CN114854791A - Novel CRISPR-Cas9 system vector and application thereof - Google Patents

Novel CRISPR-Cas9 system vector and application thereof Download PDF

Info

Publication number
CN114854791A
CN114854791A CN202110151816.4A CN202110151816A CN114854791A CN 114854791 A CN114854791 A CN 114854791A CN 202110151816 A CN202110151816 A CN 202110151816A CN 114854791 A CN114854791 A CN 114854791A
Authority
CN
China
Prior art keywords
sequence
vector
seq
loxp
cas9
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202110151816.4A
Other languages
Chinese (zh)
Inventor
刘旭
陈邵宏
史天永
郝丹丹
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beijing Chinagene Tech Co ltd
Original Assignee
Beijing Chinagene Tech Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beijing Chinagene Tech Co ltd filed Critical Beijing Chinagene Tech Co ltd
Priority to CN202110151816.4A priority Critical patent/CN114854791A/en
Publication of CN114854791A publication Critical patent/CN114854791A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4746—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used p53
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0684—Cells of the urinary tract or kidneys
    • C12N5/0686—Kidney cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1241—Nucleotidyltransferases (2.7.7)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15041—Use of virus, viral particle or viral elements as a vector
    • C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/106—Plasmid DNA for vertebrates
    • C12N2800/107—Plasmid DNA for vertebrates for mammalian
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/30—Vector systems comprising sequences for excision in presence of a recombinase, e.g. loxP or FRT
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/001—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination
    • C12N2830/002—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination inducible enhancer/promoter combination, e.g. hypoxia, iron, transcription factor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/50—Vector systems having a special element relevant for transcription regulating RNA stability, not being an intron, e.g. poly A signal
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Abstract

The embodiment of the invention relates to the technical field of biology, in particular to a novel CRISPR-Cas9 system vector and application thereof. The carrier provided by the embodiment of the invention sequentially comprises the following functional elements: an upstream LoxP sequence, a sgRNA sequence, a Cas9 protein, an inducible promoter, a Cre recombinase and a downstream LoxP sequence in the same direction; wherein the sgRNA sequence and Cas9 protein sequences are interchangeable; the sgRNA sequence targets the gene of interest. According to the vector provided by the invention, a CRISPR-Cas9 system and a Cre-Loxp system are combined, the gene knockout functions of the two systems are fully exerted, and an upstream LoxP sequence is arranged in front of the CRISPR-Cas9 system; sequentially arranging an inducible promoter, a Cre recombinase and a downstream homodromous LoxP sequence behind the CRISPR-Cas9 system; after the CRISPR-Cas9 system completes the gene knockout or gene knock-in function, the inducible promoter is induced to start expressing Cre recombinase, the Cre-Loxp system is started, the functional element between the upstream LoxP sequence and the downstream LoxP sequence is knocked out, and the Cre-Loxp system and the CRISPR-Cas9 system are completely prevented from excessively shearing cell genomes or causing immune reaction.

Description

Novel CRISPR-Cas9 system vector and application thereof
Technical Field
The invention relates to the technical field of biology, in particular to a novel CRISPR-Cas9 system vector and application thereof.
Background
The CRISPR-Cas9 (regularly clustered interspaced short palindromic repeats) technology is a novel gene editing method, can be used for site-directed knockout of genes, and is widely concerned in the field of gene therapy. The Cas9 endonuclease cuts double-stranded DNA under the guide of guide ribonucleic acid (guide RNA, sgRNA) to cause genome double-strand break, and generates nonspecific recombination by utilizing instability of cellular genome repair to generate repair errors (insertion or deletion), thereby possibly generating frame shift mutation to cause loss of gene function and achieving the purpose of gene knockout.
At present, a plurality of researchers knock out pathogenic genes or knock in beneficial genes for disease prevention or treatment by using the CRISPR-Cas9 system, but the potential danger to cells caused by the CRISPR-Cas9 system after gene knock-out or knock-in is not considered: first, Cas9 protein, as a foreign protein, may cause immune responses in the body; secondly, sgRNA may also cause an immune response in cells as foreign nucleic acid; again, the presence of both Cas9 protein and sgRNA may also cause excessive shearing of the cell genome.
Although RNA transfection techniques are currently used to co-transfect sgRNA and Cas9 mRNA directly into cells to be modified for transient expression, these techniques are more useful in vitro experiments and are not suitable for in vivo experiments or in vivo gene editing therapies.
Cre-loxP is a site-specific gene recombination technique. The Cre protein (Cyclization Enzyme) is a recombinase, consisting of 343 amino acids. The LoxP site (loci of X-over P1) is a 34bp sequence located in the P1 phage, and consists of two 13bp reverse palindromic sequences and an 8bp intermediate spacer sequence, and the spacer sequence determines the orientation of loxP. The Cre recombinase can recognize the LoxP sites, so that gene recombination occurs between the two LoxP sites. The Cre recombinase can act on DNA substrates with various structures, such as linear, circular and even supercoiled DNA, without any auxiliary factors, but the Cre recombinase can also cause immune response in vivo.
The information disclosed in this background section is only for enhancement of understanding of the general background of the invention and should not be taken as an acknowledgement or any form of suggestion that this information forms the prior art already known to a person skilled in the art.
Disclosure of Invention
Object of the Invention
In order to solve the technical problems, the invention aims to provide a novel CRISPR-Cas9 system vector and application thereof. According to the invention, a CRISPR-Cas9 system and a Cre-Loxp system are combined, gene knockout functions of the two systems are fully exerted, and an upstream LoxP sequence is arranged in front of the CRISPR-Cas9 system; sequentially arranging an inducible promoter, a Cre recombinase and a downstream homodromous LoxP sequence behind the CRISPR-Cas9 system; after the CRISPR-Cas9 system completes the gene knockout or gene knock-in function, the inducible promoter is induced to start expressing Cre recombinase, the Cre-Loxp system is started, the functional element between the upstream LoxP sequence and the downstream LoxP sequence is knocked out, and the Cre-Loxp system and the CRISPR-Cas9 system are completely prevented from excessively shearing cell genomes or causing immune reaction.
Solution scheme
To achieve the object of the present invention, an embodiment of the present invention provides a carrier, which sequentially comprises the following functional elements:
an upstream LoxP sequence, a sgRNA sequence, a Cas9 protein, an inducible promoter, Cre recombinase and a downstream LoxP sequence in the same direction; wherein the sgRNA sequence and Cas9 protein sequences are interchangeable; the sgRNA sequence targets the gene of interest. The functional elements may include a spacer sequence of 0 to several hundred bp.
In a possible implementation manner, the carrier is provided with: the sgRNA sequence and the Cas9 protein each also include a constitutive promoter before and a transcription termination element after the Cas9 protein.
In a possible implementation manner of the vector, the upstream LoxP sequence comprises a sequence shown by SEQ ID NO.1 or a complementary sequence of the sequence shown by SEQ ID NO.1, and the downstream LoxP sequence comprises a sequence shown by SEQ ID NO.9 or a complementary sequence of the sequence shown by SEQ ID NO. 9; or the upstream LoxP sequence comprises a sequence shown by SEQ ID NO.24 or a complementary sequence of the sequence shown by SEQ ID NO.24, and the downstream LoxP sequence in the same direction comprises a sequence shown by SEQ ID NO.25 or a complementary sequence of the sequence shown by SEQ ID NO. 25; or the upstream LoxP sequence comprises a sequence shown in SEQ ID NO.28 or a complementary sequence of the sequence shown in SEQ ID NO.28, and the downstream LoxP sequence comprises a sequence shown in SEQ ID NO.29 or a complementary sequence of the sequence shown in SEQ ID NO. 29.
In one possible implementation of the above vector, the constitutive promoter comprises CMV, MSCV or U6 promoter; alternatively, the U6 promoter sequence is as set forth in SEQ ID NO. 6.
In one possible implementation of the above vector, the Cas9 protein includes saCas9, spCas9, ascipf 1, Cjcas9, NmCas9, St1Cas9 or TdCas 9; alternatively, the Cas9 protein includes saCas 9; further alternatively, the saCas9 protein sequence is shown as SEQ ID No. 3.
In one possible implementation of the above vector, the inducible promoter includes the Mx1, TRE, tTA, or ER promoter; alternatively, the inducible promoter comprises the Mx1 or TRE promoter; further alternatively, the Mx1 promoter sequence is shown in SEQ ID NO. 7; the TRE promoter sequence is shown in SEQ ID NO. 23.
In one possible implementation of the above vector, the transcription termination element comprises bGH polyA; alternatively, the bGH polyA sequence is as shown in SEQ ID NO. 5.
In one possible implementation of the above vector, the Cre recombinase is Escherichia virus P1Cre recombinase, Sphingomonas sp.erg5 Cre recombinase, or Salmonella range SJ46 Cre recombinase; optionally Escherichia virus P1Cre recombinase, the coding sequence of which is shown in SEQ ID NO. 8.
In one possible implementation of the above vector, the sgRNA targets the p53 gene; optionally, the sgRNA sequence comprises the sequence shown in SEQ ID No.2 or the complement of the sequence shown in SEQ ID No. 2.
In one possible implementation of the above vector, the sgRNA targets the RPGR gene; alternatively, the sgRNA sequence comprises the sequence shown in SEQ ID No.18 or the complement of the sequence shown in SEQ ID No. 18.
In one possible implementation, the vector comprises a plasmid.
The above vector in one possible implementation, the vector includes a viral vector; optionally, the viral vector comprises a lentiviral vector, a retroviral vector, an adenoviral vector, or an adeno-associated viral vector.
The embodiment of the invention also provides a cell containing the vector; optionally, the cell comprises a human cell, a non-human mammalian cell, a stem cell.
The embodiment of the invention also provides a composition which comprises the carrier and pharmaceutically acceptable auxiliary materials.
The embodiment of the invention also provides the vector, a cell containing the vector and application of the composition in preparing a kit for modifying genes or regulating gene expression or medicines.
In one possible implementation of the above application, the modification is a knock-out.
The embodiment of the invention also provides a kit, which comprises: the above-mentioned vector, and/or the above-mentioned composition, and/or the above-mentioned cell.
Advantageous effects
At present, although a Cre-Loxp system and a CRISPR-Cas9 system are used in a matching manner, the Cre-Loxp system is only used for carrying out space-time regulation and control on the expression of the CRISPR-Cas9 system, the CRISPR-Cas9 system which is subjected to gene knockout or knocking-in is not removed, and the Cre-Loxp system is also not effectively removed. The Cre recombinase may elicit an immune response in vivo.
According to the vector provided by the invention, a CRISPR-Cas9 system and a Cre-Loxp system are combined, the gene knockout functions of the two systems are fully exerted, and an upstream LoxP sequence is arranged in front of the CRISPR-Cas9 system; sequentially arranging an inducible promoter, a Cre recombinase and a downstream homodromous LoxP sequence behind the CRISPR-Cas9 system; after the CRISPR-Cas9 system completes the gene knockout or gene knock-in function, the inducible promoter is induced to start expressing Cre recombinase, the Cre-Loxp system is started, the functional element between the upstream LoxP sequence and the downstream LoxP sequence is knocked out, and the Cre-Loxp system and the CRISPR-Cas9 system are completely prevented from excessively shearing cell genomes or causing immune reaction.
Drawings
One or more embodiments are illustrated by the corresponding figures in the drawings, which are not meant to be limiting. The word "exemplary" is used exclusively herein to mean "serving as an example, embodiment, or illustration. Any embodiment described herein as "exemplary" is not necessarily to be construed as preferred or advantageous over other embodiments.
Fig. 1 is a schematic structural diagram of a functional element in embodiment 1 of the present invention.
FIG. 2 is an electrophoretogram for detecting p53 gene in 293T cells transfected with pCDH-MSCV-sa-sgRNA1-Cre plasmid and control 293T cells in example 1 of the present invention, wherein: mock represents a control group of 293T cells, sg1 represents a group of 293T cells transfected with pCDH-MSCV-sa-sgRNA1-Cre plasmid.
FIG. 3 is an electrophoretogram of cas9 knock-out effect detected after IFN- β was added and no IFN- β was added to 293T cells transfected with pCDH-MSCV-sa-sgRNA1-Cre plasmid in example 1 of the present invention, wherein: IFN represents the control group without IFN- β, and + IFN represents the group of 293T cells with IFN- β added.
FIG. 4 shows PCR results of eyeball retinal cell cDNA of mice injected or not injected with lentivirus in example 2 of the present invention, mock represents the group not injected with virus, and 105bp of RPGR cDNA amplification product can be seen; the + virus group was a lentivirus injection group, with no corresponding band.
FIG. 5 shows the results of the lentivirus-injected or not-injected total protein western of the ocular retina cells in example 2 of the present invention, mock represents the non-injected virus group, and the RPGR protein is visible; the + virus group was a lentivirus injection group, with no corresponding band.
FIG. 6 shows the PCR results of eyeball retinal cell cDNA after the injection or non-injection of lentivirus into the eyeball and the injection or non-injection of IFN-beta in example 2 of the present invention, mouse B performs fundus retinal injection of 100IU IFN-beta to induce expression of sgRNA 2; mouse C was not injected with IFN- β, as a control; -virus indicates no lentivirus injection and + virus indicates lentivirus injection.
FIG. 7 shows the results of total protein western of eye retina cells of an eye globe injected or not injected with lentivirus, and injected or not injected with IFN- β in example 2 of the present invention, mouse B induced sgRNA2 expression by injecting 100IU IFN- β into the fundus retina; mouse C was not injected with IFN- β, as a control; -virus indicates no lentivirus injection and + virus indicates lentivirus injection.
FIG. 8 is an electrophoretogram for detection of p53 gene in 293T cells transfected with pCDH-MSCV-sa-sgRNA1-Cre2 plasmid and control 293T cells of the present invention in example 3, wherein: mock represents a control group of 293T cells, sg1 represents a group of 293T cells transfected with pCDH-MSCV-sa-sgRNA1-Cre2 plasmid.
FIG. 9 is an electrophoresis diagram of genome PCR detection of Cas9 in PCR products of 293T cells transfected with pCDH-MSCV-sa-sgRNA1-Cre2 plasmid and control 293T cells of the present invention after induction of Cre2 recombinase with final concentration of 1. mu.g/ml or without Doxylcline (Dox), respectively, in example 3, wherein: mock represents a control group of 293T cells, sg1 represents a group of 293T cells transfected with pCDH-MSCV-sa-sgRNA1-Cre2 plasmid, Dox + represents induction with addition of Doxyclline, and Dox-represents induction without addition of Doxyclline.
FIG. 10 is a graph showing the results of western detection of cas protein expression in 293T cells transfected with pCDH-MSCV-sa-sgRNA1-Cre2 plasmid and control 293T cells in example 3 of the present invention, after Cre recombinase is induced by the cells in a final concentration of 1. mu.g/ml or without Doxylcline (Dox), respectively, wherein: mock represents a control 293T cell group, sg1 represents a 293T cell group transfected with pCDH-MSCV-sa-sgRNA1-Cre2 plasmid, Dox + represents addition of Dox induction, and Dox-represents no addition of Dox induction.
FIG. 11 is an electrophoretogram for detection of p53 gene in 293T cells transfected with pCDH-MSCV-sa-sgRNA1-Cre3 plasmid and control 293T cells of the present invention in example 4, wherein: mock represents a control group of 293T cells, sg1 represents a group of 293T cells transfected with pCDH-MSCV-sa-sgRNA1-Cre3 plasmid.
FIG. 12 is an electrophoretogram of PCR detection of Cas9 products after induction of 293T cells transfected with pCDH-MSCV-sa-sgRNA1-Cre3 plasmid in example 4 of the present invention with or without IFN- β, respectively, wherein: + IFN means induction with IFN- β, -IFN means induction without IFN- β.
FIG. 13 is a diagram showing the results of western detection of cas protein expression in 293T cells transfected with pCDH-MSCV-sa-sgRNA1-Cre3 plasmid and control 293T cells in example 4 of the present invention, with or without IFN- β induction Cre recombinase, wherein: mock represents a control 293T cell group, sg1 represents a 293T cell group transfected with pCDH-MSCV-sa-sgRNA1-Cre3 plasmid, IFN + represents induction with IFN-beta, and IFN-represents no induction with IFN-beta.
FIG. 14 is an electrophoretogram for detection of the p53 gene in 293T cells transfected with pCDH-MSCV-sa-sgRNA1-Cre4 plasmid and control 293T cells of the present invention in example 5, wherein: mock represents a control group of 293T cells, sg1 represents a group of 293T cells transfected with pCDH-MSCV-sa-sgRNA1-Cre4 plasmid.
FIG. 15 is an electrophoretogram of PCR detection of Cas9 products after induction of 293T cells transfected with pCDH-MSCV-sa-sgRNA1-Cre4 plasmid in example 5 of the present invention with or without IFN- β, respectively, wherein: + IFN means induction with IFN- β, and-IFN means induction without IFN- β.
FIG. 16 is a graph showing the results of western detection of cas protein expression in 293T cells transfected with pCDH-MSCV-sa-sgRNA1-Cre4 plasmid and control 293T cells in example 5 of the present invention, with or without IFN- β induction Cre recombinase, respectively, wherein: mock represents a control 293T cell group, sg1 represents a 293T cell group transfected with pCDH-MSCV-sa-sgRNA1-Cre4 plasmid, IFN + represents induction with IFN-beta, and IFN-represents no induction with IFN-beta.
FIG. 17 is a schematic structural diagram of the functional elements of FG12-sa-sgRNA1-Cre2 vector in example 6 of the present invention.
FIG. 18 is an electrophoretogram of the p53 gene in 293T cells transfected with FG12-sa-sgRNA1-Cre2 plasmid and control 293T cells of the present invention in example 6, wherein: mock represents the control 293T cell group, sg1 represents the 293T cell group transfected with FG12-sa-sgRNA1-Cre2 plasmid.
FIG. 19 is an electrophoretogram of PCR detection of Cas9 products after induction of 293T cells transfected with FG12-sa-sgRNA1-Cre2 plasmid in example 6 of the present invention with or without Doxyccline (Dox), respectively, wherein: + Dox indicates the addition of Doxyclline induction, -Dox indicates no addition of Doxyclline induction.
Detailed Description
In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below, and it is obvious that the described embodiments are a part of the embodiments of the present invention, but not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention. Throughout the specification and claims, unless explicitly stated otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element or component but not the exclusion of any other element or component.
Furthermore, in the following detailed description, numerous specific details are set forth in order to provide a better understanding of the present invention. It will be understood by those skilled in the art that the present invention may be practiced without some of these specific details. In some embodiments, materials, elements, methods, means, and the like that are well known to those skilled in the art are not described in detail in order to not unnecessarily obscure the present invention.
The molecular cloning steps in the examples of the present invention, such as digestion, ligation, PCR, gel electrophoresis, gel recovery, transformation, transfection, etc., can be performed according to the relevant chapters of the "molecular cloning guidelines (fourth edition) (scientific press, sambrook, m.r. green).
Example 1
1. A vector, referred to in the practice of the present invention as pCDH-MSCV-sa-sgRNA1-Cre, which is: a vector having the following functional elements inserted into the multiple cloning site of a lentiviral shuttle plasmid (type pCDH-MSCV-MCS-EF1-copGFP), the functional elements including from 5 'to 3':
an upstream LoxP sequence, sacAS9 protein, a bGH polyA sequence, a U6 promoter, a sgRNA sequence, an Mx1 promoter, a Cre recombinase and a homodromous downstream LoxP sequence; a schematic diagram of which is shown in fig. 1.
Wherein, the upstream LoxP sequence is: 5'-ATAAC TTCGT ATAGC ATACA TTATA CGAAG TTAT-3' (SEQ ID NO. 1);
in this example, the sgRNA is sgRNA1, which targets the p53 gene with the sequence: AGCAA AGTTT TATTG TAAAA T (SEQ ID NO. 2);
the sacAS9 protein sequence is shown as SEQ ID NO. 3; the cDNA sequence is shown in SEQ ID NO. 4;
the sequence of the bGH polyA is shown in SEQ ID NO. 5;
the sequence of the U6 promoter is shown as SEQ ID NO. 6;
the Mx1 promoter sequence is shown in SEQ ID NO. 7;
the Cre recombinase cDNA sequence is shown as SEQ ID NO. 8;
the homodromous downstream LoxP sequence is: 5'-ATAAC TTCGT ATAGC ATACA TTATA CGAAG TTAT-3' (SEQ ID NO. 9).
The construction method of the lentiviral shuttle plasmid pCDH-MSCV-sa-sgRNA1-Cre comprises the following steps (PX 601 vector used in the experiment is a commercial vector and is purchased from XYbscience):
1) and (3) adopting restriction enzyme BsaI to cut the PX601 vector to obtain a linearized plasmid.
2) Two oligonucleotide fragments (oligos) of sgRNA1 were synthesized, annealed, and inserted into a linearized PX601 vector to obtain a PX601-sgRNA1 vector.
The sequences of the two oligonucleotide fragments of synthetic sgRNA1 were as follows:
Oligo1-5'：CACCG AGCAA AGTTT TATTG TAAAA T(SEQ ID NO.10)；
Oligo1-3'：AAACA TTTTA CAATA AAACT TTGCT C(SEQ ID NO.11)。
3) the element CMV-sacAS9-bGH polyA-U6-sgRNA1 is obtained by PCR amplification from a PX601-sgRNA1 vector, wherein an upstream primer and a downstream primer used for amplification respectively comprise an upstream LoxP sequence and a downstream LoxP sequence, and the primer sequences are as follows:
LoxP-Cas9-F：
TCTTGAAAGGAGTGGGAATTCTCGAGGCGTTATAACTTCGTATAGCATACATTATACGAAGTTATGACATTGATTATTGACTAGT(SEQ ID NO.12)；
LoxP-Cas9-R：
GCTAAGATCTACAGCTGCCTCGGCCGCAAAAATCTCGCCA (SEQ ID NO. 13); the product obtained by amplification is indicated as "LoxP-CMV-sacAS 9-bGH polyA-U6-sgRNA 1-LoxP".
4) The pCDH-MSCV-MCS-EF1-copGFP vector is cut by restriction enzymes AgeI and KpnI to obtain a linearized plasmid.
5) The PCR product "LoxP-CMV-sacAS 9-bGH polyA-U6-sgRNA 1-LoxP" was ligated into the linearized pCDH-MSCV-MCS-EF1-copGFP plasmid by homologous recombination, and the resulting plasmid was named pCDH-MSCV-LoxP-CMV-sacAS9-U6-sgRNA 1.
6) The plasmid pCDH-MSCV-loxP-CMV-sacAS9-U6-sgRNA1 is digested by restriction enzyme NotI to obtain a linearized plasmid.
7) An artificially synthesized MX1(SEQ ID NO.7) -Cre (SEQ ID NO.8) -downstream LoxP (SEQ ID NO.9) element is connected into a linearized pCDH-MSCV-LoxP-CMV-saCas9-U6-sgRNA1 plasmid by using a homologous recombination method, and the obtained vector is named as a pCDH-MSCV-sa-sgRNA1-Cre vector.
2. Transfection of 293T cells
The constructed lentiviral shuttle plasmid pCDH-MSCV-sa-sgRNA1-Cre was transfected into 293T cells.
The method comprises the following specific steps:
1) 24h before transfection, 293T cells in the logarithmic growth phase were trypsinized and adjusted to a cell density of 1.2X 10 in a medium containing 10% serum 7 The cells/20 ml were re-inoculated in a 15cm cell culture dish at 37 ℃ with 5% CO 2 Culturing in an incubator. After the cell density reaches 70-80%, the cell can be used for transfection after being cultured for 24 h. The cell state is critical for virus packaging and therefore it is desirable to ensure good cell state and a low number of passages. Cell culture medium was changed to serum-free medium 2h before transfection.
2) Mu.g of pCDH-MSCV-sa-sgRNA1-Cre vector was added to a sterilized centrifuge tube and mixed with 100. mu.l of Opti-MEM.
4) Lipofectamine 2000 was gently shaken, and 6. mu.l of Lipofectamine 2000 was mixed with 100. mu.l of Opti-MEM in another tube and incubated at room temperature for 5 minutes.
5) The diluted DNA was mixed with the diluted Lipofectamine 2000, and the mixture was gently inverted and mixed within 5 minutes without shaking.
6) After mixing, incubation was performed at room temperature for 20 minutes to form a transfection complex of DNA with Lipofectamine 2000 dilution.
7) Transferring the mixture of DNA and Lipofectamine 2000 to 293T cell culture medium, mixing, and culturing at 37 deg.C with 5% CO 2 Culturing in a cell culture box.
8) After 8h of culture, untransfected 293T and transfected 293T were divided into three 35mm dishes at 1:3, respectively, and replaced with 2ml of 10% serum cell culture medium at 37 ℃ with 5% CO 2 The incubator was allowed to incubate for 48 hours.
3. Detection of the Effect of knocking out the p53 Gene
The copy number of the p53 gene in the genome is detected by using a PCR method, and the detection steps are as follows:
1) taking transfected 293T cells and untransfected 293T cells of a 35mm culture dish as controls respectively, and extracting genomes;
2) detecting the copy number of p53 in the genome by using a detection primer;
the detection primers used were: p 53-F1: GGCCC ACCTC TTACC GATT T (SEQ ID NO. 14);
p53-R1：CAGGA GCCAT TGTCT TTGAG G(SEQ ID NO.15)。
the detection result is shown in FIG. 2, and it can be seen from FIG. 2 that the gene product of wild-type p53(717bp) is visible in the control group (indicated as "mock" in FIG. 2); and no specific band is positioned corresponding to a group (shown as sg 1) of transfected pCDH-MSCV-sa-sgRNA1-Cre, which indicates that sgRNA1 plays a gene knockout function and the p53 gene is successfully knocked out.
4. Detection of knockout Effect of cas9
After detection of the p53 gene knockout, IFN- β was used to induce Cre recombinase expression:
1) adding 500IU of recombinant IFN-beta into 293T cells transfected with pCDH-MSCV-sa-sgRNA1-Cre in a 35mm culture dish; another 35mm dish of 293T cells transfected with pCDH-MSCV-sa-sgRNA1-Cre was used as a control without IFN- β.
2) After 72h, extracting the genomes of the 293T cells of the two dishes;
3) copy number detection of cas9 using detection primers:
the specific PCR primers used were:
cas9-F2：AAGAG CAGAT CAGCC GGAAC(SEQ ID NO.16)；
cas9-R2：AAGCT TCTCT TCACG ACGGG(SEQ ID NO.17)；
the detection results are shown in FIG. 3, and it can be seen from FIG. 3 that the PCR product of cas9(935bp) is visible in the control group (IFN- β group is not added, and "-IFN" in the figure); while the corresponding position of the IFN- β group (indicated as "+ IFN" in the figure) had no specific band, indicating that cas9 was successfully knocked out after IFN- β induction. Namely, the Cre-Loxp system is started, functional elements between the upstream LoxP sequence and the downstream homonymous LoxP sequence are successfully knocked out, and the excessive shearing of cell genomes or the induction of immune reaction by the Cre-Loxp system and the CRISPR-Cas9 system can be thoroughly avoided.
Example 2
1. The structure and construction of a vector, designated pCDH-MSCV-sa-sgRNA2-Cre in the practice of the present invention, was identical to that of example 1 except that the sgRNA sequence was different.
The sgRNA used in this example was sgRNA2, which targets the RPGR gene and has the sequence: CCTTT CCCAT GTACT GTTTC (SEQ ID NO. 18).
The construction steps are the same as example 1, and the differences are as follows: artificially synthesizing two oligonucleotide fragments (oligos) of sgRNA2, annealing, and inserting the two oligonucleotide fragments into a BsaI linearized PX601 vector to obtain a PX601-sgRNA2 vector; the rest steps are the same as the example 1, and the obtained vector is named as pCDH-MSCV-sa-sgRNA 2-Cre;
the sequences of the two oligonucleotide fragments of the artificially synthesized sgRNA2 were as follows:
Oligo2F：CACCG CCTTT CCCAT GTACT GTTTC(SEQ ID NO.19)；
Oligo2R：AAAC GAAAC AGTAC ATGGG AAAGGC(SEQ ID NO.20)。
2. packaging lentiviruses
Packaging lentivirus by using a constructed lentivirus shuttle plasmid pCDH-MSCV-sa-sgRNA 2-Cre; the obtained lentivirus was injected into the retina of the fundus of a mouse. The method comprises the following specific steps:
(1) cell transfection
1) 24h before transfection, 293T cells in the logarithmic growth phase were trypsinized and adjusted to a cell density of 1.2X 10 in a medium containing 10% serum 7 The cells/20 ml were re-inoculated in a 15cm cell culture dish at 37 ℃ with 5% CO 2 Culturing in an incubator. After the cell density reaches 70-80%, the cell can be used for transfection after being cultured for 24 h. The cell state is critical for virus packaging and therefore it is desirable to ensure good cell state and a low number of passages.
2) Cell culture medium was changed to serum-free medium 2h before transfection.
3) Each prepared DNA solution (pCDH-MSCV-sa-sgRNA2-Cre vector 20. mu.g, pHelper 1.0 vector 15. mu.g, pHelper 2.0 vector 10. mu.g) was added to a sterilized centrifuge tube, mixed with the corresponding volume of Opti-MEM uniformly, adjusted to a total volume of 2.5ml, and incubated at room temperature for 5 minutes.
4) Lipofectamine 2000 was gently shaken, and 100. mu.l of Lipofectamine 2000 was mixed with 2.4ml of Opti-MEM in another tube and incubated at room temperature for 5 minutes.
5) The diluted DNA was mixed with the diluted Lipofectamine 2000, and the mixture was gently inverted and mixed within 5 minutes without shaking.
6) After mixing, incubation was performed at room temperature for 20 minutes to form a transfection complex of DNA with Lipofectamine 2000 dilution.
7) Transferring the mixture of DNA and Lipofectamine 2000 to 293T cell culture medium, mixing, and culturing at 37 deg.C with 5% CO 2 Culturing in a cell culture box.
8) After 8 hours of incubation, the medium containing the transfection mixture was poured off, 20ml of PBS was added to each flask of cells, the flask was gently shaken side to wash the residual transfection mixture, and then poured off.
9) Adding 25ml of cell culture medium containing 10% serum into each flask of cells, and culturing at 37 deg.C with 5% CO 2 The incubator was allowed to incubate for 48 hours.
(2) Harvesting and concentration of viruses
1) Supernatants from 293T cells were collected 48 hours after transfection (which could be 0 hours after transfection).
2) Cell debris was removed by centrifugation at 4000g for 10min at 4 ℃.
3) The supernatant was filtered through a 0.45 μm filter into a 40ml ultracentrifuge tube.
4) A sample of the crude viral extract was added to the filter cup (up to 19ml) and the lid was closed. The filter cup is inserted into the permeate collection tube.
5) After the combination, the balance is well made and placed on the rotating head.
6) Centrifugation at 4000 Xg brought to the desired virus concentration volume. The time required is generally from 10 to 15 minutes.
7) After centrifugation is completed, the centrifuge is removed and the filter cup is separated from the lower filtrate collection cup.
8) The filter cup was inverted over the sample collection cup.
9) The centrifugal force does not exceed 1000g and the time is 2 minutes. Too high a rotational speed can result in loss of sample. The centrifuge cup is removed from the sample collection cup. The sample in the sample collecting cup is virus concentrated solution.
10) Removing the virus concentrated solution, subpackaging and storing in a virus tube, and storing at-80 ℃ for a long time. One of the branches was used for virus biological titer determination and virus titer was quantitatively characterized by ELISA p 24.
3. Mouse fundus retina injection
Three mice were used as experimental groups and numbered individually as mouse A, B, C, and one eyeball of each mouse was used as a control without virus injection and the other side was injected with virus.
The method for injecting the subretinal space comprises the following steps:
1) after preparation of the corresponding experimental article, mice were anesthetized with 1% atropine mydriasis followed by intraperitoneal injection of 80mg/kg ketamine +8mg/kg xylazine.
2) After anaesthesia, the pupils were again mydriatic, and then the mice were placed in front of the animal experiment platform of the eye surgery microscope, and 0.5% proparacaine local anesthetic was dropped on the eyeballs of the mice.
3) The method comprises the following steps of (1) dividing by 100: 1 concentration 400ng of p24 virus was added to stock solution of sodium fluorescein, which was pipetted and mixed with a pipette, taking care that no air bubbles were present. 4) An insulin needle is used for pre-pricking a small hole on the flat part of a ciliary body of a mouse eyeball, a needle head of a micro syringe penetrates through the small hole and then enters the vitreous cavity of the mouse eyeball, at the moment, a proper amount of 2% hydroxymethyl cellulose is dripped on the mouse eyeball so that the eyeground of the mouse can be clearly seen under a microscope, the needle head is continuously inserted into the retina at the opposite side periphery by avoiding a crystalline lens, a virus with fluorescein sodium is slowly pushed in, the injection amount of each eye is 1 mu l, and the fluorescein sodium is used as an indicator to judge whether the virus is injected into the lower cavity of the retina.
5) After operation, the mouse is observed whether the mouse is abnormal or not, the surface of an eyeball is cleaned by normal saline, the mouse is placed in a cage and the like for anesthesia and revival, and the neomycin eye ointment can be given according to the condition of the mouse to prevent infection.
4. Detection of the amount of RPGR gene expression
After 2 weeks, taking the mouse A to detect the RPGR protein expression in the retinal cells; the method comprises the following specific steps:
1) taking mouse eyeballs, separating retinal cells, dividing the retinal cells into two parts, extracting total protein from one part of sample, and extracting RNA from the other part of sample;
2) reverse transcription of RNA to obtain cDNA, and detecting the RPGR gene expression quantity by using an RT-PCR method;
the detection primers of the RPGR gene used were:
RPGR-F3：TGGCG ACTTT TCTGC CGTAT(SEQ ID NO.21)；
RPGR-R3：AATCT GGTTC CTCTG GCTGC(SEQ ID NO.22)；
as shown in FIG. 4, it can be seen from FIG. 4 that the cDNA amplification product of RPGR (258bp) was observed in the non-injected virus group (indicated as "mock" in FIG. 4), while the injected virus group (indicated as "+ virus" in FIG. 4) had no band.
3) Detecting the expression level of the RPGR protein by using a Western Blot method on the extracted total protein of the mouse retinal cells; alpha-actin (actin) is used as an internal reference;
the results of the detection are shown in FIG. 5. As can be seen from FIG. 5, normal expression of RPGR protein was observed in the non-injected virus group (indicated by "mock" in FIG. 5), while expression of RPGR protein was significantly reduced in the injected virus group (indicated by "+ virus" in FIG. 5). Fig. 4 and 5 illustrate that sgRNA2 exerts a gene knockout function in the mouse eyeball, and the RPGR gene was successfully knocked out.
5. Detection of cas9 and RPGR Gene expression levels
After detecting that the RPGR gene is knocked out, injecting 100IU IFN-beta into the fundus retina of the mouse B to induce Cre recombinase expression; mouse C was not injected with IFN- β, as a control.
After 1 week, the sequence between two LoxP sequences in retinal cells was detected by PCR as follows:
1) separating retina cells from eyeballs of a mouse B and a mouse C, dividing the retina cells into two parts, extracting total protein from one part of sample, and extracting RNA from the other part of sample;
2) carrying out reverse transcription on the RNA to obtain cDNA, and detecting the expression quantity of cas9 and RPGR genes by using an RT-PCR method;
the primers used to detect cas9 were the same as in example 1: cas9-F2(SEQ ID NO.16) and cas9-R2(SEQ ID NO.17)
The primers used to detect RPGR were as described above: RPGR-F3(SEQ ID NO.21) and RPGR-R3(SEQ ID NO. 22).
As shown in FIG. 6, it can be seen from FIG. 6 that the amplification products of the cDNA of RPGR (258bp) were observed without inducing the injection of virus (denoted as "-virus" in FIG. 6) or without inducing IFN- β, and the PCR products of cas9(935bp) were not observed.
Whereas the injected virus group (indicated as "+ virus" in FIG. 6), with or without IFN- β induction, had no cDNA amplification product of RPGR (258 bp); PCR products of cas9(935bp) were visible without IFN- β induction; after IFN induction, the PCR product without cas9 was obtained, i.e. cas9 was successfully cleared after IFN induction.
3) Detecting the expression level of cas9 and RPGR protein by using a Western Blot method on the extracted total protein of the mouse retinal cells, and respectively developing color by using endogenous antibodies alpha-RPGR of the RPGR and labeled antibodies anti-HA of cas 9; alpha-actin (actin) is used as an internal reference;
as shown in FIG. 7, it can be seen from FIG. 7 that the RPGR protein was normally expressed and cas9 protein was not expressed in neither the virus-injected group (indicated as "-viruses" in FIG. 7) nor the IFN- β induced the gene expression.
While the expression of RPGR was significantly reduced in the group of injected viruses (indicated as "+ viruses" in FIG. 7), with or without IFN- β induction; expression of cas9 protein was observed without IFN- β induction; after IFN induction, the expression of cas9 protein is not seen, namely after IFN induction, cas9 is successfully knocked out.
Fig. 6 and fig. 7 show that, in mouse eyeball, after IFN induction, Cre-Loxp system is initiated to successfully knock out the functional element between the upstream Loxp sequence and the downstream homonymous Loxp sequence, which can completely avoid excessive shearing of cell genome or immune response by Cre-Loxp system and CRISPR-Cas9 system.
Example 3
1. A vector, designated pCDH-MSCV-sa-sgRNA1-Cre2 in the practice of the present invention, has the same structure as in example 1 except that the inducible promoter is different.
In this example, the inducible promoter used was TRE, the sequence of which is shown in SEQ ID NO. 23.
The construction steps are as described in example 1, except that a synthetic "TRE (SEQ ID NO.23) -Cre (SEQ ID NO.8) -downstream LoxP (SEQ ID NO. 9)" element is ligated into the linearized pCDH-MSCV-LoxP-CMV-sacAS9-U6-sgRNA1 plasmid, and the resulting vector is named as pCDH-MSCV-sa-sgRNA1-Cre2 vector.
The pCDH-MSCV-sa-sgRNA1-Cre2 vector was transfected into 293T cells to detect the knock-out effect of p53, the experimental procedure was the same as that of example 1, and the results are shown in FIG. 8.
In FIG. 8, the genomes of the control 293T not transfected with pCDH-MSCV-sa-sgRNA1-Cre2 vector and 293T cells transfected with pCDH-MSCV-sa-sgRNA1-Cre2 vector were extracted, and the copy number of p53 in the genome was detected using the detection primers p53-F1 and p53-R1 in example 1. mock represents a control 293T cell group, sg1 represents the 293T cell group transfected with pCDH-MSCV-sa-sgRNA1-Cre2 plasmid, the control group can see 717bp of gene product of wild type p53, and no specific strip is generated at the corresponding position of 293T cell transfected with pCDH-MSCV-sa-sgRNA1-Cre2 vector. Indicating that the p53 gene was knocked out.
After detecting that the p53 gene is knocked out, preparing two disks of control 293T of a pCDH-MSCV-sa-sgRNA1-Cre2 vector and 293T cells transfected with a pCDH-MSCV-sa-sgRNA1-Cre2 vector, adding a final concentration of 1 mu g/ml or no Doxylcline (Dox) to induce Cre recombinase expression, and extracting a genome after 72 hours; the copy number of Cas9 is detected by using Cas9 detection primers Cas9-F2 and Cas9-R2, and the result is shown in FIG. 9; meanwhile, extracting total cell protein after 72h, detecting the expression level of cas9 protein by using a Western Blot method, and developing by using a tag antibody anti-HA of cas 9; the results are shown in FIG. 10, using α -actin (actin) as an internal control.
As can be seen from FIG. 9, the control 293T (represented by mock) which was not transfected with pCDH-MSCV-sa-sgRNA1-Cre2 vector had no PCR product of Cas9, regardless of the addition of Doxylcline (Dox); when 293T cells (shown by sg1 in the figure) transfected with pCDH-MSCV-sa-sgRNA1-Cre2 vectors are not induced by adding Dox, PCR products of Cas9 are added, and specific bands without Cas9 at corresponding positions of a Dox group are added, so that after Dox induction is added, a Cre-LoxP system exerts a gene knockout function, and Cas9 genes are successfully knocked out.
As can be seen from FIG. 10, the control 293T (represented by mock) which was not transfected with pCDH-MSCV-sa-sgRNA1-Cre2 vector had no cas9 protein expression regardless of the addition of Doxylcline (Dox); when 293T cells (shown as sg1 in the figure) transfected with pCDH-MSCV-sa-sgRNA1-Cre2 vectors are not induced by adding Dox, cas9 protein is expressed, while cas9 protein is not detected when Dox groups are added, which indicates that after Dox induction is added, a Cre-LoxP system exerts a gene knockout function, a cas9 gene is successfully knocked out, and no cas9 protein is expressed.
Example 4
1. A vector, designated pCDH-MSCV-sa-sgRNA1-Cre3 in the practice of the present invention, was constructed as in example 1, differing only in the LoxP sequence.
In this example, the upstream LoxP-2 sequence used was: ATAAC TTCGT ATAAT GTATG CTATA CGAAG TTAT (SEQ ID NO. 24);
the downstream LoxP-2 sequence is: ATAAC TTCGT ATAAT GTATG CTATA CGAAG TTAT (SEQ ID NO. 25).
Construction of the lentiviral shuttle plasmid pCDH-MSCV-sa-sgRNA1-Cre3 was performed on the basis of the pCDH-MSCV-MCS-EF1-copGFP vector and pCDH-MSCV-sa-sgRNA1-Cre vector in example 1. The construction method comprises the following steps:
1) the pCDH-MSCV-MCS-EF1-copGFP vector is cut by restriction enzymes AgeI and KpnI to obtain a linearized plasmid.
2) The element of "CMV-sacAS 9-bGH polyA-U6-sgRNA1-Mx 1-Cre" is obtained by PCR amplification on a pCDH-MSCV-sa-sgRNA1-Cre vector, wherein the upstream and downstream primers used for amplification respectively comprise upstream and downstream LoxP-2 sequences, and the upstream and downstream primers are respectively as follows:
LoxP-2-Cas9-F：
TCTTGAAAGGAGTGGGAATTCTCGAGGCGTTATAACTTCGTATAATGTATGCTATACGAAGTTATGACATTGATTATTGACTAGT(SEQ ID NO.26)；
Cre-loxP-2-R：
GGAGTGAATTAGCCCTTCCAATAACTTCGTATAGCATACATTATACGAAGTTATCTAATCGCCATCTTCCAGCA (SEQ ID NO. 27); the amplified product is represented by "LoxP 2-CMV-sacAS9-bGH polyA-U6-sgRNA1-Mx1-Cre-LoxP 2".
3) The PCR product "LoxP 2-CMV-sacAS9-bGH polyA-U6-sgRNA1-Mx1-Cre-LoxP 2" was ligated into the linearized pCDH-MSCV-MCS-EF1-copGFP plasmid by a homologous recombination method, and the resulting plasmid was named pCDH-MSCV-sa-sgRNA1-Cre 3.
The pCDH-MSCV-sa-sgRNA1-Cre3 vector was transfected into 293T cells to detect the knock-out effect of p53, the experimental procedure was the same as that of example 1, and the results are shown in FIG. 11.
In FIG. 11, genomes of control 293T not transfected with pCDH-MSCV-sa-sgRNA1-Cre3 vector and 293T cells transfected with pCDH-MSCV-sa-sgRNA1-Cre3 vector were extracted, and copy number of p53 in the genome was detected using detection primers p53-F1 and p53-R1 in example 1. mock represents a control 293T cell group, sg1 represents the 293T cell group transfected with pCDH-MSCV-sa-sgRNA1-Cre3 plasmid, the control group can see 717bp of gene product of wild type p53, and no specific strip is generated at the corresponding position of 293T cell transfected with pCDH-MSCV-sa-sgRNA1-Cre3 vector. Indicating that the p53 gene was knocked out.
After detecting that the p53 gene is knocked out, preparing two disks of control 293T of a vector which is not transfected with pCDH-MSCV-sa-sgRNA1-Cre3 and 293T cells transfected with a vector which is transfected with pCDH-MSCV-sa-sgRNA1-Cre3 respectively, adding 500IU or not adding recombinant IFN-beta to induce Cre recombinase expression, and extracting a genome after 72 hours; the copy number of Cas9 is detected by using Cas9 detection primers Cas9-F2 and Cas9-R2, and the result is shown in FIG. 12; meanwhile, extracting total cell protein after 72h, detecting the expression level of cas9 protein by using a Western Blot method, and developing by using a tag antibody anti-HA of cas 9; the results are shown in FIG. 13, using α -actin (actin) as an internal control.
As can be seen from FIG. 12, when the 293T cell transfected with pCDH-MSCV-sa-sgRNA1-Cre3 vector is not induced by IFN- β, the PCR product of Cas9 is obtained, and a specific band without Cas9 is added to the corresponding position of IFN- β group, which indicates that after IFN- β induction is added, the Cre-LoxP system exerts a gene knockout function and successfully knocks out the Cas9 gene.
As can be seen from FIG. 13, the control 293T (represented by mock in the figure) which is not transfected with pCDH-MSCV-sa-sgRNA1-Cre3 vector is not induced by IFN- β, and has no cas9 protein expression; 293T cells (shown as sg1 in the figure) transfected with pCDH-MSCV-sa-sgRNA1-Cre3 vectors have cas9 protein expression when not being induced by IFN-beta, and cas9 protein is not detected when IFN-beta groups are added, which indicates that after IFN-beta induction is added, a Cre-LoxP system exerts a gene knockout function, a cas9 gene is successfully knocked out, and no cas9 protein expression exists.
Example 5
1. One vector, designated pCDH-MSCV-sa-sgRNA1-Cre4 in the practice of the present invention, differs from the lentiviral shuttle vector of example 1 only in the LoxP sequence.
In this example, the upstream LoxP-3 sequence used was: ATAACTTCGTATA GGGTAGGC TATACGAAGTTAT (SEQ ID NO. 28);
the downstream LoxP-3 sequence is: ATAACTTCGTATA GGGTAGGC TATACGAAGTTAT (SEQ ID NO. 29).
Construction of the lentiviral shuttle plasmid pCDH-MSCV-sa-sgRNA1-Cre4 was performed on the basis of the pCDH-MSCV-MCS-EF1-copGFP vector and pCDH-MSCV-sa-sgRNA1-Cre vector in example 1. The construction method comprises the following steps:
1) the pCDH-MSCV-MCS-EF1-copGFP vector is cut by restriction enzymes AgeI and KpnI to obtain a linearized plasmid.
2) The element of "CMV-sacAS 9-bGH polyA-U6-sgRNA1-Mx 1-Cre" is obtained by PCR amplification on a pCDH-MSCV-sa-sgRNA1-Cre vector, wherein the upstream and downstream primers used for amplification respectively comprise upstream and downstream LoxP-3 sequences, and the upstream and downstream primers are respectively as follows:
LoxP-3-Cas9-F：
GTGGGAATTCTCGAGGCGTTATAACTTCGTATAGGGTAGGCTATACGAAGTTATGACATTGATTATTGACTAGT(SEQ ID NO.30)；
Cre-loxP-3-R：
GGAGTGAATTAGCCCTTCCAATAACTTCGTATAGCCTACCCTATACGAAGTTATCTAATCGCCATCTTCCAGCA (SEQ ID NO. 31); the amplified product is represented by "LoxP 3-CMV-sacAS9-bGH polyA-U6-sgRNA1-Mx1-Cre-LoxP 3". .
3) The PCR product "LoxP 3-CMV-sacAS9-bGH polyA-U6-sgRNA1-Mx1-Cre-LoxP 3" was ligated into the linearized pCDH-MSCV-MCS-EF1-copGFP plasmid by a homologous recombination method, and the resulting plasmid was named pCDH-MSCV-sa-sgRNA1-Cre 4.
The pCDH-MSCV-sa-sgRNA1-Cre4 vector was transfected into 293T cells to detect the knock-out effect of p53, the experimental procedure was the same as that of example 1, and the results are shown in FIG. 14.
In FIG. 14, genomes of control 293T not transfected with pCDH-MSCV-sa-sgRNA1-Cre4 vector and 293T cells transfected with pCDH-MSCV-sa-sgRNA1-Cre4 vector were extracted, and copy number of p53 in the genome was detected using detection primers p53-F1 and p53-R1 in example 1. mock represents a control 293T cell group, sg1 represents the 293T cell group transfected with pCDH-MSCV-sa-sgRNA1-Cre4 plasmid, the control group can see 717bp of gene product of wild type p53, and no specific strip is generated at the corresponding position of 293T cell transfected with pCDH-MSCV-sa-sgRNA1-Cre4 vector. Indicating that the p53 gene was knocked out.
After detecting that the p53 gene is knocked out, preparing two disks of control 293T of a vector which is not transfected with pCDH-MSCV-sa-sgRNA1-Cre4 and 293T cells transfected with a vector which is transfected with pCDH-MSCV-sa-sgRNA1-Cre4 respectively, adding 500IU or not adding recombinant IFN-beta to induce Cre recombinase expression, and extracting a genome after 72 hours; the copy number of Cas9 is detected by using Cas9 detection primers Cas9-F2 and Cas9-R2, and the result is shown in FIG. 15; meanwhile, extracting total cell protein after 72h, detecting the expression level of cas9 protein by using a Western Blot method, and developing by using a tag antibody anti-HA of cas 9; the results are shown in FIG. 16, using α -actin (actin) as an internal control.
As can be seen from FIG. 15, when the 293T cell transfected with pCDH-MSCV-sa-sgRNA1-Cre4 vector is not induced by IFN- β, the PCR product of Cas9 is obtained, and a specific band without Cas9 is added to the corresponding position of IFN- β group, which indicates that after IFN- β induction is added, the Cre-LoxP system exerts a gene knockout function and successfully knocks out the Cas9 gene.
As can be seen from FIG. 16, the control 293T (represented by mock in the figure) which is not transfected with pCDH-MSCV-sa-sgRNA1-Cre3 vector is not induced by IFN- β, and has no cas9 protein expression; 293T cells (shown as sg1 in the figure) transfected with pCDH-MSCV-sa-sgRNA1-Cre3 vectors have cas9 protein expression when not being induced by IFN-beta, and cas9 protein is not detected when IFN-beta groups are added, which indicates that after IFN-beta induction is added, a Cre-LoxP system exerts a gene knockout function, a cas9 gene is successfully knocked out, and no cas9 protein expression exists.
Example 6
1. A vector, referred to in the practice of the invention as FG12-sa-sgRNA1-Cre2, which is: a vector with the following functional elements inserted into the multiple cloning site of a lentivirus shuttle plasmid (model number FG12, Addgene #14884), wherein the functional elements comprise from 5 'to 3':
an upstream LoxP sequence, sacAS9 protein, a bGH polyA sequence, a U6 promoter, a sgRNA sequence, a TRE promoter, a Cre recombinase and a homodromous LoxP sequence; a schematic diagram of which is shown in fig. 17.
Wherein the sequence of each element: the upstream LoxP sequence, sacAS9 protein, bGH polyA sequence, U6 promoter, sgRNA sequence, Cre recombinase and homodromous LoxP sequence are the same as in example 1;
the TRE promoter sequence is shown as SEQ ID NO. 23.
The construction of the lentiviral shuttle plasmid FG12-sa-sgRNA1-Cre2 is completed on the basis of FG12 vector (Addgene #14884) and pCDH-MSCV-sa-sgRNA1-Cre2 vector. The construction method comprises the following steps:
1) the FG12 vector was digested with restriction enzymes XhoI and BsrGI to give a linearized plasmid.
2) The element "CMV-sacAS 9-bGH polyA-U6-sgRNA 1-TRE-Cre" is obtained by PCR amplification from a pCDH-MSCV-sa-sgRNA1-Cre2 vector, wherein an upstream primer and a downstream primer used for amplification respectively comprise an upstream LoxP sequence and a downstream LoxP sequence, and the primer sequences are as follows:
FG12-loxP-2-Cas9-F：
AGTTAACATCTCGAGGCGTTATAACTTCGTATAGCATACATTATACGAAGTTATGACATTGATTATTGACTAGT(SEQ ID NO.32)；
FG12-Cre-loxP-2-R：
GGACTAGAGTCGCGGCCGCTATAACTTCGTATAATGTATGCTATACGAAGTTATCTAATCGCCATCTTCCAGCA (SEQ ID NO. 33); the amplified product is expressed as "LoxP-CMV-sacAS 9-bGH polyA-U6-sgRNA 1-TRE-Cre-LoxP".
3) The PCR product "LoxP-CMV-sacAS 9-bGH polyA-U6-sgRNA 1-TRE-Cre-LoxP" is connected into a linearized FG12 vector by using a homologous recombination method, and the obtained vector is named as FG12-sa-sgRNA1-Cre2 vector.
The FG12-sa-sgRNA1-Cre2 vector was transfected into 293T cells to detect the knock-out effect of p53, and the experimental procedure was the same as that of example 1, and the results are shown in FIG. 18.
In FIG. 18, the genomes of control 293T cells not transfected with FG12-sa-sgRNA1-Cre2 vector and 293T cells transfected with FG12-sa-sgRNA1-Cre2 vector were extracted, and the copy number of p53 in the genome was determined using the detection primers p53-F1 and p53-R1 in example 1. mock represents a control 293T cell group, sg1 represents the 293T cell group transfected with FG12-sa-sgRNA1-Cre2 plasmid, the control group can see 717bp of gene product of wild p53, and no specific band is positioned corresponding to the 293T cell transfected with FG12-sa-sgRNA1-Cre2 vector. Indicating that the p53 gene was knocked out.
After detecting that the p53 gene is knocked out, preparing two disks for 293T cells transfected with FG12-sa-sgRNA1-Cre2 vectors, respectively adding 1 mu g/ml or Doxyclline (Dox) at the final concentration to induce Cre recombinase expression, and extracting a genome after 72 hours; cas9 detection primers Cas9-F2 and Cas9-R2 are used for detecting the copy number of Cas9, and the results are shown in FIG. 19.
As can be seen from FIG. 19, when the 293T cell transfected with FG12-sa-sgRNA1-Cre2 vector is not induced by Dox, the PCR product of Cas9 is obtained, and a specific band without Cas9 is added to the corresponding position of the Dox group, so that the Cre-LoxP system exerts a gene knockout function and successfully knocks out the Cas9 gene after Dox induction is added.
In the examples given in the present invention, Cas9 protein can be saCas9, spCas9, ascipf 1, Cjcas9, NmCas9, St1Cas9, TdCas 9. The Cre recombinase may be Escherichia virus P1Cre recombinase, Sphingomonas sp.ERG5 Cre recombinase, or Salmonella phasege SJ46 Cre recombinase. The Cre-LoxP system may also be replaced by a Flp-FRT system. The skilled person can select different enzymes according to the actual need. The present invention can be carried out using different enzymes for the present invention.
Finally, it should be noted that: the above examples are only intended to illustrate the technical solution of the present invention, but not to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some technical features may be equivalently replaced; and such modifications or substitutions do not depart from the spirit and scope of the corresponding technical solutions of the embodiments of the present invention.
SEQUENCE LISTING
<110> Zhongjing science and technology Co., Ltd
<120> novel CRISPR-Cas9 system vector and application thereof
<130> 190300F
<160> 33
<170> PatentIn version 3.5
<210> 1
<211> 34
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 1
ataacttcgt atagcataca ttatacgaag ttat 34
<210> 2
<211> 21
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 2
agcaaagttt tattgtaaaa t 21
<210> 3
<211> 1085
<212> PRT
<213> Staphylococcus aureus
<400> 3
Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
1 5 10 15
Ala Lys Arg Asn Tyr Ile Leu Gly Leu Asp Ile Gly Ile Thr Ser Val
20 25 30
Gly Tyr Gly Ile Ile Asp Tyr Glu Thr Arg Asp Val Ile Asp Ala Gly
35 40 45
Val Arg Leu Phe Lys Glu Ala Asn Val Glu Asn Asn Glu Gly Arg Arg
50 55 60
Ser Lys Arg Gly Ala Arg Arg Leu Lys Arg Arg Arg Arg His Arg Ile
65 70 75 80
Gln Arg Val Lys Lys Leu Leu Phe Asp Tyr Asn Leu Leu Thr Asp His
85 90 95
Ser Glu Leu Ser Gly Ile Asn Pro Tyr Glu Ala Arg Val Lys Gly Leu
100 105 110
Ser Gln Lys Leu Ser Glu Glu Glu Phe Ser Ala Ala Leu Leu His Leu
115 120 125
Ala Lys Arg Arg Gly Val His Asn Val Asn Glu Val Glu Glu Asp Thr
130 135 140
Gly Asn Glu Leu Ser Thr Lys Glu Gln Ile Ser Arg Asn Ser Lys Ala
145 150 155 160
Leu Glu Glu Lys Tyr Val Ala Glu Leu Gln Leu Glu Arg Leu Lys Lys
165 170 175
Asp Gly Glu Val Arg Gly Ser Ile Asn Arg Phe Lys Thr Ser Asp Tyr
180 185 190
Val Lys Glu Ala Lys Gln Leu Leu Lys Val Gln Lys Ala Tyr His Gln
195 200 205
Leu Asp Gln Ser Phe Ile Asp Thr Tyr Ile Asp Leu Leu Glu Thr Arg
210 215 220
Arg Thr Tyr Tyr Glu Gly Pro Gly Glu Gly Ser Pro Phe Gly Trp Lys
225 230 235 240
Asp Ile Lys Glu Trp Tyr Glu Met Leu Met Gly His Cys Thr Tyr Phe
245 250 255
Pro Glu Glu Leu Arg Ser Val Lys Tyr Ala Tyr Asn Ala Asp Leu Tyr
260 265 270
Asn Ala Leu Asn Asp Leu Asn Asn Leu Val Ile Thr Arg Asp Glu Asn
275 280 285
Glu Lys Leu Glu Tyr Tyr Glu Lys Phe Gln Ile Ile Glu Asn Val Phe
290 295 300
Lys Gln Lys Lys Lys Pro Thr Leu Lys Gln Ile Ala Lys Glu Ile Leu
305 310 315 320
Val Asn Glu Glu Asp Ile Lys Gly Tyr Arg Val Thr Ser Thr Gly Lys
325 330 335
Pro Glu Phe Thr Asn Leu Lys Val Tyr His Asp Ile Lys Asp Ile Thr
340 345 350
Ala Arg Lys Glu Ile Ile Glu Asn Ala Glu Leu Leu Asp Gln Ile Ala
355 360 365
Lys Ile Leu Thr Ile Tyr Gln Ser Ser Glu Asp Ile Gln Glu Glu Leu
370 375 380
Thr Asn Leu Asn Ser Glu Leu Thr Gln Glu Glu Ile Glu Gln Ile Ser
385 390 395 400
Asn Leu Lys Gly Tyr Thr Gly Thr His Asn Leu Ser Leu Lys Ala Ile
405 410 415
Asn Leu Ile Leu Asp Glu Leu Trp His Thr Asn Asp Asn Gln Ile Ala
420 425 430
Ile Phe Asn Arg Leu Lys Leu Val Pro Lys Lys Val Asp Leu Ser Gln
435 440 445
Gln Lys Glu Ile Pro Thr Thr Leu Val Asp Asp Phe Ile Leu Ser Pro
450 455 460
Val Val Lys Arg Ser Phe Ile Gln Ser Ile Lys Val Ile Asn Ala Ile
465 470 475 480
Ile Lys Lys Tyr Gly Leu Pro Asn Asp Ile Ile Ile Glu Leu Ala Arg
485 490 495
Glu Lys Asn Ser Lys Asp Ala Gln Lys Met Ile Asn Glu Met Gln Lys
500 505 510
Arg Asn Arg Gln Thr Asn Glu Arg Ile Glu Glu Ile Ile Arg Thr Thr
515 520 525
Gly Lys Glu Asn Ala Lys Tyr Leu Ile Glu Lys Ile Lys Leu His Asp
530 535 540
Met Gln Glu Gly Lys Cys Leu Tyr Ser Leu Glu Ala Ile Pro Leu Glu
545 550 555 560
Asp Leu Leu Asn Asn Pro Phe Asn Tyr Glu Val Asp His Ile Ile Pro
565 570 575
Arg Ser Val Ser Phe Asp Asn Ser Phe Asn Asn Lys Val Leu Val Lys
580 585 590
Gln Glu Glu Asn Ser Lys Lys Gly Asn Arg Thr Pro Phe Gln Tyr Leu
595 600 605
Ser Ser Ser Asp Ser Lys Ile Ser Tyr Glu Thr Phe Lys Lys His Ile
610 615 620
Leu Asn Leu Ala Lys Gly Lys Gly Arg Ile Ser Lys Thr Lys Lys Glu
625 630 635 640
Tyr Leu Leu Glu Glu Arg Asp Ile Asn Arg Phe Ser Val Gln Lys Asp
645 650 655
Phe Ile Asn Arg Asn Leu Val Asp Thr Arg Tyr Ala Thr Arg Gly Leu
660 665 670
Met Asn Leu Leu Arg Ser Tyr Phe Arg Val Asn Asn Leu Asp Val Lys
675 680 685
Val Lys Ser Ile Asn Gly Gly Phe Thr Ser Phe Leu Arg Arg Lys Trp
690 695 700
Lys Phe Lys Lys Glu Arg Asn Lys Gly Tyr Lys His His Ala Glu Asp
705 710 715 720
Ala Leu Ile Ile Ala Asn Ala Asp Phe Ile Phe Lys Glu Trp Lys Lys
725 730 735
Leu Asp Lys Ala Lys Lys Val Met Glu Asn Gln Met Phe Glu Glu Lys
740 745 750
Gln Ala Glu Ser Met Pro Glu Ile Glu Thr Glu Gln Glu Tyr Lys Glu
755 760 765
Ile Phe Ile Thr Pro His Gln Ile Lys His Ile Lys Asp Phe Lys Asp
770 775 780
Tyr Lys Tyr Ser His Arg Val Asp Lys Lys Pro Asn Arg Glu Leu Ile
785 790 795 800
Asn Asp Thr Leu Tyr Ser Thr Arg Lys Asp Asp Lys Gly Asn Thr Leu
805 810 815
Ile Val Asn Asn Leu Asn Gly Leu Tyr Asp Lys Asp Asn Asp Lys Leu
820 825 830
Lys Lys Leu Ile Asn Lys Ser Pro Glu Lys Leu Leu Met Tyr His His
835 840 845
Asp Pro Gln Thr Tyr Gln Lys Leu Lys Leu Ile Met Glu Gln Tyr Gly
850 855 860
Asp Glu Lys Asn Pro Leu Tyr Lys Tyr Tyr Glu Glu Thr Gly Asn Tyr
865 870 875 880
Leu Thr Lys Tyr Ser Lys Lys Asp Asn Gly Pro Val Ile Lys Lys Ile
885 890 895
Lys Tyr Tyr Gly Asn Lys Leu Asn Ala His Leu Asp Ile Thr Asp Asp
900 905 910
Tyr Pro Asn Ser Arg Asn Lys Val Val Lys Leu Ser Leu Lys Pro Tyr
915 920 925
Arg Phe Asp Val Tyr Leu Asp Asn Gly Val Tyr Lys Phe Val Thr Val
930 935 940
Lys Asn Leu Asp Val Ile Lys Lys Glu Asn Tyr Tyr Glu Val Asn Ser
945 950 955 960
Lys Cys Tyr Glu Glu Ala Lys Lys Leu Lys Lys Ile Ser Asn Gln Ala
965 970 975
Glu Phe Ile Ala Ser Phe Tyr Asn Asn Asp Leu Ile Lys Ile Asn Gly
980 985 990
Glu Leu Tyr Arg Val Ile Gly Val Asn Asn Asp Leu Leu Asn Arg Ile
995 1000 1005
Glu Val Asn Met Ile Asp Ile Thr Tyr Arg Glu Tyr Leu Glu Asn
1010 1015 1020
Met Asn Asp Lys Arg Pro Pro Arg Ile Ile Lys Thr Ile Ala Ser
1025 1030 1035
Lys Thr Gln Ser Ile Lys Lys Tyr Ser Thr Asp Ile Leu Gly Asn
1040 1045 1050
Leu Tyr Glu Val Lys Ser Lys Lys His Pro Gln Ile Ile Lys Lys
1055 1060 1065
Gly Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala Lys Lys
1070 1075 1080
Lys Lys
1085
<210> 4
<211> 3255
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 4
atggccccaa agaagaagcg gaaggtcggt atccacggag tcccagcagc caagcggaac 60
tacatcctgg gcctggacat cggcatcacc agcgtgggct acggcatcat cgactacgag 120
acacgggacg tgatcgatgc cggcgtgcgg ctgttcaaag aggccaacgt ggaaaacaac 180
gagggcaggc ggagcaagag aggcgccaga aggctgaagc ggcggaggcg gcatagaatc 240
cagagagtga agaagctgct gttcgactac aacctgctga ccgaccacag cgagctgagc 300
ggcatcaacc cctacgaggc cagagtgaag ggcctgagcc agaagctgag cgaggaagag 360
ttctctgccg ccctgctgca cctggccaag agaagaggcg tgcacaacgt gaacgaggtg 420
gaagaggaca ccggcaacga gctgtccacc aaagagcaga tcagccggaa cagcaaggcc 480
ctggaagaga aatacgtggc cgaactgcag ctggaacggc tgaagaaaga cggcgaagtg 540
cggggcagca tcaacagatt caagaccagc gactacgtga aagaagccaa acagctgctg 600
aaggtgcaga aggcctacca ccagctggac cagagcttca tcgacaccta catcgacctg 660
ctggaaaccc ggcggaccta ctatgaggga cctggcgagg gcagcccctt cggctggaag 720
gacatcaaag aatggtacga gatgctgatg ggccactgca cctacttccc cgaggaactg 780
cggagcgtga agtacgccta caacgccgac ctgtacaacg ccctgaacga cctgaacaat 840
ctcgtgatca ccagggacga gaacgagaag ctggaatatt acgagaagtt ccagatcatc 900
gagaacgtgt tcaagcagaa gaagaagccc accctgaagc agatcgccaa agaaatcctc 960
gtgaacgaag aggatattaa gggctacaga gtgaccagca ccggcaagcc cgagttcacc 1020
aacctgaagg tgtaccacga catcaaggac attaccgccc ggaaagagat tattgagaac 1080
gccgagctgc tggatcagat tgccaagatc ctgaccatct accagagcag cgaggacatc 1140
caggaagaac tgaccaatct gaactccgag ctgacccagg aagagatcga gcagatctct 1200
aatctgaagg gctataccgg cacccacaac ctgagcctga aggccatcaa cctgatcctg 1260
gacgagctgt ggcacaccaa cgacaaccag atcgctatct tcaaccggct gaagctggtg 1320
cccaagaagg tggacctgtc ccagcagaaa gagatcccca ccaccctggt ggacgacttc 1380
atcctgagcc ccgtcgtgaa gagaagcttc atccagagca tcaaagtgat caacgccatc 1440
atcaagaagt acggcctgcc caacgacatc attatcgagc tggcccgcga gaagaactcc 1500
aaggacgccc agaaaatgat caacgagatg cagaagcgga accggcagac caacgagcgg 1560
atcgaggaaa tcatccggac caccggcaaa gagaacgcca agtacctgat cgagaagatc 1620
aagctgcacg acatgcagga aggcaagtgc ctgtacagcc tggaagccat ccctctggaa 1680
gatctgctga acaacccctt caactatgag gtggaccaca tcatccccag aagcgtgtcc 1740
ttcgacaaca gcttcaacaa caaggtgctc gtgaagcagg aagaaaacag caagaagggc 1800
aaccggaccc cattccagta cctgagcagc agcgacagca agatcagcta cgaaaccttc 1860
aagaagcaca tcctgaatct ggccaagggc aagggcagaa tcagcaagac caagaaagag 1920
tatctgctgg aagaacggga catcaacagg ttctccgtgc agaaagactt catcaaccgg 1980
aacctggtgg ataccagata cgccaccaga ggcctgatga acctgctgcg gagctacttc 2040
agagtgaaca acctggacgt gaaagtgaag tccatcaatg gcggcttcac cagctttctg 2100
cggcggaagt ggaagtttaa gaaagagcgg aacaaggggt acaagcacca cgccgaggac 2160
gccctgatca ttgccaacgc cgatttcatc ttcaaagagt ggaagaaact ggacaaggcc 2220
aaaaaagtga tggaaaacca gatgttcgag gaaaagcagg ccgagagcat gcccgagatc 2280
gaaaccgagc aggagtacaa agagatcttc atcacccccc accagatcaa gcacattaag 2340
gacttcaagg actacaagta cagccaccgg gtggacaaga agcctaatag agagctgatt 2400
aacgacaccc tgtactccac ccggaaggac gacaagggca acaccctgat cgtgaacaat 2460
ctgaacggcc tgtacgacaa ggacaatgac aagctgaaaa agctgatcaa caagagcccc 2520
gaaaagctgc tgatgtacca ccacgacccc cagacctacc agaaactgaa gctgattatg 2580
gaacagtacg gcgacgagaa gaatcccctg tacaagtact acgaggaaac cgggaactac 2640
ctgaccaagt actccaaaaa ggacaacggc cccgtgatca agaagattaa gtattacggc 2700
aacaaactga acgcccatct ggacatcacc gacgactacc ccaacagcag aaacaaggtc 2760
gtgaagctgt ccctgaagcc ctacagattc gacgtgtacc tggacaatgg cgtgtacaag 2820
ttcgtgaccg tgaagaatct ggatgtgatc aaaaaagaaa actactacga agtgaatagc 2880
aagtgctatg aggaagctaa gaagctgaag aagatcagca accaggccga gtttatcgcc 2940
tccttctaca acaacgatct gatcaagatc aacggcgagc tgtatagagt gatcggcgtg 3000
aacaacgacc tgctgaaccg gatcgaagtg aacatgatcg acatcaccta ccgcgagtac 3060
