marked compound TJcM02 and its application for being used to identify muskmelon unisexual flower | |
| Sinjushin et al. | Preliminary report on taxonomical position of Vavilovia formosa (Stev.) Fed. evidenced from morphological and molecular data. | |
| CN109811085B (en) | Primer for identifying purity of autumn-sown Chinese cabbage Zhenlun No. 6 seeds and application of primer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |