CN109161589A - A kind of people TGFBI gene mutation detection kit and its detection method - Google Patents
A kind of people TGFBI gene mutation detection kit and its detection method Download PDFInfo
- Publication number
- CN109161589A CN109161589A CN201811164970.XA CN201811164970A CN109161589A CN 109161589 A CN109161589 A CN 109161589A CN 201811164970 A CN201811164970 A CN 201811164970A CN 109161589 A CN109161589 A CN 109161589A
- Authority
- CN
- China
- Prior art keywords
- seq
- tgfbi
- probe
- site
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a kind of people TGFBI gene mutation detection kit and its detection methods；The present invention is directed to anomaly of cornea disease mutated gene carrier, effectively, pointedly protect in early stage, the technical issues of development that can delay the course of disease is even avoided to morbidity, the present invention provides detection 124 sites of people TGFBI gene and 555 site mutations to cause the primer of corneal dystrophy, probe, the primer, probe are able to detect 124 site of TGFBI gene and 555 site mutations, high sensitivity, high specificity；And a kind of anomaly of cornea disease mutated gene detection kit is provided, which being capable of quick, efficient, accurate detection 124 site of people TGFBI gene and 555 site mutation；The advantages that the present invention also provides the detection methods for using mentioned reagent box detection people TGFBI gene 124 site and 555 site mutations, and this method detection method is easy to operate, high sensitivity, specificity height, Fit Models are wide, and testing result is true and reliable and easy to spread.
Description
Technical field
The invention belongs to genetic test fields, and in particular to arrive a kind of people TGFBI gene mutation detection kit and its inspection
Survey method.
Background technique
Anomaly of cornea disease (Corneal Dystrophies, CD), also referred to as corneal dystrophy, are symmetry, noninflammatory
The general name of property disease of cornea.Its disease incidence is about 1/2000, and the ratio between men and women's morbidity is 1.7:1.0.Most patients be it is sporadic,
Accounting for about 6%-10% patient has specific Positive family history, and mode of inheritance includes recessive and dominant form.Its fall ill be due to
Cell in normal cornea tissue damages its structure or function by progressive, leads to cornea under the action of gene unconventionality
The sediment to come in every shape is formed in tissue, thus gradually decreases eyesight, and causes the complication such as erosion, photophobia；Advanced stage suffers from
The cornea of person will be covered with deposit, lose visual function, not only influence patients ' life quality, beauty, also bring to society heavy negative
Load.
In recent years, with the progress of molecular genetics, many scholars explore its pathogenesis and are analyzed from molecular level
Its genetic characteristics.At present relevant to the corneal dystrophy gene of report include: TGFBI, GSN, K12, M1S1, CHST6,
COL8A2, SLC4A11 etc., wherein TGFBI gene makes first discovery be also to report most commonly seen related gene at present.
TGFBI is also referred to as Keratoepithelin (keratoepithelin, KE albumen), is named as BIGH3 in initial
(Beta-induced Gene-h3).TGFBI albumen is the important composition of extracellular matrix, in cornea, skin and other connectives
There is expression in periplast.TGFBI molecular weight of albumen 68KDa is made of 683 amino acid.The variation meeting of some amino acid
Lead to the change of protein three-dimensional structure and function, the variation of partial amino-acid but will cause it that cannot be cleaned and degrade.
Korvatska etc. think amino acid variation cause TGFBI band Electrical change be influence its hydrolysis the main reason for, also because
This results in the accumulation of TGFBI in cornea；The Apoptosis process of the TGFBI meeting induced fibroblast of the discoveries such as Choi mutation, makes
It lacks normal clearing function, thus leads to the continuous accumulation of deposit.TGFBI be corneal epithelial cell secretion it is important because
One of son, it participate in it is intercellular stick and creep, thus regulation and maintain corneal epithelial cell normal hyperplasia and differentiation etc.
Morphology generating process.Mutation will lead to the exception of cell adhesion and function of creeping, and then influence the hyperplasia and differentiation of cell,
Under the accumulation of denatured products, repeatedly epithelial erosion will lead to.TGFBI has expression on Various Tissues, but in research not
It was found that deposition of the TGFBI in other tissues (such as liver, lung, kidney).This may be since the particularity of cornea tissue causes.Angle
Film is no blood vessel, institutional framework queueing discipline is orderly, refracting media with the transparency, have good self-regeneration special
Property.And the reparation of the tissue is exactly based on secretion TGFBI albumen to realize sticking and creeping for cell.Therefore, wound, ultraviolet light
Equivalent damage stimulation can lure tissue secretion TGFBI albumen into.Normal population can fully recover rapidly under this repair mechanism, and cornea is different
Normal disease patient can generate a large amount of nondegradable albumen instead then to induce and aggravate the symptom of anomaly of cornea disease.TGFBI base
Because being located at No. 5 chromosomes (5q31), main pathogenic mutation is respectively that No. 124 is encoded on 4 exons and 12 exons
Amino acid and No. 555 amino acid codes are mutated.
Although the disease can not be eradicated after the onset, specific aim operation can only be carried out late with this and be apt to eyesight.But for angle
Film abnormality disease mutated gene carrier effectively, pointedly protect in early stage, will can delay the development of the course of disease even
It avoids falling ill.
Summary of the invention
In order to solve for anomaly of cornea disease mutated gene carrier, effectively, pointedly protect in early stage, it will
Can delay the course of disease development even avoid morbidity the technical issues of, the present invention provides detection 124 site of people TGFBI gene and
555 site mutations cause the primer of corneal dystrophy, probe.The primer, probe be able to detect 124 site of TGFBI gene and
555 site mutations, high sensitivity, high specificity.
