CN109136266B - Gene vector for treating or preventing crystal-like retinitis pigmentosa and use thereof - Google Patents

Abstract

The present invention relates to a gene vector for treating or preventing crystalloid retinal pigment degeneration (BCD) and use thereof. The gene vector for treating or preventing the crystal-like retinitis pigmentosa comprises: the packaging plasmid is an AAV2 packaging plasmid inserted with a gene sequence of anti-CD 59 short peptide C9; and carrier plasmid, which is AAV carrier plasmid inserted with human cytochrome P450 superfamily protein CYP4V2 gene sequence, anti-VEGF short peptide HRH gene sequence and promoter sequence. The AAV vector can fuse and express C9 anti-CD 59 short peptide to virus capsid protein; can realize the coexpression of CYP4V 2and HRH, compensate the protein function loss caused by CYP4V2 gene mutation in RPE cells, effectively repair the normal function of the RPE cells, specifically antagonize vascular endothelial growth factor VEGF, and delay the retinal atrophy caused by choroidal hyperplasia. The invention also provides application of the gene vector in preparing a medicament for treating or preventing crystalloid retinal pigment degeneration (BCD).

Description

Gene vector for treating or preventing crystal-like retinitis pigmentosa and use thereof

Technical Field

The invention belongs to the technical field of genetic engineering, relates to a gene vector, and more particularly relates to a gene vector for treating or preventing crystal-like retinitis pigmentosa (BCD) and application thereof.

Background

Crystalline retinitis pigmentosa (BCD) is a heritable degenerative ocular disease of the retina. Patients generally have night blindness during the adolescent stage; along with the development of the disease, the patients have yellow-white crystalline lipid crystals on the cornea and the eyeground and visual field loss; in the advanced stages of the disease, the patient's retina atrophies and eventually blindness 1. The disease is a rare disease in the west, but has a high incidence in asia, particularly in china (1/20000) (Hu, d. -N. (1983) ocular Genetics in china. ocular Genetics and Genetics,2(1), 39-45.). Unfortunately, there is currently no effective treatment for this disease. Clinical observations suggest that blindness in BCD patients is due to Retinal atrophy and choroidal hyperplasia induced by degeneration of Retinal pigment epithelial cells (RPE) due to mutations in the cytochrome P450 family CYP4V2 gene (Xiaoodong Jiao (2001). Genetic Linkage of Bietti crystalline corneal methylation to Chromosome 4q35.am J Hum Genet.2000Nov; 67(5): 1309-. AAV2 has been widely used for the treatment of monogenic genetic diseases with much success (Naso MF (2017), Adeno-Associated Virus (AAV) as a Vector for Gene therapy.BioDrugs.2017 Aug; 31(4): 317-.

Disclosure of Invention

The present invention aims to provide a gene vector which can achieve a certain therapeutic effect in the prevention and treatment of BCD.

The gene vector for treating or preventing the crystal-like retinitis pigmentosa comprises: the packaging plasmid is an AAV2 packaging plasmid inserted with a gene sequence of anti-CD 59 short peptide C9; and carrier plasmid, which is AAV carrier plasmid inserted with human cytochrome P450 superfamily protein CYP4V2 gene sequence, anti-VEGF short peptide HRH gene sequence and promoter sequence.

According to a further feature of the gene vector of the present invention, the gene sequence of the CYP4V2 protein is shown in SEQ ID NO 1; the HRH gene sequence is shown in SEQ ID NO. 2; the gene sequence of C9 is shown in SEQ ID NO. 3.

According to a further feature of the gene vector of the present invention, the promoter is a universal promoter or a promoter specific to retinal pigment epithelial cells.

According to a further feature of the genetic vector of the present invention, the universal promoter is selected from the group consisting of: CBh promoter, CAG promoter, PGK promoter, EF 1a promoter.

According to a further feature of the genetic vector of the present invention, the nucleotide sequence of the CBh promoter is shown in SEQ ID NO. 4; the nucleotide sequence of the CAG promoter is shown as SEQ ID NO. 5; the nucleotide sequence of the PGK promoter is shown as SEQ ID NO. 6; the nucleotide sequence of the EF1 alpha promoter is shown as SEQ ID NO. 7.

According to a further feature of the genetic vector of the present invention, the specific promoter is an RPE65 specific promoter.

According to a further feature of the genetic vector of the present invention, the RPE 65-specific promoter has a nucleotide sequence as shown in SEQ ID No. 8;

the CD59 surface antigen has been shown to be widely expressed on human RPE cell membranes, and if fundus injected AAV2 virus can specifically bind to the surface antigen, the transfection efficiency of AAV2 virus will be greatly improved (Yang P, Tyrrell J, Han I, Jaffe G (2009)50(7):3473-81.Expression and modulation of RPE cell membrane complex regulation proteins. invest Ophthalmol Vis Sci.2009,50(7): 3473-81.). Short peptides C9 have been reported in the literature to be capable of recognizing and specifically binding to the CD59 surface antigen with high efficiency (J Biol chem.2006Sep 15; 281(37):27398-404.Epub 2006Jul 14.Defining the CD59-C9binding interaction. Huang Y, Qiao F, Abagyan R, Hazard S, Tomlinson S.). The invention can realize the combination of AAV2 virus and CD59 surface antigen by fusion expression of capsin protein of C9 and AAV2 packaging shell plasmid, thereby improving the virus infection efficiency.

