CN109161484A - A kind of application of toVerticilliumdahliaActivitie Activitie S of Relative in prevention and control exotic invasive weed Italy Siberian cocklebur - Google Patents
A kind of application of toVerticilliumdahliaActivitie Activitie S of Relative in prevention and control exotic invasive weed Italy Siberian cocklebur Download PDFInfo
- Publication number
- CN109161484A CN109161484A CN201811111039.5A CN201811111039A CN109161484A CN 109161484 A CN109161484 A CN 109161484A CN 201811111039 A CN201811111039 A CN 201811111039A CN 109161484 A CN109161484 A CN 109161484A
- Authority
- CN
- China
- Prior art keywords
- siberian cocklebur
- relative
- plant
- toverticilliumdahliaactivitie activitie
- italy
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/30—Microbial fungi; Substances produced thereby or obtained therefrom
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Virology (AREA)
- Mycology (AREA)
- Dentistry (AREA)
- Botany (AREA)
- Environmental Sciences (AREA)
- Medicinal Chemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Plant Pathology (AREA)
- Biomedical Technology (AREA)
- Pest Control & Pesticides (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Agronomy & Crop Science (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to a kind of application of toVerticilliumdahliaActivitie Activitie S of Relative in prevention and control exotic invasive weed Italy Siberian cocklebur, the pathogenic strain classification naming be toVerticilliumdahliaActivitie Activitie S of Relative (Alternaria tenuissima), completely it is named as toVerticilliumdahliaActivitie Activitie S of Relative, the pathogenic bacteria are to isolate and purify and obtain from Siberian cocklebur natural occurrence plant leaf Italian in the field population in Xinjiang Urumqi suburbs, conventional method preparation pathogen hyphal suspension and Raw toxin are respectively adopted from the fungi toVerticilliumdahliaActivitie Activitie S of Relative isolated and purified, the pathogen hyphal suspension and Raw toxin of preparation are uniformly sprayed on Italian Siberian cocklebur plant respectively again, there is very strong pathogenic effects and control effect to malignant weed Italy Siberian cocklebur.Culture of the present invention is easy to operate, culture substrate material easily obtains, obtained hyphal suspension and toxin stability are strong, obtains simple process, can be mass-produced；It is sprayed with it as cauline leaf, it is easy to use, it can effectively kill target weeds Italy Siberian cocklebur, environmental safety with higher.
Description
Technical field
The invention belongs to plant protection art, specially a kind of toVerticilliumdahliaActivitie Activitie S of Relative is grey in prevention and control exotic invasive weed Italy
Application in ear.
Background technique
Invasive plants are a global problems.Biological invasion is by replacing original species or new species being inhibited to exist
It invades the existence on ground and reduces bio-diversity, to destroy ecosystem stability, influence local economic development.China be by
One of Damage of Biological Invasion country the most serious, especially increasingly recently as economical rapid development and international trade
Prosperity, some alien species quietly enter China by approach such as business, tourisms.According to statistics, at present China have it is external enter
More than plant 600 is invaded, wherein there are more than 50 most threatening exotics in 100 kinds of the whole world for ranking International Union for Conservation of Nature and Natural Resources's announcement
In kind；Up to 103 kinds of type of serious harm are had resulted at present, wherein only Eupatorium adenophorum, artemisiifolia, water hyacinth and Value of Spartina Anglica etc.
Several Alien Invasive Plants give economic loss caused by China just more than 14,000,000,000 dollars every year, and overall loss may be up to hundred billion.
In recent years, invasion situation of the adventitious plant Italy Siberian cocklebur (Xanthium italicum) in China is gradually aggravated.
Italian Siberian cocklebur is composite family Xanthium annual herb plant, and source area is North America and southern Europe, is now mainly distributed on east, west half
The mid latitudes of ball are important one of the Alien Invasive Plants in China.In September, 1991 is in the Changping District, Beijing town Bei Qijia horse
The irrigation canals and ditches side of mill bridge is found for the first time, has spread to the ground such as Eight Great Temples of the Western Hills, Miyun at present, in Shenzhen, Guangxi, Hebei, Xinjiang, the Liao Dynasty
Rather, the ground such as Shandong are found, and are put into " People's Republic of China (PRC) saves imported plants quarantine harmful organism register " 2007 years.
Italian Siberian cocklebur adaptability is strong, can grow in wasteland, field, river shoal, limes marginis roadside.Moistening, water is irrigated the fields, irrigation canals and ditches side is planted
Strain grows more luxuriant tall and big.Italian Siberian cocklebur plant coverage is big, and competitiveness is strong, with local species contention moisture, nutrition,
Illumination and growing space, it is easy to advantage group is formed in new ecological environment, and due to Italian Siberian cocklebur adaptability pole
By force, a wide range of simple community is easily formed in field.