The present invention also provides a kind of anomaly of cornea disease mutated gene detection kit, the kit can quickly, efficiently,
Accurate detection 124 site of people TGFBI gene and 555 site mutations.
The present invention also provides the detections for using mentioned reagent box detection people TGFBI gene 124 site and 555 site mutations
Method, this method detection method is easy to operate, high sensitivity, and specificity is high, and Fit Models are wide, and testing result is true and reliable and easy
In promote the advantages that.
The present invention includes following content:
A kind of people TGFBI gene mutation detection kit, the detection kit include primer sets and probe；
The primer sets are at least one set in following two groups:
For the primer SEQ ID NO.1 and SEQ ID NO.2 in 124 site of TGFBI gene；
For the primer SEQ ID NO.5 and SEQ ID NO.6 in 555 site of TGFBI gene；
The probe is selected from below for the saltant type probe of primer corresponding site and at least one set of wild-type probe:
For the probe SEQ ID NO.3 and SEQ ID NO.4 of 124 site 370C > T (R124C) of TGFBI gene detection；
For the probe SEQ ID NO.4 and SEQ ID NO.5 of 124 site 371G > T (R124L) of TGFBI gene detection；
For the probe SEQ ID NO.4 and SEQ ID NO.6 of 124 site 371G > A (R124H) of TGFBI gene detection；
For probe SEQ ID NO.9 and the SEQ ID of 555 site 1663C > T (R555W) of TGFBI gene detection
NO.10, for the probe SEQ ID NO.10 and SEQ ID NO.11 of 555 site 1664G > A (R555Q) of TGFBI gene detection.
Preferably, the probe SEQ ID NO.3, SEQ ID NO.6 of people's TGFBI gene mutation detection kit,
5 ' the ends of SEQ ID NO.9 are marked with fluorophor FAM, and 3 ' ends are marked with quenching group BHQ1；
5 ' the ends of the probe SEQ ID NO.4, SEQ ID NO.10 are marked with fluorophor HEX, and 3 ' ends are marked with
Quenching group BHQ1；
5 ' the ends of the probe SEQ ID NO.5, SEQ ID NO.11 are marked with fluorophor TAMRA, 3 ' end labels
There is quenching group BHQ1.
Preferably, people's TGFBI gene mutation detection kit further includes drawing for reference gene GUSB detection
Object SEQ ID NO.12, SEQ ID NO.13, and the probe SEQ ID NO.14 for reference gene GUSB detection.
Preferably, the 5 ' ends of the people TGFBI gene mutation detection kit probe SEQ ID NO.14 are marked with glimmering
Light group CY5,3 ' ends are marked with quenching group BHQ1.
Preferably, people's TGFBI gene mutation detection kit includes primer sets and probe；
The primer sets are as follows:
For the primer SEQ ID NO.1 and SEQ ID NO.2 in 124 site of TGFBI gene；
For the primer SEQ ID NO.5 and SEQ ID NO.6 in 555 site of TGFBI gene；
The probe is selected from the saltant type probe and wild-type probe below for primer corresponding site:
For the probe SEQ ID NO.3 and SEQ ID NO.4 of 124 site 370C > T (R124C) of TGFBI gene detection；
For the probe SEQ ID NO.4 and SEQ ID NO.5 of 124 site 371G > T (R124L) of TGFBI gene detection；
For the probe SEQ ID NO.4 and SEQ ID NO.6 of 124 site 371G > A (R124H) of TGFBI gene detection；
For probe SEQ ID NO.9 and the SEQ ID of 555 site 1663C > T (R555W) of TGFBI gene detection
NO.10, for the probe SEQ ID NO.10 and SEQ ID NO.11 of 555 site 1664G > A (R555Q) of TGFBI gene detection.
Preferably, the people TGFBI gene mutation detection kit probe SEQ ID NO.3, SEQ ID NO.6, SEQ
5 ' the ends of ID NO.9 are marked with fluorophor FAM, and 3 ' ends are marked with quenching group BHQ1；
5 ' the ends of the probe SEQ ID NO.4, SEQ ID NO.10 are marked with fluorophor HEX, and 3 ' ends are marked with
Quenching group BHQ1；
5 ' the ends of the probe SEQ ID NO.5, SEQ ID NO.11 are marked with fluorophor TAMRA, 3 ' end labels
There is quenching group BHQ1.
Preferably, people's TGFBI gene mutation detection kit further includes PCR premixed liquid；
The PCR premixed liquid includes UDG enzyme, archaeal dna polymerase, PCR buffer, MgCl2, dNTPs and dUTP.
Preferably, people's TGFBI gene mutation detection kit further includes positive reference substance and negative controls, institute
State positive reference substance be 8 kinds of recombinant plasmids mixed liquor, 7 kinds of recombinant plasmids be containing TGFBI 370T, TGFBI 371T,
TGFBI 371A, TGFBI 1663T, TGFBI 1664G, TGFBI 124WT, TGFBI 555WT, another group is GUSB sequence
Recombinant plasmid；
The negative controls are sterilizing ultrapure water.
A kind of TGFBI detection method of gene mutation, includes the following steps:
(1) design obtains primer and probe, and the primer sets are at least one set in following two groups: being directed to
The primer SEQ ID NO.1 and SEQ ID NO.2 in 124 site of TGFBI gene；
For the primer SEQ ID NO.5 and SEQ ID NO.6 in 555 site of TGFBI gene；
The probe is selected from the saltant type probe and wild-type probe below for primer corresponding site:
For the probe SEQ ID NO.3 and SEQ ID NO.4 of 124 site 370C > T (R124C) of TGFBI gene detection；
For the probe SEQ ID NO.4 and SEQ ID NO.5 of 124 site 371G > T (R124L) of TGFBI gene detection；
For the probe SEQ ID NO.4 and SEQ ID NO.6 of 124 site 371G > A (R124H) of TGFBI gene detection；
For probe SEQ ID NO.9 and the SEQ ID of 555 site 1663C > T (R555W) of TGFBI gene detection
NO.10, for the probe SEQ ID NO.10 and SEQ ID NO.11 of 555 site 1664G > A (R555Q) of TGFBI gene detection；
(2) sample to be examined DNA is extracted, as detection template；
(3) PCR reaction solution of detection TGFBI gene is respectively configured, including TGFBI R124C/L detects reaction solution, TGFBI
R124H detects reaction solution and TGFBI R555W/Q detects reaction solution；
(4) sample to be examined, positive reference substance, negative controls are added in corresponding PCR reaction tube respectively；
(5) carry out multiple fluorescence quantitative PCR detection, multiplexed PCR amplification program are as follows: 37 DEG C 2 minutes；94 DEG C of initial denaturations 4 are divided
Clock；95 DEG C are denaturalized 30 seconds, and 60 DEG C are annealed 30 seconds, 45 circulations；
(6) according to multiple fluorescence quantitative PCR result judgement gene mutation.
Primer and probe sequence in the present invention is as follows:
SEQ ID NO.1:5 ' tcgttggatccaccaccact 3 '
SEQ ID NO.2:5 ' GGGCGAAGATGGTGAAGCT 3 '
SEQ ID NO.3:FAM-CtgtacacggacTGcacggagaagCTG-BHQ1
SEQ ID NO.4:HEX-tgtacacggaccGcacggagaagC-BHQ1
SEQ ID NO.5:TAMRA-CtgtacacggacCTcacggagaagCTG-BHQ1
SEQ ID NO.6:FAM-CtgtacacggaccAcacggagaagCTG-BHQ1
SEQ ID NO.7:5 ' ccacaaatgaagccttccga 3 '
SEQ ID NO.8:5 ' AATGGAGACGTGTACTTAAGTTGGTC 3 '
SEQ ID NO.9:FAM-CCAccaagagaaTggagcagactcTTG-BHQ1
SEQ ID NO.10:HEX-CCAccaagagaacggagcagactcTTG-BHQ1
SEQ ID NO.11:TAMRA-CCAccaagagaacAgagcagactcTTGG-BHQ1
SEQ ID NO.12:5 ' GATGTTCACTGAAGAGTACCAGAAA3 '
SEQ ID NO.13:5 ' CCACGTATTTTCTGCGTTTTTG3 '
SEQ ID NO.14:CY5-TCTGCTAGAGCAGTACCATCTGGGTCTGG-BHQ1
In summary summary of the invention is as follows: a kind of 124 site of detection people TGFBI gene of the invention and 555 site mutations
Specific primer, the primer is respectively to be directed to the specific primer 1 and 2 of 124 site primer of TGFBI gene, for TGFBI
The specific primer 3 and 4 of 555 site primer of gene, for the specific primer 5 and 6 of reference gene GUSB detection.Specificity is drawn
Object is as follows:
Primer 1:5 ' tcgttggatccaccaccact 3 '
Primer 2: 5 ' GGGCGAAGATGGTGAAGCT 3 '
Primer 3:5 ' ccacaaatgaagccttccga 3 '
Primer 4:5 ' AATGGAGACGTGTACTTAAGTTGGTC 3 '
Primer 5:5 ' GATGTTCACTGAAGAGTACCAGAAA3 '
Primer 6:5 ' CCACGTATTTTCTGCGTTTTTG3 '
A kind of specific probe detecting people TGFBI gene 124 site and 555 site mutations, the probe is respectively needle
To 124 site 370C > T (R124C) of TGFBI gene detection specific probe 1 and 2, for 124 site 371G of TGFBI gene >
The specific probe 3 and 2 of T (R124L) detection is visited for the specificity of 124 site 371G > A (R124H) of TGFBI gene detection
Needle 4 and 2, for the specific probe 5 and 6 of 555 site 1663C > T (R555W) of TGFBI gene detection, for TGFBI gene
The specific probe 7 and 6 of 555 site 1664G > A (R555Q) detection, and visited for the specificity of reference gene GUSB detection
Needle 8.Specific probe is as follows:
Probe 1:FAM-CtgtacacggacTGcacggagaagCTG-BHQ1
Probe 2:HEX-tgtacacggaccGcacggagaagC-BHQ1
Probe 3:TAMRA-CtgtacacggacCTcacggagaagCTG-BHQ1
Probe 4:FAM-CtgtacacggaccAcacggagaagCTG-BHQ1
Probe 5:FAM-CCAccaagagaaTggagcagactcTTG-BHQ1
Probe 6:HEX-CCAccaagagaacggagcagactcTTG-BHQ1
Probe 7:TAMRA-CCAccaagagaacAgagcagactcTTGG-BHQ1
Probe 8:CY5-TCTGCTAGAGCAGTACCATCTGGGTCTGG-BHQ1
A kind of anomaly of cornea disease mutated gene detection kit, component see the table below 1, which includes being directed to TGFBI base
Because of the specific primer and specific probe of 124 site 370C > T (R124C) detection, it is directed to 124 site 371G > T of TGFBI gene
(R124L) specific primer and specific probe that detect, the spy detected for 124 site 371G > A (R124H) of TGFBI gene
Specific primer and specific probe, for the specific primer of 555 site 1663C > T (R555W) of TGFBI gene detection and special
Property probe, for 555 site 1664G > A (R555Q) of TGFBI gene detection specific primer and specific probe, Yi Jizhen
To the primer and probe of internal reference genetic test.The kit further includes PCR premixed liquid, and PCR premixed liquid includes UDG enzyme, DNA polymerization
Enzyme, PCR buffer, MgCl2, dNTPs and dUTP.
The kit further includes positive reference substance and negative controls, and the positive reference substance is the mixed of 8 kinds of recombinant plasmids
Liquid is closed, 7 kinds of recombinant plasmids are to contain TGFBI 370T, TGFBI 371T, TGFBI 371A, TGFBI 1663T, TGFBI
1664G, TGFBI 124WT, TGFBI 555WT and GUSB sequence recombinant plasmid.Negative controls are sterilizing ultrapure water.
Table 1: reagent constituents
The present invention also provides the detection method in a kind of people TGFBI gene 124 site and 555 site mutations, this method packets
Include using above-mentioned 124 site 370C > T (R124C) of detection people TGFBI gene, 124 site 371G > T (R124L) of TGFBI gene,
124 site 371G > A (R124H) of TGFBI gene, 555 site 1663C > T (R555W) of TGFBI gene, 555 site of TGFBI gene
The primer and probe or above-mentioned 124 site of detection people TGFBI gene and 555 site mutations of 1664G > A (R555Q) and reference gene
Kit detection 124 site of people TGFBI gene and the step of 555 site mutation.
Detection method detects gene mutation using multiple fluorescence quantitative PCR technology, the specific steps are as follows:
(1) sample to be examined DNA is extracted, as detection template；
(2) it according to sample number to be detected (containing 1 positive control and 1 negative control), calculates and prepares each reaction mixing
Liquid, including TGFBI R124C/L detection reaction solution, TGFBI R124H detection reaction solution and TGFBI R555W/Q detection reaction
Liquid.Prepared detection reaction solution is dispensed into eight PCR reaction tubes respectively.
(3) sample to be examined, positive reference substance, negative controls are added in corresponding PCR reaction tube respectively.
(4) carry out multiple fluorescence quantitative PCR detection, multiplexed PCR amplification program are as follows: 37 DEG C 2 minutes；94 DEG C 4 minutes；94
DEG C 30 seconds, 60 DEG C (collecting fluorescence signal) 30 seconds, 45 circulations.
(5) according to multiple fluorescence quantitative PCR result judgement gene mutation.
Compared with prior art, the present invention has the following advantages:
(1) 124 site of people TGFBI gene provided by the invention and 555 site mutation detection primers, probe have high special
Property and high sensitivity；
(2) it is detected using multiple fluorescence quantitative PCR technology, detection process is to close the border reaction, and add anti-pollution
System and internal control system more accurate, steadily can carry out parting detection to sample, it is ensured that real result is credible；
(3) easy to operate quick, and result interpretation is simply objective, convenient for analysis, is suitable for large-scale promotion application.
Detailed description of the invention
In order to more clearly explain the embodiment of the invention or the technical proposal in the existing technology, to embodiment or will show below
There is attached drawing needed in technical description to be briefly described, it should be apparent that, the accompanying drawings in the following description is only this
Some embodiments of invention without any creative labor, may be used also for those of ordinary skill in the art
To obtain other drawings based on these drawings.
Fig. 1 is TGFBI 370C/C homozygosis figure in the embodiment of the present invention 2；
Fig. 2 is TGFBI 370C/T heterozygosis figure in the embodiment of the present invention 2；
Fig. 3 is TGFBI 370T/T homozygosis figure in the embodiment of the present invention 2；
Fig. 4 is TGFBI 371G/G homozygosis figure in the embodiment of the present invention 2；
Fig. 5 is TGFBI 371G/T heterozygosis figure in the embodiment of the present invention 2；
Fig. 6 is TGFBI 371T/T homozygosis figure in the embodiment of the present invention 2；
Fig. 7 is TGFBI 371G/G homozygosis figure in the embodiment of the present invention 2；
Fig. 8 is TGFBI 371G/A heterozygosis figure in the embodiment of the present invention 2；
Fig. 9 is TGFBI 371A/A homozygosis figure in the embodiment of the present invention 2；
Figure 10 is TGFBI 1663C/C homozygosis figure in the embodiment of the present invention 2；
Figure 11 is TGFBI 1663C/T heterozygosis figure in the embodiment of the present invention 2；
Figure 12 is TGFBI 1663T/T homozygosis figure in the embodiment of the present invention 2；
Figure 13 is TGFBI 1664G/G homozygosis figure in the embodiment of the present invention 2；
Figure 14 is TGFBI 1664G/A heterozygosis figure in the embodiment of the present invention 2；
Figure 15 is TGFBI 1664A/A homozygosis figure in the embodiment of the present invention 2.
Specific embodiment
The present invention will be further described in detail below with reference to the embodiments, following embodiment be explanation of the invention and
The invention is not limited to following embodiments.
A kind of anomaly of cornea disease mutated gene detection kit of embodiment 1
Specific primer and specific probe are designed according to target gene sequence, the primer and probe of design can be according to existing
There is method to carry out artificial synthesized.Specific primer and probe is as follows:
Primer 1 (TGFBI 124-Fo): 5 ' TCGTTGGATCCACCACCACT3 '
Primer 2 (TGFBI 124-Re): 5 ' GGGCGAAGATGGTGAAGCT 3 '
Primer 3 (TGFBI 555-Fo): 5 ' CCACAAATGAAGCCTTCCGA3 '
Primer 4 (TGFBI 555-Re): 5 ' AATGGAGACGTGTACTTAAGTTGGTC 3 '
Primer 5 (GUSB-Fo): 5 ' GATGTTCACTGAAGAGTACCAGAAA3 '
Primer 6 (GUSB-Re): 5 ' CCACGTATTTTCTGCGTTTTTG3 '
Probe 1 (TGFBI 370T-Pr): FAM-CtgtacacggacTGcacggagaagCTG-BHQ1
Probe 2 (TGFBI 124WT-Pr): HEX-tgtacacggaccGcacggagaagC-BHQ1
Probe 3 (TGFBI 371T-Pr): TAMRA-CtgtacacggacCTcacggagaagCTG-BHQ1
Probe 4 (TGFBI 371A-Pr): FAM-CtgtacacggaccAcacggagaagCTG-BHQ1
Probe 5 (TGFBI 1663T-Pr): FAM-CCAccaagagaaTggagcagactcTTG-BHQ1
Probe 6 (TGFBI 555WT-Pr): HEX-CCAccaagagaacggagcagactcTTG-BHQ1
Probe 7 (TGFBI 1664A-Pr): TAMRA-CCAccaagagaacAgagcagactcTTGG-BHQ1
Probe 8 (GUSB-Pr): CY5-TCTGCTAGAGCAGTACCATCTGGGTCTGG-BHQ1
A kind of anomaly of cornea disease mutated gene detection kit of the invention includes three groups of primed probe mixed liquors, respectively
Are as follows:
TGFBI R124C/L primed probe mixed liquor: it is used for 124 site 370C > T (R124C) and TGFBI of TGFBI gene
124 site 371G > T (R124L) of gene detection includes specific forward primer TGFBI 124-Fo and downstream primer TGFBI
124-Re, reference gene upstream primer GUSB-Fo and downstream primer GUSB-Re, specific probe TGFBI 370T-Pr, TGFBI
124WT-Pr and TGFBI 371T-Pr, reference gene probe GUSB-Pr.
TGFBI R124H primed probe mixed liquor: detecting for 124 site 371G > A (R124H) of TGFBI gene, including
Upstream primer TGFBI 124-Fo and downstream primer TGFBI 124-Re, reference gene upstream primer GUSB-Fo and downstream primer
GUSB-Re, specific probe TGFBI 1663T-Pr and TGFBI 124WT-Pr, reference gene probe GUSB-Pr.
TGFBI R555W/Q primed probe mixed liquor: it is used for 555 site 1663C > T (R555W) and TGFBI of TGFBI gene
555 site 1664G > A (R555Q) of gene detection, including upstream primer TGFBI 555-Fo and downstream primer TGFBI 555-Re,
Reference gene upstream primer GUSB-Fo and downstream primer GUSB-Re, specific probe include TGFBI 1663T-Pr, TGFBI
555WT-Pr and TGFBI 1664A-Pr, reference gene probe GUSB-Pr.
PCR premixed liquid include PCR premixed liquid include UDG enzyme, archaeal dna polymerase, PCR buffer, MgCl2, dNTPs and
dUTP。
Positive reference substance is to contain TGFBI 370T, TGFBI 371T, TGFBI 371A, TGFBI 1663T, TGFBI
Recombinant plasmid mixed liquor including 1664G, TGFBI 124WT, TGFBI 555WT and GUSB；Negative controls are that sterilizing is ultrapure
Water.
Embodiment 2
124 site of people TGFBI gene and 555 site mutations are detected using the kit of the embodiment of the present invention 1, including following
Step:
(1) sample to be tested processing and template extraction；
20 parts of buccal swab samples of random acquisition extract DNA with extracts kit, extract DNA stoste as PCR and detect mould
Plate.
Homozygous wild, heterozygous mutant and homozygous mutation quality-control product are prepared with the recombinant plasmid of synthesis, carries out PCR detection.Match
Method processed is as follows:
The homozygous wild quality-control product of TGFBI 370C/C: the TGFBI 370C/C plasmid of synthesis and GUSB plasmid are diluted respectively
It is mixed well at 400 copies/μ L by two kinds of plasmids respectively to mix in equal volume.
TGFBI 370C/T heterozygous mutant quality-control product: by the TGFBI 370C/C plasmid of synthesis, TGFBI 370T/T plasmid
It is diluted to 600 copies/μ L respectively with GUSB plasmid, by two kinds of plasmids respectively to mix in equal volume, mixes well.
TGFBI 370T/T homozygous mutation quality-control product: the TGFBI 370T/T plasmid of synthesis and GUSB plasmid are diluted respectively
It is mixed well at 400 copies/μ L by two kinds of plasmids respectively to mix in equal volume.
The homozygous wild quality-control product of TGFBI 371G/G: the TGFBI 371G/G plasmid of synthesis and GUSB plasmid are diluted respectively
It is mixed well at 400 copies/μ L by two kinds of plasmids respectively to mix in equal volume.
TGFBI 371G/T heterozygous mutant quality-control product: by the TGFBI 371G/G plasmid of synthesis, TGFBI 371T/T plasmid
It is diluted to 600 copies/μ L respectively with GUSB plasmid, by two kinds of plasmids respectively to mix in equal volume, mixes well.
TGFBI 371T/T homozygous mutation quality-control product: the TGFBI 371T/T plasmid of synthesis and GUSB plasmid are diluted respectively
It is mixed well at 400 copies/μ L by two kinds of plasmids respectively to mix in equal volume.
TGFBI 371G/A heterozygous mutant quality-control product: by the TGFBI 371G/G plasmid of synthesis, TGFBI 371A/A plasmid
It is diluted to 600 copies/μ L respectively with GUSB plasmid, by two kinds of plasmids respectively to mix in equal volume, mixes well.
TGFBI 371A/A homozygous mutation quality-control product: the TGFBI 371A/A plasmid of synthesis and GUSB plasmid are diluted respectively
It is mixed well at 400 copies/μ L by two kinds of plasmids respectively to mix in equal volume.
The homozygous wild quality-control product of TGFBI 1663C/C: the TGFBI 1663C/C plasmid of synthesis and GUSB plasmid difference is dilute
It is interpreted into 400 copies/μ L, by two kinds of plasmids respectively to mix in equal volume, is mixed well.
TGFBI 1663C/T heterozygous mutant quality-control product: by the TGFBI 1663C/C plasmid of synthesis, TGFBI 1663T/T matter
Grain and GUSB plasmid are diluted to 600 copies/μ L respectively, by two kinds of plasmids respectively to mix in equal volume, mix well.
TGFBI 1663T/T homozygous mutation quality-control product: the TGFBI 1663T/T plasmid of synthesis and GUSB plasmid difference is dilute
It is interpreted into 400 copies/μ L, by two kinds of plasmids respectively to mix in equal volume, is mixed well.
The homozygous wild quality-control product of TGFBI 1664G/G: the TGFBI 1664G/G plasmid of synthesis and GUSB plasmid difference is dilute
It is interpreted into 400 copies/μ L, by two kinds of plasmids respectively to mix in equal volume, is mixed well.
TGFBI 1664G/A heterozygous mutant quality-control product: by the TGFBI 1664G/G plasmid of synthesis, TGFBI 1664A/A matter
Grain and GUSB plasmid are diluted to 600 copies/μ L respectively, by two kinds of plasmids respectively to mix in equal volume, mix well.
TGFBI 1664A/A homozygous mutation quality-control product: the TGFBI 1664A/A plasmid of synthesis and GUSB plasmid difference is dilute
It is interpreted into 400 copies/μ L, by two kinds of plasmids respectively to mix in equal volume, is mixed well.
(2) system is prepared
All components in kit are melted on ice, according to sample number to be detected, calculate and prepare each reaction mixture (see
Table 2).
Table 2 detects reaction solution and prepares formula
(3) PCR amplification
(4) interpretation of result
Threshold value setting: according to different type of machines given threshold, Ct value is determined: selection STD reaction tube, NTC and example reaction pipe
Threshold value delimited together, and obtaining each system and internal reference Ct value feminine gender should rise without template blank control (NTC) without amplification curve；
According to △ Ct value (△ Ct=FAM signal Ct value-HEX signal Ct value or △ Ct=TAMRA signal Ct value-HEX signal
Ct value), determine the gene pleiomorphism of corresponding sample, see Table 3 for details for result judgement.
3 result judgement of table
124 site of TGFBI gene and 555 site mutation testing results are shown in explanatory diagram (Fig. 1-Figure 15)
(5) result verification
The present invention has carried out sequence verification to above-mentioned sample simultaneously, the results showed that 20 testing results and sequencing result are complete
Meet entirely, is homozygous wildtype.
In addition, it should be noted that, the specific embodiments described in this specification, the named title of raw material, product
Etc. can be different.The equivalent or simple change that all principles described according to the invention patent design are done is included in of the invention special
In the protection scope of benefit.Those skilled in the art can do described specific embodiment various
The similar mode of modify or supplement or adopt substitute, without departing from structure of the invention or surmount the claims institute
The range of definition, is within the scope of protection of the invention.
Claims (10)
1. a kind of people TGFBI gene mutation detection kit, it is characterised in that: the detection kit includes primer sets and spy
Needle；
The primer sets are at least one set in following two groups:
For the primer SEQ ID NO.1 and SEQ ID NO.2 in 124 site of TGFBI gene；
For the primer SEQ ID NO.5 and SEQ ID NO.6 in 555 site of TGFBI gene；
The probe is selected from below for the saltant type probe of primer corresponding site and at least one set of wild-type probe:
For the probe SEQ ID NO.3 and SEQ ID NO.4 of 124 site 370C > T (R124C) of TGFBI gene detection；
For the probe SEQ ID NO.4 and SEQ ID NO.5 of 124 site 371G > T (R124L) of TGFBI gene detection；
For the probe SEQ ID NO.4 and SEQ ID NO.6 of 124 site 371G > A (R124H) of TGFBI gene detection；
For probe SEQ ID NO.9 and SEQ the ID NO.10 of 555 site 1663C > T (R555W) of TGFBI gene detection, needle
To the probe SEQ ID NO.10 and SEQ ID NO.11 of 555 site 1664G > A (R555Q) of TGFBI gene detection.
2. people TGFBI gene mutation detection kit according to claim 1, it is characterised in that: the probe SEQ
ID NO.3, SEQ ID NO.6, SEQ ID NO.9 5 ' ends be marked with fluorophor FAM, 3 ' ends are marked with quenching group
BHQ1；
5 ' the ends of the probe SEQ ID NO.4, SEQ ID NO.10 are marked with fluorophor HEX, and 3 ' ends, which are marked with, to be quenched
Group BHQ1；
5 ' the ends of the probe SEQ ID NO.5, SEQ ID NO.11 are marked with fluorophor TAMRA, and 3 ' ends, which are marked with, quenches
Go out group BHQ1.
3. people TGFBI gene mutation detection kit according to claim 1, it is characterised in that: the detection reagent
Box further includes primer SEQ ID NO.12, the SEQ ID NO.13 for reference gene GUSB detection, and is directed to reference gene
The probe SEQ ID NO.14 of GUSB detection.
4. people TGFBI gene mutation detection kit according to claim 3, it is characterised in that: the probe SEQ
5 ' the ends of ID NO.14 are marked with fluorophor CY5, and 3 ' ends are marked with quenching group BHQ1.
5. people TGFBI gene mutation detection kit according to claim 1, it is characterised in that: the detection reagent
Box includes primer sets and probe；
The primer sets are as follows:
For the primer SEQ ID NO.1 and SEQ ID NO.2 in 124 site of TGFBI gene；
For the primer SEQ ID NO.5 and SEQ ID NO.6 in 555 site of TGFBI gene；
The probe is selected from the saltant type probe and wild-type probe below for primer corresponding site:
For the probe SEQ ID NO.3 and SEQ ID NO.4 of 124 site 370C > T (R124C) of TGFBI gene detection；
For the probe SEQ ID NO.4 and SEQ ID NO.5 of 124 site 371G > T (R124L) of TGFBI gene detection；
For the probe SEQ ID NO.4 and SEQ ID NO.6 of 124 site 371G > A (R124H) of TGFBI gene detection；
For probe SEQ ID NO.9 and SEQ the ID NO.10 of 555 site 1663C > T (R555W) of TGFBI gene detection, needle
To the probe SEQ ID NO.10 and SEQ ID NO.11 of 555 site 1664G > A (R555Q) of TGFBI gene detection.
6. people TGFBI gene mutation detection kit according to claim 5, it is characterised in that: the probe SEQ
ID NO.3, SEQ ID NO.6, SEQ ID NO.9 5 ' ends be marked with fluorophor FAM, 3 ' ends are marked with quenching group
BHQ1；
5 ' the ends of the probe SEQ ID NO.4, SEQ ID NO.10 are marked with fluorophor HEX, and 3 ' ends, which are marked with, to be quenched
Group BHQ1；
5 ' the ends of the probe SEQ ID NO.5, SEQ ID NO.11 are marked with fluorophor TAMRA, and 3 ' ends, which are marked with, quenches
Go out group BHQ1.
7. people TGFBI gene mutation detection kit according to claim 5, it is characterised in that: the detection reagent
Box further includes PCR premixed liquid；
The PCR premixed liquid includes UDG enzyme, archaeal dna polymerase, PCR buffer, MgCl2, dNTPs and dUTP.
8. according to any people's TGFBI gene mutation detection kit of claim 5-7, it is characterised in that: the inspection
Test agent box further includes positive reference substance and negative controls, and the positive reference substance is the mixed liquor of 8 kinds of recombinant plasmids, described
7 kinds of recombinant plasmids be containing TGFBI 370T, TGFBI 371T, TGFBI 371A, TGFBI 1663T, TGFBI 1664G,
TGFBI 124WT, TGFBI 555WT, another group of recombinant plasmid for GUSB sequence；
The negative controls are sterilizing ultrapure water.
9. a kind of TGFBI detection method of gene mutation, characterized by the following steps:
(1) design obtains primer and probe, and the primer sets are at least one set in following two groups: being directed to TGFBI base
Because of the primer SEQ ID NO.1 and SEQ ID NO.2 in 124 sites；
For the primer SEQ ID NO.5 and SEQ ID NO.6 in 555 site of TGFBI gene；
The probe is selected from the saltant type probe and wild-type probe below for primer corresponding site:
For the probe SEQ ID NO.3 and SEQ ID NO.4 of 124 site 370C > T (R124C) of TGFBI gene detection；
For the probe SEQ ID NO.4 and SEQ ID NO.5 of 124 site 371G > T (R124L) of TGFBI gene detection；
For the probe SEQ ID NO.4 and SEQ ID NO.6 of 124 site 371G > A (R124H) of TGFBI gene detection；
For probe SEQ ID NO.9 and SEQ the ID NO.10 of 555 site 1663C > T (R555W) of TGFBI gene detection, needle
To the probe SEQ ID NO.10 and SEQ ID NO.11 of 555 site 1664G > A (R555Q) of TGFBI gene detection；
(2) sample to be examined DNA is extracted, as detection template；
(3) PCR reaction solution of detection TGFBI gene is respectively configured, including TGFBI R124C/L detects reaction solution, TGFBI
R124H detects reaction solution and TGFBI R555W/Q detects reaction solution；
(4) sample to be examined, positive reference substance, negative controls are added in corresponding PCR reaction tube respectively；
(5) carry out multiple fluorescence quantitative PCR detection, multiplexed PCR amplification program are as follows: 37 DEG C 2 minutes；94 DEG C initial denaturation 4 minutes；95
DEG C denaturation 30 seconds, 60 DEG C anneal 30 seconds, 45 circulation；
(6) according to multiple fluorescence quantitative PCR result judgement gene mutation.