Differences in promoters mediating expression of foreign genes also affect the therapeutic efficacy of AAV. The invention adopts a plurality of universal promoters, including CBh, CAG, hPGK and EF1 alpha, which are widely used for mediating the high-efficiency expression of the foreign gene without cell differentiation. The invention also uses some cell-specific promoters, which are used to specifically express foreign genes in a specific cell. The RPE65 promoter is a specific promoter for RPE cells. The use of this promoter to mediate foreign gene expression will be limited to the specific cell RPE.

VEGF secreted by RPE plays an important role in retinal degradation and choroidal atrophy, and HRH short peptides can effectively inhibit the activity of Vascular Endothelial Growth Factor (VEGF) by binding VEGF. The invention constructs AAV2-CYP4V2-HRH co-expression vector, and utilizes T2A self-Cleavage peptide (MAbs.2015; 7(2):403-12.doi:10.1080/19420862.2015.1008351.Cleavage effective peptides 2A peptides for high level monoclonal antibody expression in CHO cells Chng J, Wang T, Nian R, Lau A, Hoi KM, Ho SC, Gagnon P, Bi X, Yang Y.) short peptide to connect CYP4V 2and HRH, thus effectively realizing their co-expression without interfering their function, and finally achieving the purpose of expressing HRH short peptide to inhibit VEGF while compensating endogenous CYP4V2 protein deletion, thereby delaying retinal degradation.

Therefore, the invention provides an adeno-associated virus vector which can be specifically combined with the retinal RPE cell surface antigen CD59 and simultaneously over-express the CYP4V2-HRH protein. The vector is composed of two parts. The first part is an engineered AAV2 packaging plasmid capable of fusion expressing C9 anti-CD 59 short peptides to viral capsid proteins; the second part of the vector can realize the co-expression of human cytochrome P450 superfamily protein CYP4V 2and HRH anti-VEGF short peptide. The exogenous gene expression is mediated by a gene sequence of a universal promoter or a retinal pigment epithelial cell RPE65 specific promoter. The adenovirus produced by the two plasmids can fuse and express C9 to virus capsid protein, and effectively improve the infection capability of AAV virus to RPE cells by specifically binding RPE cell surface antigen CD 59. Meanwhile, the AAV vector can realize the co-expression of CYP4V 2and HRH, the former compensates the protein function loss caused by CYP4V2 gene mutation in RPE cells, and can effectively repair the normal function of the RPE cells; the latter can specifically antagonize vascular endothelial growth factor VEGF, and delay retina atrophy caused by choroidal hyperplasia.

It is a second object of the present invention to provide a composition comprising the gene vector according to the present invention, and a pharmaceutically acceptable excipient. For example, the gene vector is formulated into a composition for intraocular injection, and an excipient suitable for intraocular injection may be added. Preferably, the intraocular injection is a subretinal injection or a vitreous cavity injection.

The third purpose of the invention is to provide the application of the gene vector.

One application of the gene vector is to prepare a medicine for treating or preventing crystalloid retinal pigment degeneration (BCD).

The other application of the invention is the application of the gene vector in preparing a medicament for co-expressing CYP4V 2and HRH coding sequences in retinal pigment epithelial cells of a subject suffering from crystal-like retinal pigment degeneration.

According to the above use, the expression of the normal CYP4V2 protein can be restored in retinal pigment epithelial cells of a subject suffering from crystal-like retinal pigment degeneration.

Drawings

FIG. 1 is a characteristic diagram of the AAV2/2-C9 plasmid constructed in the present invention.

FIG. 2 is a characteristic diagram of the AAV-pCBh-CYP4V2-HRH plasmid constructed in the present invention.

FIG. 3 is a characteristic diagram of the AAV-pCAG-CYP4V2-HRH plasmid constructed in the present invention.

FIG. 4 is a characteristic diagram of the AAV-pPGK-CYP4V2-HRH plasmid constructed in the present invention.

FIG. 5 is a characteristic diagram of the AAV-pEF1 alpha-CYP 4V2-HRH plasmid constructed in the present invention.

FIG. 6 is a characteristic diagram of the AAV-pRPE65-CYP4V2-HRH plasmid constructed in the present invention.

FIG. 7 is an in vitro CYP4V2 overexpression profile. In the figure: 1 is blank group without virus infection; 2 is AAV 2-pCAG-hYP 4V2-HRH control group; 3 is AAV 2-C9-pCAG-hCAP 4V2-HRH group; 4 is AAV2-pRPE 65-hYP 4V2-HRH control group; 5 is AAV2-C9-pRPE 65-hYP 4V 2-HRH.

FIG. 8 is a chart of AAV treatment of RPE cells in BCD patients. In the figure: i is iPSC (scale line 200 microns); ii differentiated RPE (scale line 50 microns); iii lipid drop staining of normal human RPE (50 microns on scale); iv staining of RPE lipid droplets in BCD patients (15 μm scale); staining of RPE lipid droplets (15 microns on the scale line) in BCD patients infected with AAV2-pCAG-CYP4V2 virus at V; the drops of RPE were stained (15 microns on the scale line) in BCD patients infected with the vims ViAAV2-pRPE65-CYP4V 2.

Detailed Description

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The experimental procedures for the specific conditions not noted in the following examples are generally performed under conventional conditions such as those described in the literature of the industry (e.g., J. SammBruk et al, molecular cloning, A laboratory Manual, third edition, scientific Press, 2002), or according to the manufacturer's recommendations.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

Example 1: construction, isolation and purification of adenovirus vector

1. The coding sequence of CYP4V2-HRH gene was amplified.

1) NCBI inquires to obtain the cDNA sequence of human CYP4V2 gene (https:// www.ncbi.nlm.nih.gov/nuccore/NM-207352.3), and synthesizes the sequence (SEQ ID NO: 1).

2) HRH short peptide nucleotide sequence was fused using T2A based on the above sequence, and the fused HRH short peptide was sent to the company for synthesis of CYP4V2-HRH gene fragment (SEQ ID NO: 2).

3) Designing and synthesizing primers, and cloning and amplifying the CYP4V2-HRH sequence by using high-fidelity PCR.

CYP4V2-F：CGCGGATCCATGGCGGGGCTCTGGCTGG

CYP4V2-R:GGTAAGCTTTTAGCGCGGTATGGCGC

2. Amplification of multiple universal promoters

1) Querying Addgene (Cambridge non-profit plasmid resource library) to obtain promoter sequences of CBh, CAG, PGK and EF1 alpha, plasmid ID: 42230, 16664, 21217 and 26797.

2) Using the promoter sequence obtained by the query, the DNA sequences thereof (SEQ ID NO:4 to SEQ ID NO:7) were synthesized.

3) Primers carrying the restriction sites as shown below were synthesized and these promoters were amplified using high fidelity PCR.

CBh-F primer: GTCAACGCGTCGTTACATAACTTACGGTA, respectively;

CBh-R primers: TCACGGTACCGCTTGAGTTGAGGCCTG, respectively;

CAG-F primer: GTCAACGCGTGCGTTACATAACTTACGGTAAAT, respectively;

CAG-R primer: TCACGGTACCGGCACGGGGCGAAGGCAG, respectively;

PGK-F primer: GTCAACGCGTGGTTGGGGTTGCGCCTTTTC, respectively;

PGK-R primers: TCACGGTACCCCTGGGGAGAGAGGTCGGTG, respectively;

EF1-F primer: GTCAACGCGCGTGAGGCTCCGGTGCCC, respectively;

EF1-R primer: TCACGGTACCCACGACACCTGAAATGGAA are provided.

3. Amplification of the RPE65 promoter

1) Human whole genome DNA was extracted and used to amplify a template for the RPE65 promoter.

2) Synthetic primers were designed according to literature reports (Yang P, Tyrrell J, Han I, Jaffe G (2009)50(7):3473-81.Expression and modification of RPE cell membrane regulation proteins. invest Ophthalmol Vis Sci.2009,50(7): 3473-81.):

RPE65-F primer: GTCAACGCGTATTGCTGGTTTAAGAAGATTTGG, respectively;

RPE65-R primer TCACGGTACCTTTCTTCCAGTTCAGGATCCAGA.

3) The promoter at the upstream of the RPE65 gene was amplified by high fidelity PCR, and the total length was about 1500bp (SEQ ID NO: 8).

4. Construction of different promoter-mediated AAV expression plasmids

1) AAV shuttle plasmid (Addgene, 60958) was digested with MluI and KpnI, 37 ° overnight; and meanwhile, the promoters subjected to 37 ℃ overnight enzyme digestion amplification comprise CMV, CAG, PGK, EF1 alpha and RPE65 promoters.

2) The plasmid backbone and the digestion products (promoters) were purified by gel recovery experiments.

3) Enzyme-linked reaction: each promoter was cloned into an AAV shuttle plasmid separately using T4 ligase, ligated overnight at 4 °.

4) Coli competent cells were transformed and clones were screened using ampicillin.

5) And (4) selecting a single clone, and sequencing and identifying.

5.A different promoter-mediated AAV 2-C9-hYP 4V2-HRH shuttle plasmid was constructed (as shown in FIGS. 2-6).

1) The AAV2 shuttle plasmid is digested by BamH1 and HindIII at 37 ℃ overnight; simultaneously, the amplified cDNA sequence of the CYP4V2-HRH gene is digested at 37 ℃ overnight.

2) The plasmid backbone and the cleavage products (CYP4V2-HRH cDNA sequence) were purified by gel recovery experiments.

3) Enzyme-linked reaction: the cDNA sequence of the CYP4V2 gene was cloned into each AAV2 expression plasmid using T4 ligase, ligated overnight at 4 °.

4) Coli competent cells were transformed and clones were screened using ampicillin.

5) And (4) selecting a single clone, and sequencing and identifying.

6. Construction of AAV2/2-C9 capsid plasmid (shown in FIG. 1)

1) The nucleotide sequence of the Cap protein of the rAAV2-retro shell plasmid was obtained from Addgene (https:// www.addgene.org/81070 /).

2) The C9 short peptide nucleotide sequence was fused based on the sequence, and the fused product was sent to the company for synthesis of gene fragments with restriction sites NotI and BmgBI.

3) NotI and BmgBI double enzyme digestion of the above synthetic gene fragment and rAAV2-retro shell plasmid.

4) Enzyme-linked reaction: coli competent cells were transformed by overnight ligation at 4 ℃ using T4 ligase.

5) And (4) selecting a single clone, and sequencing and identifying.

7. Packaging AAV 2-C9-hYP 4V2-HRH virus mediated by different promoters

1) 293 cells (Seimearfei Gene Co.) were cultured in 10cm dishes to 80% saturation.

2) The liposome Lipo2000 transfects CYP4V2-AAV2 expression vector and packaging plasmid (including AAV2/2-C9 capsid plasmid).

AAV-pCAG-hCY4VP2-HRH plasmid: 10 ug;

AAV2/2-C9 capsid plasmid: 5 ug;

helper plasmids: 5 ug;

liposome: 60 ul;

750ul of ultrapure water was added thereto, mixed well, left to stand at room temperature for 20 minutes, and added to 293 cells.

3) After 3 days, the culture supernatant containing a large amount of AAV 2-C9-pCAG-hYP 4V2-HRH virus was collected.

Purification of AAV 2-C9-hYP 4V2-HRH virus

After primary purification with ioxobutanol, further purification by ion exchange chromatography was performed by flash protein liquid chromatography using 5ml-Hitrp Q sepharose as packing (Pharmacia AKTA FPLC system (Amersham biosciences, Piscataway, N.J., USA)). The agarose gel column was then rinsed with 215mM NaCl, pH8.0, and the peaked recombinant viral vectors were collected. After the collected liquid passed through a concentrator (100K concentrator, Millipore), the recombinant viral vectors were concentrated by rinsing the concentrator with 0.014% Tween 20. DNA other than the viral particles was digested with DNase I, and the titer of the virus was determined by real-time fluorescent quantitative PCR. Finally, silver nitrate staining-SDS polyacrylamide gel electrophoresis is used for ensuring that virus vector particles are not polluted and do not contain endotoxin, and the virus vector particles are subpackaged at minus 80 ℃ for storage.

Example 2: in vitro overexpression validation of adenovirus vectors

1. ARPE-19 cells were cultured in twelve well cell culture plates to 70% saturation.

2. 10000MOI AAV 2-C9-pCAG-hCry 4V2-HRH and AAV2-C9-pRPE 65-hCry 4V2-HRH viruses are added, incubated overnight, and the corresponding AAV 2-pCAG-hCry 4V2-HRH and AAV2-pRPE 65-hCry 4V2-HRH viruses packaged by unmodified AAV2 capsomere are used as controls.

3. Replacing fresh culture medium and continuing culturing.

After 4.3 days, total cellular protein was extracted after cell collection.

And 5, verifying the CYP4V2 expression condition by using western blot.

6. The results are shown in FIG. 7: 1 is a blank group without virus infection, and only expresses very low amount of CYP4V2 protein; 2 is AAV 2-pCAG-hYP 4V2-HRH control group, the CYP4V2 protein expression is improved, and a certain amount of HRH expression can be detected; 3 is AAV 2-C9-pCAG-hCGP 4V2-HRH group, compared with the control group, the CYP4V 2and HRH protein expression quantity are obviously improved, which shows that C9 can obviously improve the infection efficiency of AAV2 virus to ARPE-19 cells; 4 is AAV2-pRPE 65-hYP 4V2-HRH control group, the CYP4V2 protein expression is improved, and a certain amount of HRH expression can be detected; 5 is AAV2-C9-pRPE 65-hYP 4V2-HRH, compared with a control group, the expression levels of CYP4V 2and HRH protein are also obviously improved, and C9 is also shown to be capable of obviously improving the infection efficiency of AAV2 virus on ARPE-19 cells. Finally, experiments prove that the modified AAV2/2-C9 plasmid and the CYP4V2-HRH expression plasmid can effectively improve the RPE infection capability of AAV 2and realize the high-efficiency co-expression of CYP4V 2and HRH.

Example 3: functional verification of adenovirus vectors

1. Establishment of BCD patient iPSC cell line

The peripheral blood cells of normal and BCD patients were extracted by iPSC reprogramming technology (cell.2006Aug 25; 126(4):663-76.Epub 2006Aug 10. indication of pluripotent stem cells from mouse embryo culturing and adult fibroblast cells, Takahashi K1, Yamanaka S.), cultured for 10 days in CD34+ serum-free medium, electrically transformed into Yamanaka four-factor plasmid, cultured for two days with serum-free culture, transformed into Geltrex treated cell culture plate, and cultured in dry cell culture medium E8 until iPSC clone appeared. Typically, ipscs appear after two weeks and when the clone grows to the naked eye, it can be passage expanded for the next cell differentiation experiment.

Differentiation of RPE cells in BCD patients and in normal humans

RPE cell differentiation was performed according to published methods (PLoS one.2015Jul 1; 10(7): e0131288.doi:10.1371/journal. point.0131288. ecoselection 2015.Human Ocular Cells Expressing SOX2and OCT4Yield High Efficiency of Pluripotency reproduction. point MW, He J, Fan X, Zhang Z, Wang W, Wang J, Qiu F, Tse HF, Li W, Liu Z, Lian Q.), as follows. BCD patients and normal iPSCs are cultured in an E8 culture medium until saturation, then a serum-containing differentiation culture medium A is added for continuous culture for two days, then the cells are cultured in a serum-free differentiation culture medium for continuous culture, after three weeks, RPE cells with typical cobblestone shapes and pigment precipitates can be seen, and the cells can be subjected to subculture and expansion and used for subsequent experiments (the specific culture medium formula is shown in the cited literature).

AAV2 infection assay

RPE cells were inoculated to a cell culture plate, 10000MOI AAV2 virus was added when the cells grew to 70% saturation, the solution was changed the next day, and the cells were cultured to saturation for subsequent analysis. Staining with the fluorescent dye Bodipy-493/503 indicated lipid droplet accumulation in the RPE of BCD patients. In order to verify the functions of the adenovirus vector, AAV 2-pCAG-hYP 4V 2and AAV2-pRPE 65-hYP 4V2 viruses are used for infecting RPE cells of a BCD patient (the method is consistent with that of infecting ARPE19 cells), and the MOI is 10000.

The final result is shown in fig. 8: i is iPSC of BCD patient; ii is RPE cells of a BCD patient differentiated from the iPSC; iii is lipid droplet accumulation in normal human RPE cells; iv is the lipid droplet accumulation of the RPE cells of the BCD patient, and the lipid droplet accumulation degree is far higher than that of the normal RPE of the iii patient; v is that lipid droplets accumulated by cells are obviously reduced after the RPE of a BCD patient receives AAV 2-C9-pCAG-hYP 4V 2-HRH; vi shows that lipid droplets accumulated by cells are obviously reduced after the RPE of a BCD patient receives AAV2-C9-pRPE 65-hYP 4V 2-HRH. These results demonstrate that AAV virus packaged by the provided plasmid can effectively improve lipid metabolism disorder of RPE cells of BCD patients, thereby achieving the purpose of treating BCD.

Example 4: application of gene vector

The gene vector is a virus expression vector and can be used for gene therapy of BCD.

Recombinant viral vectors can be produced according to standard techniques. For example, recombinant adeno-associated virus vectors can be transmitted in human 293 cells (which provide the properties of trans E1A and E1B) to reach 10⁷～10¹³Titers in the range of individual virus particles/mL.

Prior to in vivo use, the viral vector may be desalted by gel filtration methods (e.g., agarose columns) and purified by subsequent filtration. Purification reduces potential deleterious effects in the host of the administration vehicle. Administered byThe virus is substantially free of wild-type virus and replication-competent virus. The purity of the virus can be demonstrated by a suitable method, such as sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), followed by silver staining. Suitable dosages for human AAV are in the range of about 1X 10¹⁰～1×10¹⁴Individual viral particles.

The gene therapy vector is administered by intraocular injection, and can be administered by subretinal or intravitreal injection.

For convenience of clinical application, the pharmaceutical composition of the present invention may be contained in an administration device for injection (e.g., a needle for injection), in which the pharmaceutical composition may be contained in an amount administered at one time. The administration device for injection may be contained in a cartridge for convenient storage and use. The transportation requires placing a tiny container filled with the drug suspension in dry ice. It should be kept in a-80C refrigerator at ordinary times. The kit or kit of the present invention may further comprise instructions for use, which will facilitate the use of the kit or kit in a proper manner by those skilled in the art. As used herein, a "pharmaceutically acceptable" component is one that is suitable for use in humans and/or mammals without undue adverse side effects (such as toxicity), i.e., with a reasonable benefit/risk ratio. The term "pharmaceutically acceptable carrier" refers to a carrier for administration of a therapeutic agent, including various excipients and diluents. The term refers to such pharmaceutical carriers: they are not essential active ingredients per se and are not unduly toxic after administration. Suitable pharmaceutically acceptable carriers are well known to those of ordinary skill in the art. Sufficient details regarding pharmaceutically acceptable carriers can be found in Remington's pharmaceutical Sciences (Mack pub. co., n.j., 1991). Pharmaceutically acceptable carriers in the compositions may comprise liquids such as water, BBS (balanced salt solution) phosphate buffer, ringer's solution, physiological saline, balanced salt solution, glycerol or sorbitol, and the like. In addition, auxiliary substances, such as lubricants, glidants, wetting or emulsifying agents, pH buffering substances and stabilizers, etc., may also be present in these carriers.

SEQUENCE LISTING

<110> Shenzhen Hongxi Biotech development Limited

<120> Gene vector for treating or preventing crystalline retinitis pigmentosa and use thereof

<130>

<160> 8

<170> PatentIn version 3.5

<210> 1

<211> 1578

<212> DNA

<213> Artificial Synthesis

<400> 1

atggcggggc tctggctggg gctcgtgtgg cagaagctgc tgctgtgggg cgcggcgagt 60

gccctttccc tggccggcgc cagtctggtc ctgagcctgc tgcagagggt ggcgagctac 120

gcgcggaaat ggcagcagat gcggcccatc cccacggtgg cccgcgccta cccactggtg 180

ggccacgcgc tgctgatgaa gccggacggg cgagaatttt ttcagcagat cattgagtac 240

acagaggaat accgccacat gccgctgctg aagctctggg tcgggccagt gcccatggtg 300

gccctttata atgcagaaaa tgtggaggta attttaacta gttcaaagca aattgacaaa 360

tcctctatgt acaagttttt agaaccatgg cttggcctag gacttcttac aagtactgga 420

aacaaatggc gctccaggag aaagatgtta acacccactt tccattttac cattctggaa 480

gatttcttag atatcatgaa tgaacaagca aatatattgg ttaagaaact tgaaaaacac 540

attaaccaag aagcatttaa ctgctttttt tacatcactc tttgtgcctt agatatcatc 600

tgtgaaacag ctatggggaa gaatattggt gctcaaagta atgatgattc cgagtatgtc 660

cgtgcagttt atagaatgag tgagatgata tttcgaagaa taaagatgcc ctggctttgg 720

cttgatctct ggtaccttat gtttaaagaa ggatgggaac acaaaaagag ccttcagatc 780

ctacatactt ttaccaacag tgtcatcgct gaacgggcca atgaaatgaa cgccaatgaa 840

gactgtagag gtgatggcag gggctctgcc ccctccaaaa ataaacgcag ggcctttctt 900

gacttgcttt taagtgtgac tgatgacgaa gggaacaggc taagtcatga agatattcga 960

gaagaagttg acaccttcat gtttgagggg cacgatacaa ctgcagctgc aataaactgg 1020

tccttatacc tgttgggttc taacccagaa gtccagaaaa aagtggatca tgaattggat 1080

gacgtgtttg ggaagtctga ccgtcccgct acagtagaag acctgaagaa acttcggtat 1140

ctggaatgtg ttattaagga gacccttcgc ctttttcctt ctgttccttt atttgcccgt 1200

agtgttagtg aagattgtga agtggcaggt tacagagttc taaaaggcac tgaagccgtc 1260

atcattccct atgcattgca cagagatccg agatacttcc ccaaccccga ggagttccag 1320

cctgagcggt tcttccccga gaatgcacaa gggcgccatc catatgccta cgtgcccttc 1380

tctgctggcc ccaggaactg tataggtcaa aagtttgctg tgatggaaga aaagaccatt 1440

ctttcgtgca tcctgaggca cttttggata gaatccaacc agaaaagaga agagcttggt 1500

ctagaaggac agttgattct tcgtccaagt aatggcatct ggatcaagtt gaagaggaga 1560

aatgcagatg aacgctaa 1578

<210> 2

<211> 36

<212> DNA

<213> Artificial Synthesis

<400> 2

catcgccata ccaaacagcg ccataccgcg ctgcat 36

<210> 3

<211> 36

<212> DNA

<213> Artificial Synthesis

<400> 3

ctggatgtga gcctggcgtt tagcgaaatt agcgtg 36

<210> 4

<211> 564

<212> DNA

<213> Artificial Synthesis

<400> 4

cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt 60

gacgtcaata gtaacgccaa tagggacttt ccattgacgt caatgggtgg agtatttacg 120

gtaaactgcc cacttggcag tacatcaagt gtatcatatg ccaagtacgc cccctattga 180

cgtcaatgac ggtaaatggc ccgcctggca ttgtgcccag tacatgacct tatgggactt 240

tcctacttgg cagtacatct acgtattagt catcgctatt accatggtcg aggtgagccc 300

cacgttctgc ttcactctcc ccatctcccc cccctcccca cccccaattt tgtatttatt 360

tattttttaa ttattttgtg cagcgatggg ggcggggggg gggggggggc gcgcgccagg 420

cggggcgggg cggggcgagg ggcggggcgg ggcgaggcgg agaggtgcgg cggcagccaa 480

tcagagcggc gcgctccgaa agtttccttt tatggcgagg cggcggcggc ggcggcccta 540

taaaaagcga agcgcgcggc gggc 564

<210> 5

<211> 584

<212> DNA

<213> Artificial Synthesis

<400> 5

gcgttacata acttacggta aatggcccgc ctggctgacc gcccaacgac ccccgcccat 60

tgacgtcaat aatgacgtat gttcccatag taacgccaat agggactttc cattgacgtc 120

aatgggtgga gtatttacgg taaactgccc acttggcagt acatcaagtg tatcatatgc 180

caagtacgcc ccctattgac gtcaatgacg gtaaatggcc cgcctggcat tatgcccagt 240

acatgacctt atgggacttt cctacttggc agtacatcta cgtattagtc atcgctatta 300

ccatggtcga ggtgagcccc acgttctgct tcactctccc catctccccc ccctccccac 360

ccccaatttt gtatttattt attttttaat tattttgtgc agcgatgggg gcgggggggg 420

ggggggggcg cgcgccaggc ggggcggggc ggggcgaggg gcggggcggg gcgaggcgga 480

gaggtgcggc ggcagccaat cagagcggcg cgctccgaaa gtttcctttt atggcgaggc 540

ggcggcggcg gcggccctat aaaaagcgaa gcgcgcggcg ggcg 584

<210> 6

<211> 513

<212> DNA

<213> Artificial Synthesis

<400> 6

cggggttggg gttgcgcctt ttccaaggca gccctgggtt tgcgcaggga cgcggctgct 60

ctgggcgtgg ttccgggaaa cgcagcggcg ccgaccctgg gtctcgcaca ttcttcacgt 120

ccgttcgcag cgtcacccgg atcttcgccg ctacccttgt gggccccccg gcgacgcttc 180

ctgctccgcc cctaagtcgg gaaggttcct tgcggttcgc ggcgtgccgg acgtgacaaa 240

cggaagccgc acgactcact agtaccctcg cagacggaca gcgccaggga gcaatggcag 300

cgcgccgacc gcgatgggct gtggccaata gcggctgctc agcggggcgc gccgagagca 360

gcggccggga aggggcggtg cgggaggcgg ggtgtggggc ggtagtgtgg gccctgttcc 420

tgcccgcgcg gtgttccgca ttctgcaagc ctccggagcg cacgtcggca gtcggctccc 480

tcgttgaccg aatcaccgac ctctctcccc agg 513

<210> 7

<211> 1188

<212> DNA

<213> Artificial Synthesis

<400> 7

cgtgaggctc cggtgcccgt cagtgggcag agcgcacatc gcccacagtc cccgagaagt 60

tggggggagg ggtcggcaat tgaaccggtg cctagagaag gtggcgcggg gtaaactggg 120

aaagtgatgt cgtgtactgg ctccgccttt ttcccgaggg tgggggagaa ccgtatataa 180

gtgcagtagt cgccgtgaac gttctttttc gcaacgggtt tgccgccaga acacaggtaa 240

gtgccgtgtg tggttcccgc gggcctggcc tctttacggg ttatggccct tgcgtgcctt 300

gaattacttc cacgcccctg gctgcagtac gtgattcttg atcccgagct tcgggttgga 360

agtgggtggg agagttcgag gccttgcgct taaggagccc cttcgcctcg tgcttgagtt 420

gaggcctggc ctgggcgctg gggccgccgc gtgcgaatct ggtggcacct tcgcgcctgt 480

ctcgctgctt tcgataagtc tctagccatt taaaattttt gatgacctgc tgcgacgctt 540

tttttctggc aagatagtct tgtaaatgcg ggccaagatc tgcacactgg tatttcggtt 600

tttggggccg cgggcggcga cggggcccgt gcgtcccagc gcacatgttc ggcgaggcgg 660

ggcctgcgag cgcggccacc gagaatcgga cgggggtagt ctcaagctgg ccggcctgct 720

ctggtgcctg gcctcgcgcc gccgtgtatc gccccgccct gggcggcaag gctggcccgg 780

tcggcaccag ttgcgtgagc ggaaagatgg ccgcttcccg gccctgctgc agggagctca 840

aaatggagga cgcggcgctc gggagagcgg gcgggtgagt cacccacaca aaggaaaagg 900

gcctttccgt cctcagccgt cgcttcatgt gactccacgg agtaccgggc gccgtccagg 960

cacctcgatt agttctcgag cttttggagt acgtcgtctt taggttgggg ggaggggttt 1020

tatgcgatgg agtttcccca cactgagtgg gtggagactg aagttaggcc agcttggcac 1080

ttgatgtaat tctccttgga atttgccctt tttgagtttg gatcttggtt cattctcaag 1140

cctcagacag tggttcaaag tttttttctt ccatttcagg tgtcgtga 1188

<210> 8

<211> 1533

<212> DNA

<213> human

<400> 8

attgctggtt taagaagatt tggattatcc ttgtactttg aggagaagtt tcttatttga 60

aatattttgg aaacaggtct tttaatgtgg aaagatagat attaatctcc tcttctatta 120

ctctccaaga tccaacaaaa gtgattatac cccccaaaat atgatggtag tatcttatac 180

taccatcatt ttataggcat agggctctta gctgcaaata atggaactaa ctctaataaa 240

gcagaacgca aatattgtaa atattagaga gctaacaatc tctgggatgg ctaaaggatg 300

gagcttggag gctacccagc cagtaacaat attccgggct ccactgttga atggagacac 360

tacaactgcc ttggatgggc agagatatta tggatgctaa gccccaggtg ctaccattag 420

gacttctacc actgtcccta acgggtggag cccatcacat gcctatgccc tcactgtaag 480

gaaatgaagc tactgttgta tatcttggga agcacttgga ttaattgtta tacagttttg 540

ttgaagaaga cccctagggt aagtagccat aactgcacac taaatttaaa attgttaatg 600

agtttctcaa aaaaaatgtt aaggttgtta gctggtatag tatatatctt gcctgttttc 660

caaggacttc tttgggcagt accttgtctg tgctggcaag caactgagac ttaatgaaag 720

agtattggag atatgaatga attgatgctg tatactctca gagtgccaaa catataccaa 780

tggacaagaa ggtgaggcag agagcagaca ggcattagtg acaagcaaag atatgcagaa 840

tttcattctc agcaaatcaa aagtcctcaa cctggttgga agaatattgg cactgaatgg 900

tatcaataag gttgctagag agggttagag gtgcacaatg tgcttccata acattttata 960

cttctccaat cttagcacta atcaaacatg gttgaatact ttgtttacta taactcttac 1020

agagttataa gatctgtgaa gacagggaca gggacaatac ccatctctgt ctggttcata 1080

ggtggtatgt aatagatatt tttaaaaata agtgagttaa tgaatgaggg tgagaatgaa 1140

ggcacagagg tattaggggg aggtgggccc cagagaatgg tgccaaggtc cagtggggtg 1200

actgggatca gctcaggcct gacgctggcc actcccacct agctcctttc tttctaatct 1260

gttctcattc tccttgggaa ggattgaggt ctctggaaaa cagccaaaca actgttatgg 1320

gaacagcaag cccaaataaa gccaagcatc agggggatct gagagctgaa agcaacttct 1380

gttccccctc cctcagctga aggggtgggg aagggctccc aaagccataa ctccttttaa 1440

gggatttaga aggcataaaa aggcccctgg ctgagaactt ccttcttcat tctgcagttg 1500

gtgccagaac tctggatcct gaactggaag aaa 1533

Claims (5)

1. A gene vector for use in treating or preventing crystalloid retinal pigment degeneration, comprising: the packaging plasmid is an AAV2 packaging plasmid inserted with a gene sequence of anti-CD 59 short peptide C9; and

the vector plasmid is an AAV vector plasmid inserted with a gene sequence of human cytochrome P450 superfamily protein CYP4V2, a gene sequence of anti-VEGF short peptide HRH and a promoter sequence;

the gene sequence of the CYP4V2 protein is shown in SEQ ID NO: 1; the HRH gene sequence is shown in SEQ ID NO. 2; the gene sequence of C9 is shown in SEQ ID NO. 3.

2. The gene vector according to claim 1, wherein the promoter is a universal promoter or a promoter specific to retinal pigment epithelial cells;

the universal promoter is selected from: CBh promoter, CAG promoter, PGK promoter, EF 1a promoter; the nucleotide sequence of the CBh promoter is shown as SEQ ID NO. 4; the nucleotide sequence of the CAG promoter is shown as SEQ ID NO. 5; the nucleotide sequence of the PGK promoter is shown as SEQ ID NO. 6; the nucleotide sequence of the EF1 alpha promoter is shown as SEQ ID NO. 7;

the specific promoter is an RPE65 specific promoter, and the nucleotide sequence of the specific promoter is shown as SEQ ID NO. 8.

3.A composition comprising the gene vector of claim 1, and a pharmaceutically acceptable excipient.

4. Use of the gene vector according to claim 1 for the preparation of a medicament for the treatment or prevention of crystal-like retinitis pigmentosa.

5. Use of the gene vector of claim 1 for the preparation of a medicament co-expressing CYP4V 2and an HRH coding sequence in retinal pigment epithelial cells of a subject having crystalloid retinal pigment degeneration.

Images