The main means of the Italy of prevention and control at present Siberian cocklebur have artificial control and chemical weed control.Artificial control can only be when shorter
Between, smaller range work, and it is time-consuming and laborious；Chemical herbicide is also easy to produce antibody, and due in nature because targeting is single
Lack the microorganism decomposed in boundary, can cause environmental pollution；And biological pesticide is derived from because of it naturally, can be by microorganism
Degradation, it is more friendly to environment, adapt to the demand of sustainable development.Therefore, carrying out biological control is that current prevention and treatment Italy is grey
Ear is most potential and the method for development prospect.
Summary of the invention
Present invention aims at provide a kind of fungi toVerticilliumdahliaActivitie Activitie S of Relative in prevention and control exotic invasive weed Italy Siberian cocklebur
Using the fungi toVerticilliumdahliaActivitie Activitie S of Relative (Alternaria tenuissima) is from the field population in Xinjiang Urumqi suburbs
Acquisition is isolated and purified on Italian Siberian cocklebur natural occurrence plant leaf, is divided from the fungi toVerticilliumdahliaActivitie Activitie S of Relative isolated and purified
Not Cai Yong conventional method prepare hyphal suspension and Raw toxin, then the hyphal suspension of preparation and Raw toxin are uniformly sprayed respectively
On weeds Italy Siberian cocklebur plant, there is very strong pathogenic effects and control effect, this hair to malignant weed Italy Siberian cocklebur
Bright culture is easy to operate, culture substrate material easily obtains, obtained hyphal suspension and toxin stability are strong, obtains technique letter
It is single, it can be mass-produced；It is sprayed with it as cauline leaf, it is easy to use, target weeds Italy Siberian cocklebur can be effectively killed, is had higher
Environmental safety.
A kind of application of the toVerticilliumdahliaActivitie Activitie S of Relative of the present invention in prevention and control exotic invasive weed Italy Siberian cocklebur, the fungi
ToVerticilliumdahliaActivitie Activitie S of Relative (Alternaria tenuissima) be from the field population in Xinjiang Urumqi suburbs Italian Siberian cocklebur from
Acquisition is isolated and purified on right disease plant blade, conventional side is respectively adopted from the fungi toVerticilliumdahliaActivitie Activitie S of Relative isolated and purified
Method prepares hyphal suspension and Raw toxin, then the hyphal suspension of preparation and Raw toxin are uniformly sprayed at weeds Italy respectively
On Siberian cocklebur plant, in which:
The hyphal suspension of preparation is sprayed on weeds Italy Siberian cocklebur blade face, plant leaf occurs after 48h after inoculation
Obvious scab point；For plant illness rate up to 100%, entire plant leaf has begun dehydration yellow after 3d；Entire plant withers after 10d
Listless death；
The fungi Raw toxin of preparation is formulated as 5 ㎎/ml solution, is uniformly sprayed at field weeds Italy Siberian cocklebur plant
On, after spraying treatment 3d, Italian Siberian cocklebur plant is dead.
A kind of application of the fungi toVerticilliumdahliaActivitie Activitie S of Relative in prevention and control exotic invasive weed Italy Siberian cocklebur, the open country of Raw toxin
Outer implementation amount is 30ml/m2。
A kind of application of the fungi toVerticilliumdahliaActivitie Activitie S of Relative of the present invention in prevention and control exotic invasive weed Italy Siberian cocklebur, should
Fungi toVerticilliumdahliaActivitie Activitie S of Relative (Alternaria tenuissima) is Italian from the Natural Populations of Xinjiang Urumqi suburbs field
Acquisition is isolated and purified on Siberian cocklebur natural occurrence plant leaf, acquisition time is in July, 2016.
A kind of application of the fungi toVerticilliumdahliaActivitie Activitie S of Relative of the present invention in prevention and control exotic invasive weed Italy Siberian cocklebur, root
ToVerticilliumdahliaActivitie Activitie S of Relative is accredited as according to morphological feature and molecular biology method.