10. people TGFBI detection method of gene mutation according to claim 9, it is characterised in that: received in 60 DEG C of annealing stages
Collect fluorescence signal.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811164970.XA CN109161589A (en) | 2018-10-07 | 2018-10-07 | A kind of people TGFBI gene mutation detection kit and its detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811164970.XA CN109161589A (en) | 2018-10-07 | 2018-10-07 | A kind of people TGFBI gene mutation detection kit and its detection method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109161589A true CN109161589A (en) | 2019-01-08 |
Family
ID=64877341
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811164970.XA Pending CN109161589A (en) | 2018-10-07 | 2018-10-07 | A kind of people TGFBI gene mutation detection kit and its detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109161589A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113999899A (en) * | 2020-07-28 | 2022-02-01 | 首都医科大学附属北京同仁医院 | Kit for detecting TGFBI gene mutation |
| CN116024335A (en) * | 2023-02-14 | 2023-04-28 | 福建佰孟医学科技有限公司 | Corneal dystrophy gene mutation detection primer composition, kit and detection method |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103313648A (en) * | 2010-10-01 | 2013-09-18 | 阿维利诺研究所 | System for diagnosing Avellino corneal dystrophy |
| CN105274228A (en) * | 2015-10-27 | 2016-01-27 | 上海芯超生物科技有限公司 | Kit and method for warfarin medicine gene mutation site detection |
| KR20160088996A (en) * | 2015-01-16 | 2016-07-27 | 연세대학교 산학협력단 | Mutations Related to Severe Avellino Corneal Dystrophies and Use Thereof |
| CN106434923A (en) * | 2016-09-28 | 2017-02-22 | 江苏睿玻生物科技有限公司 | MTHFR gene C677T non-invasive detection kit and method |
| CN107523635A (en) * | 2017-10-09 | 2017-12-29 | 湖南大地同年生物科技有限公司 | A kind of TGFBI gene pleiomorphisms quick detection kit and its detection method |
| CN108085375A (en) * | 2016-11-07 | 2018-05-29 | 北京宏微特斯生物科技有限公司 | Detect the method and its kit of the genotype of corneal dystrophy gene polymorphism sites |
-
2018
- 2018-10-07 CN CN201811164970.XA patent/CN109161589A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103313648A (en) * | 2010-10-01 | 2013-09-18 | 阿维利诺研究所 | System for diagnosing Avellino corneal dystrophy |
| KR20160088996A (en) * | 2015-01-16 | 2016-07-27 | 연세대학교 산학협력단 | Mutations Related to Severe Avellino Corneal Dystrophies and Use Thereof |
| CN105274228A (en) * | 2015-10-27 | 2016-01-27 | 上海芯超生物科技有限公司 | Kit and method for warfarin medicine gene mutation site detection |
| CN106434923A (en) * | 2016-09-28 | 2017-02-22 | 江苏睿玻生物科技有限公司 | MTHFR gene C677T non-invasive detection kit and method |
| CN108085375A (en) * | 2016-11-07 | 2018-05-29 | 北京宏微特斯生物科技有限公司 | Detect the method and its kit of the genotype of corneal dystrophy gene polymorphism sites |
| CN107523635A (en) * | 2017-10-09 | 2017-12-29 | 湖南大地同年生物科技有限公司 | A kind of TGFBI gene pleiomorphisms quick detection kit and its detection method |
Non-Patent Citations (1)
| Title |
|---|
| DAVID G. COURTNEY ET AL.: "Protein Composition of TGFBI-R124C- and TGFBI-R555-WAssociated Aggregates Suggests Multiple Mechanisms Leading to Lattice and Granular Corneal Dystrophy", 《IOVS》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113999899A (en) * | 2020-07-28 | 2022-02-01 | 首都医科大学附属北京同仁医院 | Kit for detecting TGFBI gene mutation |
| CN116024335A (en) * | 2023-02-14 | 2023-04-28 | 福建佰孟医学科技有限公司 | Corneal dystrophy gene mutation detection primer composition, kit and detection method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN114085903B (en) | Primer pair probe combination product for detecting mitochondria 3243A & gtG mutation, kit and detection method thereof | |
| CN110305948A (en) | A kind of reagent and method detecting self-closing disease related gene UBE3A copy number | |
| Chen et al. | Association of variant interactions in RANK, RANKL, OPG, TRAF6, and NFATC1 genes with the development of osteonecrosis of the femoral head | |
| CN109468372A (en) | Primer combination, method and the kit in a variety of hereditary metabolic disorders hepatopathy targetings library are constructed based on high-flux sequence | |
| CN109161589A (en) | A kind of people TGFBI gene mutation detection kit and its detection method | |
| CN107523617A (en) | The standard items of intestinal cancer clinical drug-resistant genetic test and its application | |
| CN103374575B (en) | CYP4V2 gene mutant and application thereof | |
| CN106811517A (en) | It is a kind of for detecting that c-MET gene extrons 14 are skipped the composition and kit of mutation | |
| CN108715893B (en) | SNP markers related to radioactive brain injury caused by radiotherapy and application thereof | |
| CN103074415A (en) | Obesity gene susceptivity and pre-warning detection kit | |
| CN106834501A (en) | To the fat related mononucleotide polymorphism site of Children in China and its application | |
| CN110551728A (en) | FOXC1 gene mutant and application thereof | |
| CN109321569B (en) | Primer probe composition and application thereof | |
| CN107312859A (en) | Application of the AQP5 genes in detection congenital cataract product is prepared | |
| CN103374574A (en) | CYP4V2 gene mutant and application thereof | |
| CN108753945A (en) | With Children in China obesity and/or the relevant SNP site of hypertriglyceridemia and its application | |
| CN110184270A (en) | Diagnosis marker of the non-coding RNA as Male Osteoporosis | |
| CN104928297A (en) | LPL (lipoprotein lipase) novel mutant pathogenic gene of separated familial chylomicronemia syndrome and kit for detecting same | |
| Huan et al. | Identifying Novel Genes and Variants in Immune and Coagulation Pathways Associated with Macular Degeneration | |
| CN106701947A (en) | Kit for detecting genotype of gene CYP2C19 at SNP site rs4986893 | |
| CN108753959B (en) | SNP marker located in DISC1FP1 gene and related to radioactive brain injury caused by radiotherapy and application thereof | |
| CN113528469A (en) | High-risk HPV nucleic acid detection pseudovirus standard substance | |
| CN108441560B (en) | SNP marker located in CEP128 gene and related to radioactive brain injury caused by radiotherapy and application thereof | |
| CN108998527A (en) | A kind of relevant osteopontin functionality SNP of nasopharynx cancer onset risk and application | |
| JP2008182993A (en) | Method, program and system for judging gene examination result |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |