CN109161581B - Mongolian leek chromosome fluorescence in situ hybridization method - Google Patents
Mongolian leek chromosome fluorescence in situ hybridization method Download PDFInfo
- Publication number
- CN109161581B CN109161581B CN201811038847.3A CN201811038847A CN109161581B CN 109161581 B CN109161581 B CN 109161581B CN 201811038847 A CN201811038847 A CN 201811038847A CN 109161581 B CN109161581 B CN 109161581B
- Authority
- CN
- China
- Prior art keywords
- leek
- placing
- chromosome
- fluorescence
- water
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6841—In situ hybridisation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
Abstract
The invention provides a method for fluorescence in situ hybridization of Mengdu leek chromosomes, which comprises the following steps: s1, preparing a mongolian leek chromosome slide specimen; s2 and 45S rDNA probes are prepared, a conservative sequence is selected from a corn 45S rDNA sequence to synthesize a probe, and a fluorescent group is connected to the 5 'end or the 3' end of the probe sequence, wherein the probe sequence is SEQ ID NO: 1-3; s3, chromosome fluorescence in situ hybridization; s4, eluting and detecting; the fluorescent in-situ hybridization method can perform fluorescent in-situ hybridization on the Mongolian leek, can clearly display the 45S rDNA locus of the Mongolian leek chromosome, has high hybridization specificity, can be better applied to chromosome detection of the Mongolian leek, and is convenient for analyzing the karyotype of the Mongolian leek chromosome.
Description
Technical Field
The invention belongs to the technical field of cytogenetics and molecular biology, and particularly relates to a method for fluorescence in situ hybridization of a chromosome of leek mongolica.
Background
Fluorescence In Situ Hybridization (FISH) is an important non-radioactive labeling in situ hybridization technology which is developed in the late 80 th 20 th century and is widely applied to research of plant molecular cytogenetics, gene amplification, gene mapping and identification of plant evolution and genetic relationship.
The ribosomal rRNA gene is one of the most important housekeeping genes of organisms, and its transcription product is assembled into a ribosome together with ribosomal proteins. The main rDNA (18S, 5.8S, 28S) and 5S rDNA of the higher plant nucleus are composed of highly repetitive sequences which are gene coding regions, have high selection pressure and belong to highly conserved regions, have hundreds or even thousands of copies in a plant genome, are distributed on one or a plurality of parts of a chromosome in a cluster mode in a tandem repetitive arrangement mode, and the positions of the 18SrDNA and the 5SrDNA on the chromosome can be positioned by performing Fluorescence In Situ Hybridization (FISH) on the plant chromosome by adopting 18SrDNA and 5SrDNA probes, so that important information is provided for the evolution and karyotype analysis of the plant genome.
Mongolian leek (the academic name: Allium mongolicum Regel) is a perennial herb of the Liliaceae family, belonging to the genus Allium, and is also called shallot, and is distributed in northeast, north Qinghai, Gansu, north Ningxia, north Shaanxi, west Liaoning, and the like, in Xinjiang, in China. The Mongolian leek is rich in various nutrient components such as essential trace elements, vitamins, amino acids and the like, in addition, the Mongolian leek can be used as a medicine, can stimulate appetite, promote digestion and kill insects, is mainly used for treating various diseases such as dyspepsia, anorexia, baldness, green leg diseases and the like, has important pharmacological actions such as removing miasma and expelling malignant toxicity and the like, and is praised as 'desert potherb', 'vegetable good in sand' and 'lucid ganoderma in vegetables'. However, the current karyotype analysis of the Mongolian leek adopts a classical cytological means, and no report about the application of the fluorescence in situ hybridization method to the Mongolian leek for karyotype analysis is found. Therefore, the invention provides a rapid and accurate Mongolian leek chromosome fluorescence in situ hybridization method, which dyes chromosomes with good dispersion and strong fluorescence signals.
Disclosure of Invention
Therefore, the technical problem to be solved by the invention is to provide a rapid and accurate Mongolian leek chromosome fluorescence in-situ hybridization method for dyeing chromosomes with good dispersion and strong fluorescence signals.
The invention provides a method for fluorescence in situ hybridization of Mengdu leek chromosomes, which comprises the following steps:
s1, preparing a mongolian leek chromosome slide specimen;
s2 and 45S rDNA probes are prepared, a conservative sequence is selected from a corn 45S rDNA sequence to synthesize a probe, and a fluorescent group is connected to the 5 'end or the 3' end of the probe sequence, wherein the probe sequence is SEQ ID NO: 1-3;
s3, chromosome fluorescence in situ hybridization;
and S4, eluting and detecting.
The Mongolian leek chromosome fluorescence in situ hybridization method is characterized in that the probe sequence is shown as SEQ ID NO: 1-2.
In the method for fluorescence in situ hybridization of the chromosome of the leek mongolica, in the step of S1, the preparation of the leek mongolica chromosome slide specimen comprises the following steps:
(1) material taking: washing Mengolian leek seeds with distilled water for 1-3 times, soaking in the soaking solution, placing in a culture dish containing 2 layers of wet filter paper, adding water, placing in a thermostat, culturing at 22-25 deg.C until the root tip of the seeds grows to 0.5-1cm, and cutting to obtain 1-2mm root tips;
(2) tabletting: placing the cut root tip into a small bottle, adding appropriate amount of water, sealing, rapidly placing into ice water mixture at 0 deg.C, and pretreating in a refrigerator at 0 deg.C for 20-24 hr;
(3) fixing: washing the pretreated root tips, and fixing with freshly prepared Carnoy's fixative (glacial acetic acid: ethanol ═ 1:3) at room temperature (25 deg.C) for 12-24 h;
(4) dissociation: washing the root tips in the step (3) with distilled water for 2 times, each time for 6min, so as to wash out the fixative, then using 2.5% (w/w) of enzyme mixed by pectinase and cellulase according to the weight ratio of 1:1, dissociating the root tips for 1 hour at 37 ℃, washing out the enzyme solution with distilled water, and then using the prepared Carnoy's fixative (glacial acetic acid: alcohol ═ 1:3) to fix for 1-2 hours at room temperature (25 ℃);
(5) dyeing: taking out the root tip, cutting about 0.5mm with a scalpel, placing on a glass slide, dropping a drop of staining solution for staining, then placing on a cover glass, staining for 5min, taking filter paper, covering on the cover glass, fixing the filter paper, and then tabletting to disperse and spread the tissue at the root tip;
(6) microscopic examination: and (3) loading the slide into a microscope, observing the distribution condition of chromosomes in cells, and storing the dispersed slide specimen in an environment at the temperature of minus 20 ℃.
The Mongolian leek chromosome fluorescence in-situ hybridization method is characterized in that the seed soaking liquid consists of brown sugar, mannitol, acetone and water.
The method for carrying out fluorescence in situ hybridization on the chromosome of the leek mongolica comprises the following steps of: 70-90mg/L of brown sugar; mannitol, 120-170 mg/L; acetone, 10-40 mg/L; the balance being water.
The method for carrying out fluorescence in situ hybridization on the chromosome of the leek mongolica comprises the following steps of: brown sugar, 80 mg/L; mannitol, 150 mg/L; acetone, 25 mg/L; the balance being water.
The invention also provides a method for dyeing and flaking the root tips of the Mongolian leeks, which comprises the following steps: (1) material taking: washing Mengolian leek seeds with distilled water for 1-3 times, soaking in the soaking solution, placing in a culture dish containing 2 layers of wet filter paper, adding water, placing in a thermostat, culturing at 22-25 deg.C until the root tip of the seeds grows to 0.5-1cm, and cutting to obtain 1-2mm root tips;
(2) tabletting: placing the cut root tip into a small bottle, adding appropriate amount of water, sealing, rapidly placing into ice water mixture at 0 deg.C, and pretreating in a refrigerator at 0 deg.C for 20-24 hr;
(3) fixing: washing the pretreated root tips, and fixing with freshly prepared Carnoy's fixative (glacial acetic acid: ethanol ═ 1:3) at room temperature (25 deg.C) for 12-24 h;
(4) dissociation: washing the root tips in the step (3) with distilled water for 2 times, each time for 6min, so as to wash out the fixative, then using 2.5% (w/w) of enzyme mixed by pectinase and cellulase according to the weight ratio of 1:1, dissociating the root tips for 1 hour at 37 ℃, washing out the enzyme solution with distilled water, and then using the prepared Carnoy's fixative (glacial acetic acid: alcohol ═ 1:3) to fix for 1-2 hours at room temperature (25 ℃);
(5) dyeing: taking out the root tip, cutting about 0.5mm with a scalpel, placing on a glass slide, dropping a drop of staining solution for staining, then placing on a cover glass, staining for 5min, taking filter paper, covering on the cover glass, fixing the filter paper, and then tabletting to disperse and spread the tissue at the root tip;
(6) microscopic examination: and (3) loading the slide into a microscope, observing the distribution condition of chromosomes in cells, and storing the dispersed slide specimen in an environment at the temperature of minus 20 ℃.
The Mongolian leek chromosome fluorescence in-situ hybridization method is characterized in that the seed soaking liquid consists of brown sugar, mannitol, acetone and water.
The method for carrying out fluorescence in situ hybridization on the chromosome of the leek mongolica comprises the following steps of: 70-90mg/L of brown sugar; mannitol, 120-170 mg/L; acetone, 10-40 mg/L; the balance being water.
The method for carrying out fluorescence in situ hybridization on the chromosome of the leek mongolica comprises the following steps of: brown sugar, 80 mg/L; mannitol, 150 mg/L; acetone, 25 mg/L; the balance being water.
The technical scheme of the invention has the following advantages:
1. the invention provides a method for fluorescence in situ hybridization of Mengdu leek chromosomes, which comprises the following steps: s1, preparing a mongolian leek chromosome slide specimen; s2 and 45S rDNA probes are prepared, a conservative sequence is selected from a corn 45S rDNA sequence to synthesize a probe, and a fluorescent group is connected to the 5 'end or the 3' end of the probe sequence, wherein the probe sequence is SEQ ID NO: 1-3; s3, chromosome fluorescence in situ hybridization; s4, eluting and detecting; the fluorescent in-situ hybridization method can perform fluorescent in-situ hybridization on the Mongolian leek, can clearly display 45SrDNA sites of the Mongolian leek chromosome, has high hybridization specificity, can be better applied to chromosome detection of the Mongolian leek, and is convenient for analyzing the karyotype of the Mongolian leek chromosome.
2. The invention provides a fluorescence in situ hybridization method for chromosomes of leek mongolica, wherein a probe sequence is shown as SEQ ID NO: 1-2, the probe sequence is selected to carry out fluorescence in situ hybridization on the leek of Mongolia, the hybridization specificity is strong, and the fluorescence signal is strong.
3. The invention provides a method for carrying out fluorescence in situ hybridization on Mongolian leek chromosomes, which is characterized in that a seed soaking solution is composed of brown sugar, mannitol, acetone and water, the seed soaking solution is adopted to carry out seed soaking and germination acceleration on Mongolian leeks, the seeds of the Mongolian leeks can be promoted to rapidly take roots and germinate, compared with the traditional method that only water is used for germinating in a constant temperature box, the culture time can be greatly shortened from original 4-5 days, and the time is greatly saved.
4. The invention provides a fluorescence in situ hybridization method for chromosomes of Mongolian leeks, which is characterized in that a seed soaking solution consists of the following components in concentration: 70-90mg/L of brown sugar; mannitol, 120-170 mg/L; acetone, 10-40 mg/L; the balance of water; the seed soaking liquid can further shorten the culture time to 20 hours, greatly saves the time and improves the efficiency.
5. According to the method for dyeing and flaking the root tips of the Mongolian leeks, the dyed chromosomes in the slide prepared by the method for dyeing and flaking the root tips of the Mongolian leeks are good in dispersity, and the fluorescence in-situ hybridization and observation are facilitated.
6. The invention provides a method for dyeing and flaking root tips of Mongolian leeks, which is characterized in that a seed soaking solution comprises the following components in concentration: 70-90mg/L of brown sugar; mannitol, 120-170 mg/L; acetone, 10-40 mg/L; the balance of water; the seed soaking liquid can further shorten the culture time to 20 hours, greatly saves the time and improves the efficiency.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.
FIG. 1 shows the FISH mapping result of 45S rDNA on metaphase chromosome of leek mongolica in example 1 of the present invention, and the arrow indicates the site of 45S rDNA hybridization signal;
FIG. 2 is a diagram showing the metaphase chromosome distribution of leek mongolica in the microscopic examination step in example 2 of the present invention;
FIG. 3 shows the FISH mapping result of 45S rDNA on metaphase chromosome of leek mongolica in example 2 of the present invention, and the arrow indicates the site of 45S rDNA hybridization signal;
FIG. 4 shows the FISH mapping of 45S rDNA on metaphase chromosome of leek in example 4 of the present invention, and the arrow indicates the site of 45S rDNA hybridization signal.
Detailed Description
The seeds of leek Mongolian are commercially available in the following examples.
Example 1
The embodiment provides a method for fluorescence in situ hybridization of Mengdu leek chromosomes, which comprises the following steps:
s1, preparing a leek mongolicus chromosome slide specimen:
(1) material taking: placing Mongolian leek seeds in a culture dish containing 2 layers of wet filter paper, adding water, placing in a thermostat, culturing at 22-25 deg.C for 4-5 days until the root tip of the seeds grows to 0.6cm and meets the requirement of the root tip of the seeds by 0.5-1cm, and cutting to obtain 1-2mm root tips.
(2) Tabletting: placing the cut root tip into a small bottle, adding appropriate amount of water, sealing, rapidly placing into 0 deg.C ice water mixture, and pretreating in 0 deg.C refrigerator for 20-24 h.
(3) Fixing: the pretreated root tips were washed and fixed with freshly prepared Carnoy's fixative (glacial acetic acid: ethanol ═ 1:3) at room temperature (25 ℃) for 12-24 h.
(4) Dissociation: washing the root tip in the step (3) with distilled water for 2 times, each time for 6min, so as to wash out the fixative, then using 2.5% (w/w) of enzyme mixed by pectase and cellulase according to the weight ratio of 1:1, dissociating the root tip for 1 hour at 37 ℃, washing out the enzyme solution with distilled water, and then using the prepared Carnoy's fixative (glacial acetic acid: alcohol ═ 1:3) to fix for 1-2 hours at room temperature (25 ℃).
(5) Dyeing: the root tip was taken out and cut with a scalpel to about 0.5mm, and placed on a glass slide, a drop of staining solution was dropped, in this example, Giemsa staining solution (1:30 dilution) was used for staining, then a cover glass was placed, after staining for about 5min, filter paper was taken out and covered on the cover glass, the filter paper was fixed, and then the tissue at the root tip was spread by spreading by pressing.
(6) Microscopic examination: and (3) loading the slide into a microscope, observing the distribution condition of chromosomes in cells, and storing the dispersed slide specimen in an environment at the temperature of minus 20 ℃.
Preparation of S2 and 45S rDNA probes: a segment of conserved sequence CACTAGCTATCCGATCATCAC (shown as SEQ ID NO: 1) is selected from a corn 45S rDNA sequence (shown as SEQ ID NO: 4) and synthesized by Shanghai, and the 5' end of the segment is provided with green fluorescence labeling FAM (carboxyl fluorescein, Shanghai). The probe was diluted with distilled water to 30 ng/. mu.l and stored in a refrigerator at-20 ℃ for further use.
S3 chromosome fluorescence in situ hybridization method
Chromosome degeneration: preparing chromosome denaturant, adding 100 mul denaturant into each glass slide, and mixing according to volume ratioThe amount was 70% deionized formamide, 20% ddH2O, preparing 10% 20 XSSC solution, adding the denatured liquid onto the chromosome slide, covering with a cover glass, performing light-shielding denaturation for 3.5min in an oven at 85 ℃, then removing the cover glass, dehydrating with 70%, 95% and 100% ethanol at-20 ℃ for 5min per stage, and air-drying.
And (3) hybridization:
(1) the probe was diluted to 5 ng/. mu.l with 2 XSSC.
(2) Mu.l of probe was added to each specimen and covered with a cover slip.
(3) Hybridization was performed in a wet box at 37 ℃ for 1.5 hours.
Elution after hybridization
(1) Wash in 4 XSSC, 0.2% Tween 20 for 10min at room temperature in the dark.
(2) Distilled water washing for a moment, air drying (avoid light)
Post-hybridization Signal Observation
(1) Mu.l of an anti-fluorescence quencher containing 1.5. mu.g/ml DAPI was added dropwise and the coverslip was covered.
(2) By adopting a Nikon 80i fluorescence microscope, blue chromosomes can be observed under the excitation of ultraviolet light, and green 45S rDNA hybridization signals can be observed under the excitation of blue excitation light.
(3) The SPOT RT KE cold CCD carries out image acquisition, and SPOT 4.1 software carries out image synthesis, and the result is shown in figure 1.
Example 2
The embodiment provides a method for fluorescence in situ hybridization of Mengdu leek chromosomes, which comprises the following steps:
s1, preparing a leek mongolicus chromosome slide specimen:
(1) material taking: washing Mengolian leek seeds with distilled water for 1-3 times, soaking in a seed soaking solution for 0.5 hour, placing in a culture dish containing 2 layers of wet filter paper, adding water, placing in a thermostat, culturing at 22-25 deg.C for 18 hours until the root tip of the seeds grows to 0.8cm and meets the requirement of the root tip of the seeds by 0.5-1cm, and cutting to obtain 1-2mm root tips; the seed soaking liquid is a mixed aqueous solution containing 80mg/L brown sugar, 150mg/L mannitol and 25mg/L acetone.
(2) Tabletting: placing the cut root tip into a small bottle, adding appropriate amount of water, sealing, rapidly placing into 0 deg.C ice water mixture, and pretreating in 0 deg.C refrigerator for 20-24 h.
(3) Fixing: the pretreated root tips were washed and fixed with freshly prepared Carnoy's fixative (glacial acetic acid: ethanol ═ 1:3) at room temperature (25 ℃) for 12-24 h.
(4) Dissociation: washing the root tip in the step (3) with distilled water for 2 times, each time for 6min, so as to wash out the fixative, then using 2.5% (w/w) of enzyme mixed by pectase and cellulase according to the weight ratio of 1:1, dissociating the root tip for 1 hour at 37 ℃, washing out the enzyme solution with distilled water, and then using the prepared Carnoy's fixative (glacial acetic acid: alcohol ═ 1:3) to fix for 1-2 hours at room temperature (25 ℃).
(5) Dyeing: the root tip was taken out and cut with a scalpel to about 0.5mm, and placed on a glass slide, a drop of staining solution was dropped, in this example, Giemsa staining solution (1:30 dilution) was used for staining, then a cover glass was placed, after staining for about 5min, filter paper was taken out and covered on the cover glass, the filter paper was fixed, and then the tissue at the root tip was spread by spreading by pressing.
(6) Microscopic examination: and (3) loading the slide into a microscope, observing the distribution condition of chromosomes in cells, and storing the dispersed slide specimen in an environment at the temperature of minus 20 ℃.
Preparation of S2 and 45S rDNA probes: a segment of conserved sequence TGTAAACCAAACTCAACAAT (shown as SEQ ID NO: 2) is selected from a corn 45S rDNA sequence (shown as SEQ ID NO: 4) and synthesized by Shanghai, and the 5' end of the segment is provided with green fluorescence labeling FAM (carboxyl fluorescein, Shanghai). The probe was diluted with distilled water to 50 ng/. mu.l and stored in a refrigerator at-20 ℃ for further use.
S3 chromosome fluorescence in situ hybridization method
Chromosome degeneration: preparing chromosome denaturating liquid, adding 100 mul denaturating liquid into each glass slide, and according to the volume percentage content, 70% deionized formamide and 20% ddH2O, preparing 10% 20 XSSC solution, adding the denatured liquid onto the chromosome slide, covering with a cover glass, performing light-shielding denaturation for 3.5min in an oven at 85 ℃, then removing the cover glass, dehydrating with 70%, 95% and 100% ethanol at-20 ℃ for 5min per stage, and air-drying.
And (3) hybridization:
(4) the probe was diluted to 5 ng/. mu.l with 2 XSSC.
(5) Mu.l of probe was added to each specimen and covered with a cover slip.
(6) Hybridization was performed in a wet box at 37 ℃ for 1.5 hours.
Elution after hybridization
(3) Wash in 4 XSSC, 0.2% Tween 20 for 10min at room temperature in the dark.
(4) Distilled water washing for a moment, air drying (avoid light)
Post-hybridization Signal Observation
(1) Mu.l of an anti-fluorescence quencher containing 1.5. mu.g/ml DAPI was added dropwise and the coverslip was covered.
(2) By adopting a Nikon 80i fluorescence microscope, blue chromosomes can be observed under the excitation of ultraviolet light, and green 45S rDNA hybridization signals can be observed under the excitation of blue excitation light.
(3) The SPOT RT KE cold CCD carries out image acquisition, and SPOT 4.1 software carries out image synthesis, and the result is shown in figure 2.
Example 3
The embodiment provides a method for fluorescence in situ hybridization of Mengdu leek chromosomes, which comprises the following steps:
s1, preparing a leek mongolicus chromosome slide specimen:
(1) material taking: washing Mengolian leek seeds with distilled water for 1-3 times, soaking in a seed soaking solution for 0.5 hour, placing in a culture dish containing 2 layers of wet filter paper, adding water, placing in a thermostat, culturing at 22-25 deg.C for 21 hours until the root tip of the seeds grows to 0.6cm and meets the requirement of the root tip of the seeds by 0.5-1cm, and cutting to obtain 1-2mm root tips; the seed soaking liquid is a mixed aqueous solution containing 90mg/L brown sugar, 120mg/L mannitol and 40mg/L acetone.
(2) Tabletting: placing the cut root tip into a small bottle, adding appropriate amount of water, sealing, rapidly placing into 0 deg.C ice water mixture, and pretreating in 0 deg.C refrigerator for 20-24 h.
(3) Fixing: the pretreated root tips were washed and fixed with freshly prepared Carnoy's fixative (glacial acetic acid: ethanol ═ 1:3) at room temperature (25 ℃) for 12-24 h.
(4) Dissociation: washing the root tip in the step (3) with distilled water for 2 times, each time for 6min, so as to wash out the fixative, then using 2.5% (w/w) of enzyme mixed by pectase and cellulase according to the weight ratio of 1:1, dissociating the root tip for 1 hour at 37 ℃, washing out the enzyme solution with distilled water, and then using the prepared Carnoy's fixative (glacial acetic acid: alcohol ═ 1:3) to fix for 1-2 hours at room temperature (25 ℃).
(5) Dyeing: the root tip was taken out and cut with a scalpel to about 0.5mm, and placed on a glass slide, a drop of staining solution was dropped, in this example, Giemsa staining solution (1:30 dilution) was used for staining, then a cover glass was placed, after staining for about 5min, filter paper was taken out and covered on the cover glass, the filter paper was fixed, and then the tissue at the root tip was spread by spreading by pressing.
(6) Microscopic examination: the distribution of chromosomes in cells was observed by mounting the slide specimen on a microscope, and the result of the observation is shown in FIG. 2, and the dispersed slide specimen was stored at-20 ℃.
Preparation of S2 and 45S rDNA probes: a segment of conserved sequence TGTAAACCAAACTCAACAAT (shown as SEQ ID NO: 2) is selected from a corn 45S rDNA sequence (shown as SEQ ID NO: 4) and synthesized by Shanghai, and the 5' end of the segment is provided with green fluorescence labeling FAM (carboxyl fluorescein, Shanghai). The probe was diluted with distilled water to 50 ng/. mu.l and stored in a refrigerator at-20 ℃ for further use.
S3 chromosome fluorescence in situ hybridization method
Chromosome degeneration: preparing chromosome denaturating liquid, adding 100 mul denaturating liquid into each glass slide, and according to the volume percentage content, 70% deionized formamide and 20% ddH2O, preparing 10% 20 XSSC solution, adding the denatured liquid onto the chromosome slide, covering with a cover glass, performing light-shielding denaturation for 3.5min in an oven at 85 ℃, then removing the cover glass, dehydrating with 70%, 95% and 100% ethanol at-20 ℃ for 5min per stage, and air-drying.
And (3) hybridization:
(7) the probe was diluted to 5 ng/. mu.l with 2 XSSC.
(8) Mu.l of probe was added to each specimen and covered with a cover slip.
(9) Hybridization was performed in a wet box at 37 ℃ for 1.5 hours.
Elution after hybridization
(5) Wash in 4 XSSC, 0.2% Tween 20 for 10min at room temperature in the dark.
(6) Distilled water washing for a moment, air drying (avoid light)
Post-hybridization Signal Observation
(1) Mu.l of an anti-fluorescence quencher containing 1.5. mu.g/ml DAPI was added dropwise and the coverslip was covered.
(2) By adopting a Nikon 80i fluorescence microscope, blue chromosomes can be observed under the excitation of ultraviolet light, and green 45S rDNA hybridization signals can be observed under the excitation of blue excitation light.
(3) SPOT RT KE cold CCD carries out image acquisition, SPOT 4.1 software carries out image synthesis.
Example 4
The embodiment provides a method for fluorescence in situ hybridization of Mengdu leek chromosomes, which comprises the following steps:
s1, preparing a leek mongolicus chromosome slide specimen:
(1) material taking: washing Mengolian leek seeds with distilled water for 1-3 times, soaking in a seed soaking solution for 0.5 hour, placing in a culture dish containing 2 layers of wet filter paper, adding water, placing in a thermostat, culturing at 22-25 deg.C for 23 hours until the root tip of the seeds grows to 0.8cm and meets the requirement of the root tip of the seeds by 0.5-1cm, and cutting to obtain 1-2mm root tips; the seed soaking liquid is a mixed aqueous solution containing 70mg/L brown sugar, 170mg/L mannitol and 10mg/L acetone.
(2) Tabletting: placing the cut root tip into a small bottle, adding appropriate amount of water, sealing, rapidly placing into 0 deg.C ice water mixture, and pretreating in 0 deg.C refrigerator for 20-24 h.
(3) Fixing: the pretreated root tips were washed and fixed with freshly prepared Carnoy's fixative (glacial acetic acid: ethanol ═ 1:3) at room temperature (25 ℃) for 12-24 h.
(4) Dissociation: washing the root tip in the step (3) with distilled water for 2 times, each time for 6min, so as to wash out the fixative, then using 2.5% (w/w) of enzyme mixed by pectase and cellulase according to the weight ratio of 1:1, dissociating the root tip for 1 hour at 37 ℃, washing out the enzyme solution with distilled water, and then using the prepared Carnoy's fixative (glacial acetic acid: alcohol ═ 1:3) to fix for 1-2 hours at room temperature (25 ℃).
(5) Dyeing: the root tip was taken out and cut with a scalpel to about 0.5mm, and placed on a glass slide, a drop of staining solution was dropped, in this example, Giemsa staining solution (1:30 dilution) was used for staining, then a cover glass was placed, after staining for about 5min, filter paper was taken out and covered on the cover glass, the filter paper was fixed, and then the tissue at the root tip was spread by spreading by pressing.
(6) Microscopic examination: and (3) loading the slide into a microscope, observing the distribution condition of chromosomes in cells, and storing the dispersed slide specimen in an environment at the temperature of minus 20 ℃.
Preparation of S2 and 45S rDNA probes: a segment of conserved sequence AGAAGACGGACGAATCCGAGC (shown as SEQ ID NO: 3) is selected from a corn 45S rDNA sequence (shown as SEQ ID NO: 4) and synthesized by Shanghai, and the 5' end of the segment is provided with green fluorescence labeling FAM (carboxyl fluorescein, Shanghai). The probe was diluted with distilled water to 50 ng/. mu.l and stored in a refrigerator at-20 ℃ for further use.
S3 chromosome fluorescence in situ hybridization method
Chromosome degeneration: preparing chromosome denaturating liquid, adding 100 mul denaturating liquid into each glass slide, and according to the volume percentage content, 70% deionized formamide and 20% ddH2O, preparing 10% 20 XSSC solution, adding the denatured liquid onto the chromosome slide, covering with a cover glass, performing light-shielding denaturation for 3.5min in an oven at 85 ℃, then removing the cover glass, dehydrating with 70%, 95% and 100% ethanol at-20 ℃ for 5min per stage, and air-drying.
And (3) hybridization:
(10) the probe was diluted to 5 ng/. mu.l with 2 XSSC.
(11) Mu.l of probe was added to each specimen and covered with a cover slip.
(12) Hybridization was performed in a wet box at 37 ℃ for 1.5 hours.
Elution after hybridization
(7) Wash in 4 XSSC, 0.2% Tween 20 for 10min at room temperature in the dark.
(8) Distilled water washing for a moment, air drying (avoid light)
Post-hybridization Signal Observation
(1) Mu.l of an anti-fluorescence quencher containing 1.5. mu.g/ml DAPI was added dropwise and the coverslip was covered.
(2) By adopting a Nikon 80i fluorescence microscope, blue chromosomes can be observed under the excitation of ultraviolet light, and green 45S rDNA hybridization signals can be observed under the excitation of blue excitation light.
(3) The SPOT RT KE cold CCD carries out image acquisition, and SPOT 4.1 software carries out image synthesis, and the result is shown in FIG. 3.
Example 5
The embodiment provides a method for fluorescence in situ hybridization of Mengdu leek chromosomes, which comprises the following steps:
s1, preparing a leek mongolicus chromosome slide specimen:
(1) material taking: washing Mengolian leek seeds with distilled water for 1-3 times, soaking in a seed soaking solution for 0.5 hour, placing in a culture dish containing 2 layers of wet filter paper, adding water, placing in a thermostat, culturing at 22-25 deg.C for 3 days until the root tip of the seeds grows to 0.6cm and meets the requirement of the root tip of the seeds by 0.5-1cm, and cutting to obtain 1-2mm root tips; the seed soaking liquid is an aqueous solution containing 80mg/L brown sugar.
(2) Tabletting: placing the cut root tip into a small bottle, adding appropriate amount of water, sealing, rapidly placing into 0 deg.C ice water mixture, and pretreating in 0 deg.C refrigerator for 20-24 h.
(3) Fixing: the pretreated root tips were washed and fixed with freshly prepared Carnoy's fixative (glacial acetic acid: ethanol ═ 1:3) at room temperature (25 ℃) for 12-24 h.
(4) Dissociation: washing the root tip in the step (3) with distilled water for 2 times, each time for 6min, so as to wash out the fixative, then using 2.5% (w/w) of enzyme mixed by pectase and cellulase according to the weight ratio of 1:1, dissociating the root tip for 1 hour at 37 ℃, washing out the enzyme solution with distilled water, and then using the prepared Carnoy's fixative (glacial acetic acid: alcohol ═ 1:3) to fix for 1-2 hours at room temperature (25 ℃).
(5) Dyeing: the root tip was taken out and cut with a scalpel to about 0.5mm, and placed on a glass slide, a drop of staining solution was dropped, in this example, Giemsa staining solution (1:30 dilution) was used for staining, then a cover glass was placed, after staining for about 5min, filter paper was taken out and covered on the cover glass, the filter paper was fixed, and then the tissue at the root tip was spread by spreading by pressing.
(6) Microscopic examination: and (3) loading the slide into a microscope, observing the distribution condition of chromosomes in cells, and storing the dispersed slide specimen in an environment at the temperature of minus 20 ℃.
Preparation of S2 and 45S rDNA probes: a segment of conserved sequence TGTAAACCAAACTCAACAAT (shown as SEQ ID NO: 2) is selected from a corn 45S rDNA sequence (shown as SEQ ID NO: 4) and synthesized by Shanghai, and the 5' end of the segment is provided with green fluorescence labeling FAM (carboxyl fluorescein, Shanghai). The probe was diluted with distilled water to 50 ng/. mu.l and stored in a refrigerator at-20 ℃ for further use.
S3 chromosome fluorescence in situ hybridization method
Chromosome degeneration: preparing chromosome denaturating liquid, adding 100 mul denaturating liquid into each glass slide, and according to the volume percentage content, 70% deionized formamide and 20% ddH2O, preparing 10% 20 XSSC solution, adding the denatured liquid onto the chromosome slide, covering with a cover glass, performing light-shielding denaturation for 3.5min in an oven at 85 ℃, then removing the cover glass, dehydrating with 70%, 95% and 100% ethanol at-20 ℃ for 5min per stage, and air-drying.
And (3) hybridization:
(13) the probe was diluted to 5 ng/. mu.l with 2 XSSC.
(14) Mu.l of probe was added to each specimen and covered with a cover slip.
(15) Hybridization was performed in a wet box at 37 ℃ for 1.5 hours.
Elution after hybridization
(9) Wash in 4 XSSC, 0.2% Tween 20 for 10min at room temperature in the dark.
(10) Distilled water washing for a moment, air drying (avoid light)
Post-hybridization Signal Observation
(1) Mu.l of an anti-fluorescence quencher containing 1.5. mu.g/ml DAPI was added dropwise and the coverslip was covered.
(2) By adopting a Nikon 80i fluorescence microscope, blue chromosomes can be observed under the excitation of ultraviolet light, and green 45S rDNA hybridization signals can be observed under the excitation of blue excitation light.
(3) SPOT RT KE cold CCD carries out image acquisition, SPOT 4.1 software carries out image synthesis.
Example 6
The embodiment provides a method for fluorescence in situ hybridization of Mengdu leek chromosomes, which comprises the following steps:
s1, preparing a leek mongolicus chromosome slide specimen:
(1) material taking: washing Mengolian leek seeds with distilled water for 1-3 times, soaking in a seed soaking solution for 0.5 hour, placing in a culture dish containing 2 layers of wet filter paper, adding water, placing in a thermostat, culturing at 22-25 deg.C for 4 days until the root tip of the seeds grows to 0.5cm and meets the requirement of the root tip of the seeds by 0.5-1cm, and cutting to obtain 1-2mm root tips; the seed soaking liquid is an aqueous solution containing 150mg/L mannitol.
(2) Tabletting: placing the cut root tip into a small bottle, adding appropriate amount of water, sealing, rapidly placing into 0 deg.C ice water mixture, and pretreating in 0 deg.C refrigerator for 20-24 h.
(3) Fixing: the pretreated root tips were washed and fixed with freshly prepared Carnoy's fixative (glacial acetic acid: ethanol ═ 1:3) at room temperature (25 ℃) for 12-24 h.
(4) Dissociation: washing the root tip in the step (3) with distilled water for 2 times, each time for 6min, so as to wash out the fixative, then using 2.5% (w/w) of enzyme mixed by pectase and cellulase according to the weight ratio of 1:1, dissociating the root tip for 1 hour at 37 ℃, washing out the enzyme solution with distilled water, and then using the prepared Carnoy's fixative (glacial acetic acid: alcohol ═ 1:3) to fix for 1-2 hours at room temperature (25 ℃).
(5) Dyeing: the root tip was taken out and cut with a scalpel to about 0.5mm, and placed on a glass slide, a drop of staining solution was dropped, in this example, Giemsa staining solution (1:30 dilution) was used for staining, then a cover glass was placed, after staining for about 5min, filter paper was taken out and covered on the cover glass, the filter paper was fixed, and then the tissue at the root tip was spread by spreading by pressing.
(6) Microscopic examination: and (3) loading the slide into a microscope, observing the distribution condition of chromosomes in cells, and storing the dispersed slide specimen in an environment at the temperature of minus 20 ℃.
Preparation of S2 and 45S rDNA probes: a segment of conserved sequence TGTAAACCAAACTCAACAAT (shown as SEQ ID NO: 2) is selected from a corn 45S rDNA sequence (shown as SEQ ID NO: 4) and synthesized by Shanghai, and the 5' end of the segment is provided with green fluorescence labeling FAM (carboxyl fluorescein, Shanghai). The probe was diluted with distilled water to 50 ng/. mu.l and stored in a refrigerator at-20 ℃ for further use.
S3 chromosome fluorescence in situ hybridization method
Chromosome degeneration: preparing chromosome denaturating liquid, adding 100 mul denaturating liquid into each glass slide, and according to the volume percentage content, 70% deionized formamide and 20% ddH2O, preparing 10% 20 XSSC solution, adding the denatured liquid onto the chromosome slide, covering with a cover glass, performing light-shielding denaturation for 3.5min in an oven at 85 ℃, then removing the cover glass, dehydrating with 70%, 95% and 100% ethanol at-20 ℃ for 5min per stage, and air-drying.
And (3) hybridization:
(16) the probe was diluted to 5 ng/. mu.l with 2 XSSC.
(17) Mu.l of probe was added to each specimen and covered with a cover slip.
(18) Hybridization was performed in a wet box at 37 ℃ for 1.5 hours.
Elution after hybridization
(11) Wash in 4 XSSC, 0.2% Tween 20 for 10min at room temperature in the dark.
(12) Distilled water washing for a moment, air drying (avoid light)
Post-hybridization Signal Observation
(1) Mu.l of an anti-fluorescence quencher containing 1.5. mu.g/ml DAPI was added dropwise and the coverslip was covered.
(2) By adopting a Nikon 80i fluorescence microscope, blue chromosomes can be observed under the excitation of ultraviolet light, and green 45S rDNA hybridization signals can be observed under the excitation of blue excitation light.
(3) SPOT RT KE cold CCD carries out image acquisition, SPOT 4.1 software carries out image synthesis.
Example 7
The embodiment provides a method for fluorescence in situ hybridization of Mengdu leek chromosomes, which comprises the following steps:
s1, preparing a leek mongolicus chromosome slide specimen:
(1) material taking: washing Mengolian leek seeds with distilled water for 1-3 times, soaking in a seed soaking solution for 0.5 hour, placing in a culture dish containing 2 layers of wet filter paper, adding water, placing in a thermostat, culturing at 22-25 deg.C for 3 days until the root tip of the seeds grows to 0.6cm and meets the requirement of the root tip of the seeds by 0.5-1cm, and cutting to obtain 1-2mm root tips; the seed soaking liquid is an aqueous solution containing 25mg/L of acetone.
(2) Tabletting: placing the cut root tip into a small bottle, adding appropriate amount of water, sealing, rapidly placing into 0 deg.C ice water mixture, and pretreating in 0 deg.C refrigerator for 20-24 h.
(3) Fixing: the pretreated root tips were washed and fixed with freshly prepared Carnoy's fixative (glacial acetic acid: ethanol ═ 1:3) at room temperature (25 ℃) for 12-24 h.
(4) Dissociation: washing the root tip in the step (3) with distilled water for 2 times, each time for 6min, so as to wash out the fixative, then using 2.5% (w/w) of enzyme mixed by pectase and cellulase according to the weight ratio of 1:1, dissociating the root tip for 1 hour at 37 ℃, washing out the enzyme solution with distilled water, and then using the prepared Carnoy's fixative (glacial acetic acid: alcohol ═ 1:3) to fix for 1-2 hours at room temperature (25 ℃).
(5) Dyeing: the root tip was taken out and cut with a scalpel to about 0.5mm, and placed on a glass slide, a drop of staining solution was dropped, in this example, Giemsa staining solution (1:30 dilution) was used for staining, then a cover glass was placed, after staining for about 5min, filter paper was taken out and covered on the cover glass, the filter paper was fixed, and then the tissue at the root tip was spread by spreading by pressing.
(6) Microscopic examination: and (3) loading the slide into a microscope, observing the distribution condition of chromosomes in cells, and storing the dispersed slide specimen in an environment at the temperature of minus 20 ℃.
Preparation of S2 and 45S rDNA probes: a segment of conserved sequence TGTAAACCAAACTCAACAAT (shown as SEQ ID NO: 2) is selected from a corn 45S rDNA sequence (shown as SEQ ID NO: 4) and synthesized by Shanghai, and the 5' end of the segment is provided with green fluorescence labeling FAM (carboxyl fluorescein, Shanghai). The probe was diluted with distilled water to 50 ng/. mu.l and stored in a refrigerator at-20 ℃ for further use.
S3 chromosome fluorescence in situ hybridization method
Chromosome degeneration: preparing chromosome denaturating liquid, adding 100 mul denaturating liquid into each glass slide, and according to the volume percentage content, 70% deionized formamide and 20% ddH2O, 10% 20 XSSC solution, adding the denatured solution onto the chromosome slide, covering with a cover slip, and denaturing in an oven at 85 deg.C in the dark for 3.5min, then the cover glass is thrown off, dehydrated by 70 percent, 95 percent and 100 percent ethanol at the temperature of minus 20 ℃ in sequence, each stage is carried out for 5min, and air is dried.
And (3) hybridization:
(19) the probe was diluted to 5 ng/. mu.l with 2 XSSC.
(20) Mu.l of probe was added to each specimen and covered with a cover slip.
(21) Hybridization was performed in a wet box at 37 ℃ for 1.5 hours.
Elution after hybridization
(13) Wash in 4 XSSC, 0.2% Tween 20 for 10min at room temperature in the dark.
(14) Distilled water washing for a moment, air drying (avoid light)
Post-hybridization Signal Observation
(1) Mu.l of an anti-fluorescence quencher containing 1.5. mu.g/ml DAPI was added dropwise and the coverslip was covered.
(2) By adopting a Nikon 80i fluorescence microscope, blue chromosomes can be observed under the excitation of ultraviolet light, and green 45S rDNA hybridization signals can be observed under the excitation of blue excitation light.
(3) SPOT RT KE cold CCD carries out image acquisition, SPOT 4.1 software carries out image synthesis.
It should be understood that the above examples are only for clarity of illustration and are not intended to limit the embodiments. Other variations and modifications will be apparent to persons skilled in the art in light of the above description. And are neither required nor exhaustive of all embodiments. And obvious variations or modifications therefrom are within the scope of the invention.
Sequence listing
<110> Nanjing Xiaozhuang college
<120> method for fluorescence in situ hybridization of Mengdu leek chromosomes
<130>NJHA201800032
<160>4
<170>SIPOSequenceListing 1.0
<210>1
<211>21
<212>DNA
<213> Artificial Synthesis (artificial Synthesis)
<400>1
cactagctat ccgatcatca c 21
<210>2
<211>20
<212>DNA
<213> Artificial Synthesis (artificial Synthesis)
<400>2
tgtaaaccaa actcaacaat 20
<210>3
<211>21
<212>DNA
<213> Artificial Synthesis (artificial Synthesis)
<400>3
agaagacgga cgaatccgag c 21
<210>4
<211>3559
<212>DNA
<213> corn 45s rDNA (Zea mays Linn.45s rDNA)
<400>4
ccctccccta aatcactcca aaaaaaacaa tccccaattc tacacaagtg tttctacact 60
aacaaagcaa cagctcctta acgaattccc aactttacac gagctcgtct ctcgaggtta 120
aatgttatta cttggtaaga ttccggacct cgccaagtgt tttgaaaacc cgcaacgctc 180
gcaaaggtgg atagtgagaa taataagtga agagacagac ttgtccaaaa cgcccacacg 240
aaggtgcata gtgagaagag taagtcaaga gatagacttg tccaaaaaga aacggaagag 300
aaagcgtggg agacgctcac gaaggtgcat agttggaatc gtcgatcaag agacagactt 360
gttcgaaaga aacagaagag aatgcttggg gttacactca cgaaggtgca tagtgagaag 420
agtaagtcaa gagacagact tgttcgaaaa gaaacaaaag agaatgcttg gggagataga 480
agtgtgagat agttctcaag ctaagaaagt tgtaaaagct aagaactagc atcaaatgat 540
ggatgaaaca caaggtagtt gttgaaagtc aaacacttgg tgatatgaac acaaacgttc 600
aatatgacaa acccatgcca agtaaagaga aaatgaaaac tggtgattgt tgcggaaatc 660
gtccaggatt cctcgaccag gacttgaaat cgtcgagggg aaaaaatcgg ttccgaggaa 720
tcgtcgatcc ggacttggaa tcgtcgagaa aagtttaccg ggtccgagga tttgtcgacc 780
aggagtggaa atcgtcgaga aaaatctatc gggtccgagg aatcgtcgac caggacgagg 840
aatcgtcgat gaaaatctat cgggttcgag gaatggtcga ccaggggttg aaatcgtcga 900
ccaggtccga gacttcatcg accgtgtccg aggagtggtc gagggtttgt cgaccaggac 960
gaggaatcgt cgaccgggtc cgaggatttg tcgaccaggg gttgaaatcg tcgaccaggt1020
ccgagacttc atcgaccagg acggcggaac cctcgaccag gacgatgaat gggcgatgaa1080
aatctatcgg gttcgaggaa tggtcgacca gaagttgaaa tggtcgaccg ggtccgagaa1140
ttcgtcgacc aggccgagga gtggtcgagg atttgtcgac caggagttga aatcgtcgac1200
cgggaccgag aattcgtcga ccaggacggc ggaaccctcg accaggacga tgaatgggcg1260
atgaaaatct atcgggttcg aggaatggtc gaccaggggt tgaaatcgtc gaccaggtcc1320
gagacttcat cgaccgggtc cgaggattcg tcgaccagga cggccggatg tccgagaaaa1380
aaaaatgttg ccgaataact ttcgaaaatc attggatatg atgcaatgtt ttgtgatcga1440
atctcttaaa atacatcaat aaagagttta ggatgtcaag tttgcatcaa atatgcccac1500
ggagccccaa ctagaccatg aaaatccgat gttgtatcag gtcaaatgac ctagctagag1560
gtgtcaaaaa attatgaaaa tttaccagaa aataggattt agtatcctta tgatgcatgc1620
caaaaagaat tttcaaattc caagtatttc tttttttttg gcaccggtgt ctcctcagac1680
atttcaatgt ctgttggtgc caagagggaa aagggctatt aagctatata ggggggtggg1740
tgttgaggga gtctgggcag tccgtgggga accccctttt tcggttcgga cttgggtagc1800
gatcgaggga tggtatcgga tatcggcacg aggaatgacc gaccgtccgg ccgccgggat1860
tttcgccgga aaacttttcc ggcgactttt ccggcgatcg gttttgtgcc tttttccgag1920
ttttctcagc agttctcgga caaaaactgc tgaatcgtcg aggagaatgg gcttgccttg1980
cgtgggctgc cattagttct tcgaggcgtt agggtggcgg cggtataaaa gtgtcggagt2040
tttttcagca gttctcggac aaaaattgct gagtggccga gaagaatggg cgtgtcatgc2100
gtgggctgac atggattctt cgaggcctag ggtggcggta tataacttgt tcgcatgata2160
ttaccgagat gtccccacgg gcatcttttc acctcgtcgc cgaagagaat gggcgtgtca2220
tggcatgggc tgacatggat tctcctaggc cgtttgggtg gcggtatagt cgtcttgcgc2280
acgaaatacc gagatgtccc catgggcatc gattccaccc gcctaggttg gatgggcgtg2340
cttcgtcgga aagcatggat ccgcctaggc tgtcccgagt gtgagcgagg tgtgagtgtc2400
gcccatgggc atcgacacct tgcggctagg aactggaacg agacgggtgg caaagatttc2460
gagtagcact tcatactacc gtgggttttt taaaccttcc gagttttgtt gatgttattc2520
cgagaattag caaaccgtaa cgaagatgtt cttggcaacc atcttttgat gggagtccgg2580
ctgttcgata gccggccaag ggtgatgaac gaaatgtgaa cccttgtctc gcctaggttg2640
gatgggcgtg cttcgttgga aagcatggat ccgcctaggc tgtccgagtg tgagcgaggt2700
gtgagtgtcg cccatgggca tcgacacctt gcggctagga actggaacga gacgggtagc2760
aaagatttcg agtagcactt catactaccg tgggttttta aaccttccga gttttgttga2820
tgttattccg agaattagca aaccgtaacg aagatgttct tggcaaccat cttttgatgg2880
gagtccggct gttcgaaagc cggccaaggg tgatgaacga aatgtgaacc cttgtctcgc2940
ctaggttgga tgggcgtgct tcgttggaaa gcatggatcc gcctaggctg tcccgaaggt3000
atctcgcgct tgtacggctt tggctcggat tcgtccgtct tctttcttct tagccgagta3060
cttcggtaga ttagttggaa cgattgatga tttgagttaa ttgaacgttc ggcgtatgag3120
tgatgatcgg atagctagtg ttcgtaggct ccatgctcgc gcatcgaact acctaccacc3180
tatccttctc agttaattca cgggcgatgt tacgctcgat gatgagttcc ggggcctgtg3240
tttcgtacct aatttgaaga attgttgagt ttggtttaca cctttgcccg cggcttctcc3300
ttcgtgggga agtcgtgggc acaaacatcg gcgcttgttc acctctcgtc atcgcatttg3360
ttgccttgct cgcattggtg aatgagttgc gggttgaaat ctcggatgcg gaaaagttgt3420
cgacggtgac tcgaagtgat tcagtcccgc caaagctcat ccgtccttcg ggcaaaagat3480
gacggtcaag acctcgtcct ttctctcttt ccattgcgtt tgagaggatg tggcggggaa3540
ttgccgtgat cgatgaatg 3559
Claims (5)
1. A method for fluorescence in situ hybridization of Mengolia leek chromosomes is characterized by comprising the following steps:
s1, preparing a mongolian leek chromosome slide specimen, comprising the following steps:
(1) material taking: washing Mengolian leek seeds with distilled water for 1-3 times, soaking in the soaking solution, placing in a culture dish containing 2 layers of wet filter paper, adding water, placing in a thermostat, culturing at 22-25 deg.C until the root tip of the seeds grows to 0.5-1cm, and cutting to obtain 1-2mm root tips; the seed soaking liquid comprises the following components in concentration: 70-90mg/L of brown sugar; mannitol, 120-170 mg/L; acetone, 10-40 mg/L; the balance of water;
(2) tabletting: placing the cut root tip into a small bottle, adding appropriate amount of water, sealing, rapidly placing into ice water mixture at 0 deg.C, and pretreating in a refrigerator at 0 deg.C for 20-24 hr;
(3) fixing: washing the pretreated root tips, and fixing for 12-24h at room temperature by using a ready-prepared Carnot fixing solution;
(4) dissociation: washing the root tips in the step (3) with distilled water for 2 times, each time for 6min, so as to wash away the fixative, then using 2.5% (w/w) of enzyme mixed by pectinase and cellulase according to the weight ratio of 1:1, dissociating the root tips for 1 hour at 37 ℃, washing away the enzyme solution with distilled water, and then using the prepared Carnot's fixative to fix for 1-2 hours at room temperature;
(5) dyeing: taking out the root tip, cutting about 0.5mm with a scalpel, placing on a glass slide, dripping a drop of staining solution, staining, placing on a cover glass, staining for 5min, taking filter paper, covering on the cover glass, fixing the filter paper, and tabletting to disperse and spread the tissue at the root tip;
(6) microscopic examination: loading the slide into a microscope, observing the distribution condition of chromosomes in cells, and storing dispersed slide specimens in an environment at the temperature of minus 20 ℃;
s2 and 45S rDNA probes are prepared, a conservative sequence is selected from a corn 45S rDNA sequence to synthesize a probe, and a fluorescent group is connected to the 5 'end or the 3' end of the probe sequence, wherein the probe sequence is SEQ ID NO: 1-3;
s3, chromosome fluorescence in situ hybridization;
and S4, eluting and detecting.
2. The method for fluorescence in situ hybridization of the chromosomes of leek Mongolian according to claim 1, wherein the probe sequence is as shown in SEQ ID NO: 1-2.
3. The method for fluorescence in situ hybridization of Mongolian leek chromosomes according to claim 1 or 2, wherein the seed soaking solution is composed of the following components in concentration: brown sugar, 80 mg/L; mannitol, 150 mg/L; acetone, 25 mg/L; the balance being water.
4. A method for dyeing and flaking root tips of Mongolian leeks is characterized by comprising the following steps:
(1) material taking: washing Mengolian leek seeds with distilled water for 1-3 times, soaking in the soaking solution, placing in a culture dish containing 2 layers of wet filter paper, adding water, placing in a thermostat, culturing at 22-25 deg.C until the root tip of the seeds grows to 0.5-1cm, and cutting to obtain 1-2mm root tips; the seed soaking liquid comprises the following components in concentration: 70-90mg/L of brown sugar; mannitol, 120-170 mg/L; acetone, 10-40 mg/L; the balance of water;
(2) tabletting: placing the cut root tip into a small bottle, adding appropriate amount of water, sealing, rapidly placing into ice water mixture at 0 deg.C, and pretreating in a refrigerator at 0 deg.C for 20-24 hr;
(3) fixing: washing the pretreated root tips, and adding the prepared glacial acetic acid: fixing Carnoy's stationary liquid with alcohol =1:3 at 25 deg.C for 12-24 h;
(4) dissociation: washing the root tips in the step (3) with distilled water for 2 times, each time for 6min, so as to wash away the fixative, then using 2.5% (w/w) of enzyme mixed by pectinase and cellulase according to the weight ratio of 1:1, dissociating the root tips for 1 hour at 37 ℃, washing away the enzyme solution with distilled water, and then using the prepared Carnot's fixative to fix for 1-2 hours at room temperature;
(5) dyeing: taking out the root tip, cutting about 0.5mm with a scalpel, placing on a glass slide, dropping a drop of staining solution for staining, then placing on a cover glass, staining for about 5min, taking filter paper, covering on the cover glass, fixing the filter paper, and then tabletting to disperse and spread the tissue at the root tip;
(6) microscopic examination: and (4) loading the slide into a microscope, observing the distribution condition of chromosomes in cells, and storing the dispersed slide specimen in an environment at the temperature of-20 ℃.
5. The method for dyeing and flaking root tips of leek montmoru according to claim 4, wherein the seed soaking solution is composed of the following components in concentration: brown sugar, 80 mg/L; mannitol, 150 mg/L; acetone, 25 mg/L; the balance being water.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811038847.3A CN109161581B (en) | 2018-09-06 | 2018-09-06 | Mongolian leek chromosome fluorescence in situ hybridization method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811038847.3A CN109161581B (en) | 2018-09-06 | 2018-09-06 | Mongolian leek chromosome fluorescence in situ hybridization method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109161581A CN109161581A (en) | 2019-01-08 |
| CN109161581B true CN109161581B (en) | 2020-06-09 |
Family
ID=64894394
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811038847.3A Active CN109161581B (en) | 2018-09-06 | 2018-09-06 | Mongolian leek chromosome fluorescence in situ hybridization method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109161581B (en) |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102787166B (en) * | 2012-07-16 | 2014-03-12 | 北京林业大学 | Fluorescence in situ hybridization method of prunus mume chromosome |
| CN103305614B (en) * | 2013-06-06 | 2016-01-20 | 北京林业大学 | The chromosomal in-situ hybridization method of a kind of plant of Lagerstroemia |
| CN103409524B (en) * | 2013-08-12 | 2015-02-11 | 南开大学 | Fluorescence in situ hybridization method for positioning 45S rDNA on plant chromosome |
| CN106399499A (en) * | 2016-09-18 | 2017-02-15 | 新乡医学院 | Fluorescence in-situ hybridization method for asparagus fern medium-term chromosomes |
| KR101863820B1 (en) * | 2017-07-28 | 2018-06-01 | 삼육대학교산학협력단 | Novel 45S rDNA Nucleic Acid Probes for Advansed FISH and Novel FISH method Using the Same |
-
2018
- 2018-09-06 CN CN201811038847.3A patent/CN109161581B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN109161581A (en) | 2019-01-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109652455A (en) | The Chinese cabbage high-efficiency genetic transforming method and its application that a kind of magnetic nano-carrier mediates | |
| CN115466749A (en) | Application method of gingko bZIP transcription factor GbbZIP08 in promotion of plant flavonoid synthesis | |
| CN107937492B (en) | Quantitative detection method and application of key enzyme gene for metabolizing garlic fructan | |
| AU2021101596A4 (en) | SSR molecular marker primer set for identifying Rhynchostylis and use thereof | |
| CN109161581B (en) | Mongolian leek chromosome fluorescence in situ hybridization method | |
| CN109609514A (en) | Pears transcription factor PbrMYB169 and its application | |
| CN106755507B (en) | Molecular detection method for distinguishing chromosomes of cultivated rye and wild rye | |
| CN103421807A (en) | Application of OsMYB91 transcription factor in rice growth and stress-tolerance | |
| CN110669771B (en) | Cucumber CsLsi2 gene and its coded protein and application | |
| CN102220330A (en) | MiRNA-gma-miR56b related to drought resistance of plants and application thereof | |
| Zhao et al. | Molecular identification and functional verification of SPL9 and SPL15 of Lilium | |
| CN109207628A (en) | A kind of molecular labeling and application suitable for detecting purple radish | |
| CN111926005B (en) | Probe and method for high-resolution fluorescence in situ hybridization of chrysanthemum plant chromosome | |
| CN107868840A (en) | One grow flax in the SSR molecular marker associated with full growth number of days and application | |
| CN106929518A (en) | A kind of rubber tree HbAG genes and its application | |
| CN108893555B (en) | A method of based on InDel molecular markers for identification hot pepper male sterile three series mating cenospecies authenticity and purity | |
| CN107505303B (en) | A kind of seedling stage Rapid identification hops plant male and female method for distinguishing | |
| CN112522306B (en) | Method for remarkably improving instantaneous conversion efficiency of peach leaves through weak light treatment | |
| CN110283933A (en) | The fluorescent quantitation reference gene and its primer of siberian wildrye different tissues and application | |
| CN106636424B (en) | In-situ hybridization probe and method for identifying barley genome by using same | |
| CN110747287A (en) | Haynaldia villosa chromosome specific oligonucleotide probe and application thereof | |
| CN105861640B (en) | A kind of method of Rapid identification edible sunflower cenospecies SH338 authenticity and purity | |
| CN113957166B (en) | Ribosome DNA oligonucleotide mixed probe sleeve based on chrysanthemum related species plant reference genome and development method | |
| Nizam et al. | Determination of nuclear DNA content and ploidy of some Bromus l. germplasm by flow cytometery | |
| CN116144682B (en) | Application of raffinose synthase gene SpRAFS1 of feather needle grass in promoting plant root development |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information | ||
| CB03 | Change of inventor or designer information |
Inventor after: Tang Ning Inventor after: Zhang Bianjiang Inventor after: Chen Quanzhan Inventor after: Wang Like Inventor after: Yang Ping Inventor after: Qian Baoli Inventor before: Zhang Bianjiang Inventor before: Chen Quanzhan Inventor before: Tang Ning Inventor before: Wang Like Inventor before: Yang Ping Inventor before: Qian Baoli |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20220905 Address after: 201400 Building 8, 8188 Daye Road, Fengxian District, Shanghai Patentee after: Shanghai Qiuhuang Pharmaceutical Technology Co.,Ltd. Address before: No. 3601 Jiangning Road, Nanjing District hirokage 211171 cities in Jiangsu Province Patentee before: NANJING XIAOZHUANG University |