A kind of application of the fungi toVerticilliumdahliaActivitie Activitie S of Relative of the present invention in prevention and control exotic invasive weed Italy Siberian cocklebur,
The separation of middle fungi toVerticilliumdahliaActivitie Activitie S of Relative is identified are as follows:
The Italian strong pathogenic strain of Siberian cocklebur isolates and purifies: acquiring Italian Siberian cocklebur natural occurrence in Urumchi suburbs and plants
Strain, isolates and purifies to obtain a variety of fungies, and verified with Koch's Postulates by potato sucrose culture medium (PDA), by causing a disease
Property test comparison screening, obtain the herbicide disease fungus toVerticilliumdahliaActivitie Activitie S of Relative for having very strong pathogenic effects to Italian Siberian cocklebur,
Corresponding rDNA ITS genetic fragment has been uploaded in Genbank, accession number KY087531.1, entitled toVerticilliumdahliaActivitie Activitie S of Relative
XIF10。
The identification by morphological characters of bacterial strain: 25 DEG C of culture 5d bacterium colony (figures on potato sucrose culture medium (PDA) culture medium
1A) diameter is up to 64mm or more, and germ bacterium colony is round, and surface aerial hyphae is more developed, and green is short cotton-shaped, radially extends:
Mycelia (Fig. 1 C) is colourless, separates, and diameter about 1.3-2.7m, the fungi is difficult on potato sucrose culture medium (PDA) culture medium
Generate spore.
The identification of bacterial strain molecular engineering: the genomic DNA of bacterial strain is extracted, using rDNA ITS universal primer: ITS1 (5 '-
TCCGTAGGTGAACCTGCGG-3), the PCR that ITS4 (5 '-TCCTCCGCTTATTGATATGC-3) carries out rDNA ITS sequence expands
Increase, acquisition length is 530bp (rDNA ITS) genetic fragment, from NCBI Blast retrieval and the high DNA of target sequence homology
Sequence, with this test be sequenced column respectively carry out bacterial strain kind in compare, by comparison result determine fungi toVerticilliumdahliaActivitie Activitie S of Relative with it is superfine
Rod method (Alternaria tenuissima) is same kind.
The optimal culture condition and inoculation infection condition of bacterial strain: the optimal culture condition and inoculation infection condition of bacterial strain: should
The optimum medium of fungal colony growth is that potato Portugal foretells sugar culture-medium (PDA), 28 DEG C of optimum temperature, Optimum pH pH
6.5, under these conditions, bacterium colony growth is fast, and when germ infects pathogenic, the optimum condition of hyphal suspension is mycelia weight in wet base and nothing
Bacterium water ratio is even higher in 1:100, moisturizing and half-light 48h after inoculation, and is entirely infecting 25-28 DEG C of temperature of period holding.
ToVerticilliumdahliaActivitie Activitie S of Relative (XIF10) fungus block it is pathogenic: the filter paper of sterilized culture dish size is put into culture dish,
Every ware one is opened, and 1mL sterile purified water is added, and the blade of clip robust growth disease-free spot after being rinsed well with clear water, uses concentration
For 70% alcohol scouring 1 time, dried after then being rinsed 3 times with sterile purified water again, face of blade is unfolded to be put into culture dish upwards
In, every ware puts 1, and moisturizing culture is spare；Needle thorn causes microtrauma mouth at blade proximal edge about 1cm, cuts in potato sucrose
The size cultivated on culture medium (PDA) is about 0.5 × 0.5cm2ToVerticilliumdahliaActivitie Activitie S of Relative (XIF10) fungus block, be placed in wound, then use
Preservative film sealing, moisturizing, is repeated 3 times, and separately does blank control, and germ diameter reaches 2cm after constant incubator 25 DEG C of preservations 5d, 5d2。
ToVerticilliumdahliaActivitie Activitie S of Relative (XIF10) hyphal suspension is pathogenic: picking toVerticilliumdahliaActivitie Activitie S of Relative (XIF10) strain is inoculated with potato
In sucrose culture medium (PDA), in 25 DEG C of constant temperature incubation 7d of temperature, allocation mycelia is simultaneously configured to hyphal suspension (mycelia is wet
Weight and sterile water 1:100), are inoculated with using semar technique, mycelia are equably applied to Italian Folium Xanthii on piece with sterile brush,
Until mycelia liquid starts lower drop on blade, is compared with the Italian Siberian cocklebur that sterile water is smeared, plastic bag cover is used after inoculation
To keep high humility on Italian Siberian cocklebur, polybag is thrown off after 48h, temperature is 25-28 DEG C, after inoculation after 48h during inoculation
There is obvious scab point in plant leaf；For plant illness rate up to 100%, entire plant leaf has begun dehydration yellow after 3d；10d
Entire plant is wilted dead afterwards.
ToVerticilliumdahliaActivitie Activitie S of Relative (XIF10) Raw toxin it is pathogenic: with after potato glucose (PDB) culture solution culture 7d, four
Layer filtered through gauze 1 time, gained filtrate is again with the double-deck chromatography filter paper filtering, and then filtrate is centrifuged 20min, revolving speed 4000r/min,
Gained supernatant is evaporated in vacuo to obtain the Raw toxin that causes a disease by ethyl acetate extraction, rotary evaporator, and gained Raw toxin is prepared
It is dead with plant after 3dh after the sprinkling Italy Siberian cocklebur blade of the toxin for 5 ㎎/ml solution.
The preparation and application of toVerticilliumdahliaActivitie Activitie S of Relative (XIF10) Biocontrol Activity bacterium:
(1) preparation of hyphal suspension:
The strain shifting of preservation is grown and is activated in Test-tube potato sucrose culture medium (PDA) slant medium, will be activated
ToVerticilliumdahliaActivitie Activitie S of Relative (XIF10) afterwards moves on potato sucrose culture medium (PDA) plating medium after culture 5d, and allocation mycelia will
It is made as hyphal suspension (mycelia weight in wet base and sterile water 1:100), and gained hyphal suspension is sprayed at Italian Siberian cocklebur blade face
On, there is obvious scab point in plant leaf after 48h after inoculation；Plant illness rate up to 100%, opened by entire plant leaf after 3d
Beginning dehydration yellow；Entire plant is wilted dead after 10d.
(2) preparation of Raw toxin:
Strain shifting is grown and is activated in Test-tube potato sucrose culture medium (PDA) slant medium, by the pole after activation
Alternaria tenuis moves on potato sucrose culture medium (PDA) plating medium after culture 5d, the punch for being then 5mm with diameter
It is beatened to take bacteria cake in access potato dextrose broth (2 pieces/100mL), is put into shaking table shaken cultivation, setting temperature is 25 DEG C,
Revolving speed 110r/min, continuously cultivates 7d, and potato dextrose broth is obtained filtrate, gained filtrate by four layers of filtered through gauze
Filtered again with double-layer filter paper, then filtrate be centrifuged 20min, revolving speed 4000r/min, gained supernatant by ethyl acetate extraction,
Rotavapor under vacuum steams sky and obtains Raw toxin, and gained Raw toxin is formulated as 5 ㎎/ml solution, in fine day or dusk at cloudy day
It is uniform to be sprayed at weeds Italy Siberian cocklebur blade face, after spraying treatment 3d, Italian Siberian cocklebur plant withered death.
The application of toVerticilliumdahliaActivitie Activitie S of Relative Raw toxin preparation and its advantage: resulting toVerticilliumdahliaActivitie Activitie S of Relative Raw toxin preparation is uniform
It is sprayed at weeds Italy Siberian cocklebur blade face, every square metre of spraying usage amount is the bacterium solution 30ml after dilution, is had to Italian Siberian cocklebur
The good effect of preventing and kill off, and to people, animal safety, do not poison.
A kind of application of the fungi toVerticilliumdahliaActivitie Activitie S of Relative of the present invention in prevention and control exotic invasive weed Italy Siberian cocklebur,
The rDNA ITS sequence of toVerticilliumdahliaActivitie Activitie S of Relative (XIF10):
GAAGGGCGGGCTGGACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTC
TTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAACATAAACCTTTTGTAATTGCAATCAGCGTCAGAAACAAAT
TAATAATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTG
TGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGT
TCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCTTGTCTCTAGCTTTGCTGGAGACTCGCCTTAA
AGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCAT
TAAGCCTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGG
Detailed description of the invention
Fig. 1 is simple community picture of the Italian Siberian cocklebur of the present invention in field；
Fig. 2 is the morphological feature picture of the Italian Siberian cocklebur toVerticilliumdahliaActivitie Activitie S of Relative (XIF10) of the present invention, and wherein A is potato sugarcane
5d bacterium colony front on sugar culture-medium (PDA)；B is the 5d bacterium colony back side on potato sucrose culture medium (PDA)；C is mycelia；
Fig. 3 is that toVerticilliumdahliaActivitie Activitie S of Relative of the present invention (XIF10) fungus block infects symptom (scab) figure after Italian Siberian cocklebur blade 5d
Piece；Wherein A is clear water control；B is the processing of toVerticilliumdahliaActivitie Activitie S of Relative (XIF10) fungus block；
Fig. 4 is 10d plant after Siberian cocklebur potting Italian in toVerticilliumdahliaActivitie Activitie S of Relative of the present invention (XIF10) hyphal suspension spray booth
Incidence picture；Wherein A is clear water control；B is the processing of toVerticilliumdahliaActivitie Activitie S of Relative (XIF10) hyphal suspension；
Fig. 5 is Italian Siberian cocklebur toVerticilliumdahliaActivitie Activitie S of Relative (XIF10) the Raw toxin indoor bioassay result picture of the present invention；Wherein
A is clear water control；B is the processing of toVerticilliumdahliaActivitie Activitie S of Relative (XIF10) Raw toxin；
Fig. 6 is the morbidity of toVerticilliumdahliaActivitie Activitie S of Relative of the present invention (XIF10) Raw toxin spraying suspension field Italy Siberian cocklebur 48h plant
Situation picture；Wherein A is before toVerticilliumdahliaActivitie Activitie S of Relative (XIF10) toxin soiutions act on；B is toVerticilliumdahliaActivitie Activitie S of Relative (XIF10) toxin soiutions
After effect.
Specific embodiment
The present invention will be further described with reference to the examples below.
Embodiment 1
Italian Siberian cocklebur pathogen isolating and purifying and screening:
Italian Siberian cocklebur pathogenicbacteria separation, purifying:
The separation of bacterial strain: choosing blade or stem that Italian Siberian cocklebur has typical scab respectively, rinsed well with clear water,
In the tissue block of the strong intersection clip 2mm × 2mm size of disease, superclean bench successively 70% alcohol, 0.1% mercuric chloride
Middle disinfection, then continuous rinsing 3 times in sterile water, are placed on horse after sucking extra moisture with the blotting paper of sterilizing after taking-up
In bell potato sucrose culture medium (PDA) plate, cultivated in 25 DEG C of constant incubators of temperature；
When the bacterium colony on PDA plate culture medium grows to a certain size, is isolated and purified and moved back through Pathogenicity
It is saved backup at 4 DEG C of refrigerator after entering the test tube slant potato sucrose culture medium (PDA)；
Host plant source and cultivation: relative healths plant of the acquisition without obvious Disease symptoms, removal ageing leaves move back
Plant the Italian Siberian cocklebur plant of health spare in the indoor sink of temperature, 2d selection grows fine and is of moderate size before inoculation test
Strain is implanted into polypots respectively, and polypots bottom is affixed by a small amount of Nutrition Soil and fills tap water, and basin alms bowl plant is placed on greenhouse certainly
It is grown at right temperature；
Italian Siberian cocklebur disease screening and tieback: picking isolates and purifies resulting pathogen strain inoculation potato sugarcane on a small quantity
In sugar culture-medium (PDA) culture medium, in 25 DEG C of constant temperature incubation 7d of temperature, allocation mycelia is simultaneously configured to hyphal suspension (bacterium
Silk weight in wet base and sterile water 1:100), it is inoculated with using semar technique, mycelia is equably applied to Italian Folium Xanthii with sterile brush
On piece is compared with the Italian Siberian cocklebur that sterile water is smeared until mycelia liquid starts lower drop on blade, plastics is used after inoculation
Bag covers on Italian Siberian cocklebur to keep high humility, and polybag is thrown off after 48h, and temperature is 25-28 DEG C during inoculation, fits after inoculation
When observation incidence and record Disease symptoms；
After symptom occurs in the blade of plant waiting, pathogen is separated again with tissue isolation, to separate front and back
Morphological features such as cultural colony, the mycelia of pathogen etc. are compared；
The screening of Italian Siberian cocklebur pathogen:
Under the conditions of 25 DEG C of temperature, separating obtained each bacterial strain is pressed into mycelia weight in wet base and the ratio of sterile water 1:100 respectively
Example is configured to hyphal suspension, before inoculation, rinses Italian Siberian cocklebur blade well with sterile water, is inoculated with using semar technique, uses
Mycelia is equably applied to Italian Folium Xanthii on piece by sterile brush, until mycelia liquid starts lower drop on blade, with nothing
The Italian Siberian cocklebur that bacterium water is smeared is as control, after inoculation, with plastic bag cover on Italian Siberian cocklebur, keeps high humility, 48h
Afterwards, polybag is removed, the susceptible gene and disease severity of plant are observed and recorded；
Italian Siberian cocklebur Taxonomic Status of Pathogenic Fungus identification:
The Morphological Identification of pathogen: pathogen is cultivated on potato sucrose culture medium (PDA), observes and records cause of disease in due course
The various forms feature of bacterium；Bacterium colony is directly shot with digital camera, and the mycelia of fungi is observed under an optical microscope, and with micro-
Imaging system shooting；
The Molecular Identification of sick pathogen: the extraction of total DNA uses chloroform/isoamyl alcohol extraction method, using rDNA ITS sequence
PCR amplification universal primer: ITS1 (5 '-TCCGTAGGTGAACCTGCGG-3), ITS4 (5 '-
TCCTCCGCTTATTGATATGC-3 the PCR amplification of rDNA sequence) is carried out, then obtained PCR product is sequenced, is grown
It in the accession number of Genbank is KY087531.1, entitled pole that degree, which is 530bp (rDNA ITS) genetic fragment (being detailed in sequence table),
The bacterial strain strain rDNA ITS sequence of alternaria tenuis (XIF10), acquisition carries out in www.ncbi.nlm.nih.gov database
BLAST is compared, and then determines the classification position of pathogen；
Pathogenic test of the toVerticilliumdahliaActivitie Activitie S of Relative XIF10 fungus block to Italian Siberian cocklebur blade:
The filter paper of sterilized culture dish size is put into culture dish, every ware one is opened, and 1mL sterile purified water is added,
The blade of clip robust growth disease-free spot after being rinsed well with clear water, is cleaned one time with 70% alcohol, then uses aseptic distillation again
Water dries after rinsing 3 times, and face of blade is unfolded to be put into culture dish upwards, and every ware puts 1, and moisturizing culture is spare；It is close in blade
Needle thorn causes microtrauma mouth at edge about 1cm, cut the size cultivated on potato sucrose culture medium (PDA) be about 0.5 ×
0.5cm2ToVerticilliumdahliaActivitie Activitie S of Relative (XIF10) fungus block, be placed in wound, then with preservative film sealing, moisturizing, be repeated 3 times, separately do blank
It compares, germ diameter reaches 2cm after constant incubator 25 DEG C of preservations 5d, 5d2(Fig. 3)；
Pathogenic test of the toVerticilliumdahliaActivitie Activitie S of Relative XIF10 hyphal suspension to Italian Siberian cocklebur potting:
Picking toVerticilliumdahliaActivitie Activitie S of Relative (XIF10) strain is inoculated in potato sucrose culture medium (PDA), in 25 DEG C of constant temperature trainings of temperature
7d is supported, allocation mycelia is simultaneously configured to hyphal suspension (mycelia weight in wet base and sterile water 1:100), is inoculated with, is used using semar technique
Mycelia is equably applied to Italian Folium Xanthii on piece by sterile brush, until mycelia liquid starts lower drop on blade, with nothing
The Italian Siberian cocklebur that bacterium water is smeared compares, and keeps high humility on Italian Siberian cocklebur with plastic bag cover after inoculation, takes off after 48h
Polybag is removed, temperature is 25-28 DEG C during inoculation, and obvious scab point occurs in plant leaf after 48h after inoculation；Plant illness after 3d
For rate up to 100%, entire plant leaf has begun dehydration yellow；Entire plant wilts dead (Fig. 4) after 10d；
The preparation method of toVerticilliumdahliaActivitie Activitie S of Relative (XIF10) hyphal suspension aqua:
Strain shifting is grown and is activated in Test-tube potato sucrose culture medium (PDA) slant medium, by the pole after activation
Alternaria tenuis (XIF10) moves on potato sucrose culture medium (PDA) plating medium after culture 5d, and allocation mycelia is made as
Hyphal suspension (mycelia weight in wet base and sterile water 1:100), i.e. the hyphal suspension preparation of toVerticilliumdahliaActivitie Activitie S of Relative (XIF10)；
The application of toVerticilliumdahliaActivitie Activitie S of Relative Raw toxin preparation and its advantage: resulting toVerticilliumdahliaActivitie Activitie S of Relative Raw toxin preparation is uniform
It is sprayed at Italian Siberian cocklebur blade face, every square metre of spraying usage amount is the bacterium solution 30ml after dilution, is had well to Italian Siberian cocklebur
The effect of preventing and kill off, and to people, animal safety, do not poison.
Embodiment 2
Italian Siberian cocklebur pathogen isolates and purifies with screening according to embodiment 1；
The extraction of toVerticilliumdahliaActivitie Activitie S of Relative (XIF10) Raw toxin:
The production poison culture of Italian Siberian cocklebur toVerticilliumdahliaActivitie Activitie S of Relative XIF10:
On superclean bench, the cultured Italian Siberian cocklebur toVerticilliumdahliaActivitie Activitie S of Relative bacterial strain plate of taking-up, a small amount of mycelia of picking,
It is inoculated in potato glucose (PDB) culture medium, the potato glucose (PDB) of inoculation is put into shaking table shaken cultivation, if
It sets temperature to replace for 25 DEG C, revolving speed 110r/min, 12h dark, continuously cultivates 7d, obtain fermentation liquid；
The extraction of Raw toxin
By resulting fermentation liquid, with four layers filtered through gauze 1 time, the double-deck chromatography filter paper filtering of gained filtrate, then filtrate
It is centrifuged 20min, revolving speed 10000r/min, gained supernatant is toxin crude extract；
Ethyl acetate extraction test:
It is initially charged with 100mL Raw toxin in separatory funnel, is reloaded into isometric acetate extractant, fulling shake makes
Two kinds of liquid blendings are obtained, stands to after being layered, from lower slow removal organic phase, then isometric extractant is added into water phase,
Such continuous extraction 3 times, merge organic phase, obtains extraction organic phase and aqueous phase extracted；Rotary evaporation, evaporation are carried out to organic phase
Fall organic solvent, extraction product is the Raw toxin of toVerticilliumdahliaActivitie Activitie S of Relative XIF10, is sealed against 4 DEG C of refrigerators and saves backup；
The Raw toxin active testing of toVerticilliumdahliaActivitie Activitie S of Relative XIF10:
Excised leaf needle point method: being formulated as 2 ㎎/ml aqueous solution for the toxin being obtained by extraction, and the culture dish of sterilizing is big
Small filter paper is put into culture dish, and every ware one is opened, and 1mL sterile purified water is added, the blade of clip robust growth disease-free spot, is used
After clear water is rinsed well, with 70% alcohol clean one time, then again with sterile purified water rinse 3 times after dry, face of blade to
Upper expansion is put into culture dish, and every ware puts 1, and moisturizing culture is spare；Needle thorn causes microtrauma mouth at blade proximal edge about 1cm,
Respectively inhale 40 μ L of prepare liquid, drip in wound, then use preservative film sealing, moisturizing, be repeated 3 times, compared with sterile water, constant temperature train
Germ diameter reaches 1cm after supporting case 25 DEG C of preservations 5d, 5d2(Fig. 5)；
The test pathogenic to field Italy Siberian cocklebur of toVerticilliumdahliaActivitie Activitie S of Relative (XIF10) Raw toxin aqua:
Strain shifting is grown and is activated in Test-tube potato sucrose culture medium (PDA) slant medium, by the pole after activation
Alternaria tenuis (XIF10) moves on potato sucrose culture medium (PDA) plating medium after culture 5d, a small amount of potato sugarcane of picking
Mycelium inoculation in sugar culture-medium (PDA) culture medium is simultaneously shaking table one week on potato glucose (PDB), by potato glucose
(PDB) culture solution obtains filtrate by four layers of filtered through gauze, and gained filtrate is filtered with double-layer filter paper again, and then filtrate is centrifuged
20min, revolving speed 4000r/min, gained supernatant filter to obtain Raw toxin by ethyl acetate extraction, rotavapor under vacuum,
Gained Raw toxin is formulated as 5 ㎎/ml solution, spray so uniform that be sprayed at Italian Siberian cocklebur blade face at dusk in fine day or cloudy day
After mist handles 3d, Italian Siberian cocklebur plant withered death (Fig. 6)；
The preparation method of toVerticilliumdahliaActivitie Activitie S of Relative XIF10 bacterial strain Raw toxin aqua:
Mycelium inoculation in a small amount of potato sucrose culture medium (PDA) of picking is on potato glucose (PDB) and shaking table
One week, PDB culture solution is obtained into filtrate by four layers of filtered through gauze, gained filtrate is filtered with double-layer filter paper again, then filtrate from
Heart 20min, revolving speed 4000r/min, gained supernatant steam sky by ethyl acetate extraction, rotavapor under vacuum and obtain thick poison
Element, and then gained Raw toxin is formulated as 5 ㎎/ml solution；
The application of toVerticilliumdahliaActivitie Activitie S of Relative Raw toxin preparation and its advantage: resulting toVerticilliumdahliaActivitie Activitie S of Relative Raw toxin preparation is uniform
It is sprayed at Italian Siberian cocklebur blade face, every square metre of spraying usage amount is the bacterium solution 30ml after dilution, is had well to Italian Siberian cocklebur
The effect of preventing and kill off, and to people, animal safety, do not poison.
Sequence table
<110>Xinjiang Inst. of Ecology and Geography, Chinese Academy of Sciences
<120>application of a kind of fungi toVerticilliumdahliaActivitie Activitie S of Relative in prevention and control exotic invasive weed Italy Siberian cocklebur
<130> 2018
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 480
<212> DNA
<213>(Alternaria tenuissima is grey in prevention and control exotic invasive weed Italy for a kind of fungi toVerticilliumdahliaActivitie Activitie S of Relative
Application in ear)
<400> 1
Claims (2)
1. a kind of application of toVerticilliumdahliaActivitie Activitie S of Relative in prevention and control exotic invasive weed Italy Siberian cocklebur, which is characterized in that the fungi pole
Alternaria tenuis (Alternaria tenuissima) it is that Italian Siberian cocklebur is natural from the field population in Xinjiang Urumqi suburbs
Acquisition is isolated and purified on disease plant blade, conventional method is respectively adopted from the fungi toVerticilliumdahliaActivitie Activitie S of Relative isolated and purified
Hyphal suspension and Raw toxin are prepared, then that the hyphal suspension of preparation and Raw toxin be uniformly sprayed at weeds Italy respectively is grey
On ear plant, in which:
The hyphal suspension of preparation is sprayed on weeds Italy Siberian cocklebur blade face, plant leaf occurs obviously after 48h after inoculation
Scab point；For plant illness rate up to 100%, entire plant leaf has begun dehydration yellow after 3d；Entire plant is wilted dead after 10d
It dies；
The fungi Raw toxin of preparation is formulated as 5 ㎎/ml solution, is uniformly sprayed on field weeds Italy Siberian cocklebur plant,
After spraying treatment 3d, Italian Siberian cocklebur plant is dead.
2. a kind of fungi toVerticilliumdahliaActivitie Activitie S of Relative according to claim 1 answering in prevention and control exotic invasive weed Italy Siberian cocklebur
With, which is characterized in that the field implementation amount of Raw toxin is 30ml/m2。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811111039.5A CN109161484A (en) | 2018-09-22 | 2018-09-22 | A kind of application of toVerticilliumdahliaActivitie Activitie S of Relative in prevention and control exotic invasive weed Italy Siberian cocklebur |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811111039.5A CN109161484A (en) | 2018-09-22 | 2018-09-22 | A kind of application of toVerticilliumdahliaActivitie Activitie S of Relative in prevention and control exotic invasive weed Italy Siberian cocklebur |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109161484A true CN109161484A (en) | 2019-01-08 |
Family
ID=64879958
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811111039.5A Withdrawn CN109161484A (en) | 2018-09-22 | 2018-09-22 | A kind of application of toVerticilliumdahliaActivitie Activitie S of Relative in prevention and control exotic invasive weed Italy Siberian cocklebur |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109161484A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115216409A (en) * | 2022-08-10 | 2022-10-21 | 武汉轻工大学 | Biological prevention and control method for radix seu folium Tetrastigmatis Hypoglauci |
-
2018
- 2018-09-22 CN CN201811111039.5A patent/CN109161484A/en not_active Withdrawn
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115216409A (en) * | 2022-08-10 | 2022-10-21 | 武汉轻工大学 | Biological prevention and control method for radix seu folium Tetrastigmatis Hypoglauci |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101851597B (en) | Streptomyces griseoflavus for resisting alfalfa diseases and screening method thereof | |
| CN102599031B (en) | Efficient stable indoor inoculation method for Ustilaginoidea virens and special strain | |
| CN109355233A (en) | A kind of bacillus amyloliquefaciens and its application | |
| CN109628328A (en) | One plant can prevent and treat sesame wilt disease and visit bad mould and its screening technique and application with growth-promoting and induction of resistance effect | |
| CN105368720A (en) | Cotton fungal endophyte CEF-082 and application of cotton fungal endophyte CEF-082 in prevention and treatment of cotton verticillium wilt | |
| CN105018391A (en) | Bacillus vallismortis NBIF-001 and fermentation process and application | |
| CN102925387B (en) | Bacillus simplex for inducing soybean to generate soybean cyst nematode resistance and application | |
| CN104195064B (en) | The Oryza sativa L. endogeny rayungus of the one external efficient antagonism Pyricularia oryzae of strain | |
| CN105670938B (en) | It is a kind of kill holotrichia oblita beauveria bassiana and its application | |
| CN109077068A (en) | A kind of application of fungi rod method in prevention and control exotic invasive weed Yellow calla | |
| CN115851553B (en) | Streptomyces virginiae capable of preventing and treating clubroot and application thereof | |
| CN102876584A (en) | Xylaria strain and application thereof | |
| CN110317735B (en) | Biocontrol pythium oligandrum and application thereof | |
| CN109161484A (en) | A kind of application of toVerticilliumdahliaActivitie Activitie S of Relative in prevention and control exotic invasive weed Italy Siberian cocklebur | |
| CN108102992B (en) | Microbacterium aurantiacus and application thereof in prevention and treatment of tomato root-knot nematodes | |
| CN102382776B (en) | Small spore phoma microspora for controlling conyza sumatrensis | |
| CN101555456A (en) | Fusarium philoceroides | |
| CN104893986B (en) | Dragonfly enterobacteriaceae Aspergillus terreus QT122 and its metabolite and application | |
| KR100459869B1 (en) | A cultivation method of cordyceps sinensis by using silkworm or its chrysalis | |
| CN110205262B (en) | Rhodobacter sphaeroides A2 strain, biocontrol microbial inoculum and preparation method and application thereof | |
| CN107325973A (en) | One plant there is High pathogenicity to hazel stinkbug muscardine bacterial strain and its application | |
| CN102634461B (en) | Verticillium dahliae 171 (Vd171) for preventing and treating cotton verticillium wilt and application of Vd171 | |
| CN110679611A (en) | Application of fusarium proliferatum in prevention and control of invasive plant xanthium sibiricum | |
| CN104962497B (en) | The dinitrogen of a kind of canker resistant pathogenic bacteria supports cholerae strain | |
| CN103641810A (en) | Polyketone compound, preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20190108 |