ctggaaaaca tgaacgacaa gaggcccccc aggatcatta agacaatcgc ctccaagacc 3120
cagagcatta agaagtacag cacagacatt ctgggcaacc tgtatgaagt gaaatctaag 3180
aagcaccctc agatcatcaa aaagggcaaa aggccggcgg ccacgaaaaa ggccggccag 3240
gcaaaaaaga aaaag 3255
<210> 5
<211> 208
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 5
ctgtgccttc tagttgccag ccatctgttg tttgcccctc ccccgtgcct tccttgaccc 60
tggaaggtgc cactcccact gtcctttcct aataaaatga ggaaattgca tcgcattgtc 120
tgagtaggtg tcattctatt ctggggggtg gggtggggca ggacagcaag ggggaggatt 180
gggaagagaa tagcaggcat gctgggga 208
<210> 6
<211> 241
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 6
gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60
ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120
aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180
atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240
c 241
<210> 7
<211> 1704
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 7
cctggatggg taagcagcca tgcaagggtt ccttgataat tgctggagaa gcctgtgttc 60
tcccattaga ctccagcaga gggccccata gaacatgcca gacttcaggc cagggagctg 120
ctctgtgtgg cctcctcccc ttcttttggg tgccaccaca ttgaaattgg ttccatccaa 180
gttttcccga tgtggctgaa gaatgtcacc agccatatca gtagacaaaa gaaattgcag 240
ccatcacgcc agcagccact gcattttttg acctgtgact gtacgtcctt caggggttca 300
ggatgaggaa aagcaggatg ctggccctag acagccaagg tgcacatcaa aggaataatt 360
tcaaggagcc cagactcttg catcttccca tgcatagaat aagtgctgaa ttcatgaact 420
tgggatgtct ggtttttctt taagtaacaa taactttgtt aatattttca ctacctggat 480
tttgttgcaa aaactcctat atgttctggc tcctctctga cctgtttgct gccgtcccta 540
agagcaatct gagaggctgt cttccagggt aagtcctcag caagtccacc aagtaaaata 600
taattctcaa tttttttagg tgtgtagttt ttttttttta aagtcaacat tgtagcccag 660
cacttggaaa aggggcagtt ctgggtcttt gtgtaggggg caggtgaccc tctataacca 720
caggagtctt tgtggggagg atacttgttg tccaggcttc ttagctgagc caaggaggat 780
ggaggtgggc tttccaaaat gaaattttac tcctcatccc caaagccctc cgggagggct 840
catctttggg tctatttgac cttggtcccc cactttctac tcatttccat cctgaagaaa 900
tcaaatgagc taaacttcag ggagggcttg ggacttccct ggtggtccag ggaacctttt 960
gcttccgatt cagggggcac aggtccgatc cctggtcaag aaaccaagat ctcacacgac 1020
atgcagagtg gtcaagagat ttaaaggtgg gtggaggggg cggtgcttga agaggataag 1080
gaaaattgag aaaggagcct gatgtaggtc tgggtgagga gggggctaag ggggtagctc 1140
cctagcatgc ttgagaatcc ctacgggcgc tggaatgttc ccagtgaacc tacagcagaa 1200
gtttgatacc caattatcaa tgcatctgtt caaacaacca aaggttaagg ttagccaggt 1260
tccaagctac cttcggcttt ggatgactcg gggctgcttg agcagaggtt ctcaaactgc 1320
cagaaacttc agaagggccg gataaagctc gggtagctgg gtcctactcc cgagtttctg 1380
gggcagcagg tctgggtgcg ggccgagaat ttgcatttcc cgcaagctcc tagggatgcc 1440
gttggtgcgg ggcgcaccta gagtgcttct gggaggatac agctgagggt gctgggcgca 1500
gcgacctcgg gaggcgccgg tgcgcaagtg cgctacccgt tcgatttggg tttcggtttc 1560
ctttccgatt cagcagccct gaaaactcta cgagtttcgt ttcccagagg ctgggtggga 1620
gatgacggac ggggaggcgg gggcagcgag ctgggggcgg cgctagcgct gcataaagcc 1680
gaggagggcc agcgccggga gccc 1704
<210> 8
<211> 1032
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 8
atgtccaatt tactgaccgt acaccaaaat ttgcctgcat taccggtcga tgcaacgagt 60
gatgaggttc gcaagaacct gatggacatg ttcagggatc gccaggcgtt ttctgagcat 120
acctggaaaa tgcttctgtc cgtttgccgg tcgtgggcgg catggtgcaa gttgaataac 180
cggaaatggt ttcccgcaga acctgaagat gttcgcgatt atcttctata tcttcaggcg 240
cgcggtctgg cagtaaaaac tatccagcaa catttgggcc agctaaacat gcttcatcgt 300
cggtccgggc tgccacgacc aagtgacagc aatgctgttt cactggttat gcggcggatc 360
cgaaaagaaa acgttgatgc cggtgaacgt gcaaaacagg ctctagcgtt cgaacgcact 420
gatttcgacc aggttcgttc actcatggaa aatagcgatc gctgccagga tatacgtaat 480
ctggcatttc tggggattgc ttataacacc ctgttacgta tagccgaaat tgccaggatc 540
agggttaaag atatctcacg tactgacggt gggagaatgt taatccatat tggcagaacg 600
aaaacgctgg ttagcaccgc aggtgtagag aaggcactta gcctgggggt aactaaactg 660
gtcgagcgat ggatttccgt ctctggtgta gctgatgatc cgaataacta cctgttttgc 720
cgggtcagaa aaaatggtgt tgccgcgcca tctgccacca gccagctatc aactcgcgcc 780
ctggaaggga tttttgaagc aactcatcga ttgatttacg gcgctaagga tgactctggt 840
cagagatacc tggcctggtc tggacacagt gcccgtgtcg gagccgcgcg agatatggcc 900
cgcgctggag tttcaatacc ggagatcatg caagctggtg gctggaccaa tgtaaatatt 960
gtcatgaact atatccgtaa cctggatagt gaaacagggg caatggtgcg cctgctggaa 1020
gatggcgatt ag 1032
<210> 9
<211> 34
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 9
ataacttcgt atagcataca ttatacgaag ttat 34
<210> 10
<211> 26
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 10
caccgagcaa agttttattg taaaat 26
<210> 11
<211> 26
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 11
aaacatttta caataaaact ttgctc 26
<210> 12
<211> 85
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 12
tcttgaaagg agtgggaatt ctcgaggcgt tataacttcg tatagcatac attatacgaa 60
gttatgacat tgattattga ctagt 85
<210> 13
<211> 40
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 13
gctaagatct acagctgcct cggccgcaaa aatctcgcca 40
<210> 14
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 14
ggcccacctc ttaccgattt 20
<210> 15
<211> 21
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 15
caggagccat tgtctttgag g 21
<210> 16
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 16
aagagcagat cagccggaac 20
<210> 17
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 17
aagcttctct tcacgacggg 20
<210> 18
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 18
cctttcccat gtactgtttc 20
<210> 19
<211> 25
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 19
caccgccttt cccatgtact gtttc 25
<210> 20
<211> 25
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 20
aaacgaaaca gtacatggga aaggc 25
<210> 21
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 21
tggcgacttt tctgccgtat 20
<210> 22
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 22
aatctggttc ctctggctgc 20
<210> 23
<211> 247
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 23
tccctatcag tgatagagaa cgatgtcgag tttactccct atcagtgata gagaacgtat 60
gtcgagttta ctccctatca gtgatagaga acgtatgtcg agtttactcc ctatcagtga 120
tagagaacgt atgtcgagtt tatccctatc agtgatagag aacgtatgtc gagtttactc 180
cctatcagtg atagagaacg tatgtcgagg taggcgtgta cggtgggagg cctatataag 240
cagagct 247
<210> 24
<211> 34
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 24
ataacttcgt ataatgtatg ctatacgaag ttat 34
<210> 25
<211> 34
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 25
ataacttcgt ataatgtatg ctatacgaag ttat 34
<210> 26
<211> 85
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 26
tcttgaaagg agtgggaatt ctcgaggcgt tataacttcg tataatgtat gctatacgaa 60
gttatgacat tgattattga ctagt 85
<210> 27
<211> 74
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 27
ggagtgaatt agcccttcca ataacttcgt atagcataca ttatacgaag ttatctaatc 60
gccatcttcc agca 74
<210> 28
<211> 34
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 28
ataacttcgt atagggtagg ctatacgaag ttat 34
<210> 29
<211> 34
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 29
ataacttcgt atagggtagg ctatacgaag ttat 34
<210> 30
<211> 74
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 30
gtgggaattc tcgaggcgtt ataacttcgt atagggtagg ctatacgaag ttatgacatt 60
gattattgac tagt 74
<210> 31
<211> 74
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 31
ggagtgaatt agcccttcca ataacttcgt atagcctacc ctatacgaag ttatctaatc 60
gccatcttcc agca 74
<210> 32
<211> 74
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 32
agttaacatc tcgaggcgtt ataacttcgt atagcataca ttatacgaag ttatgacatt 60
gattattgac tagt 74
<210> 33
<211> 74
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 33
ggactagagt cgcggccgct ataacttcgt ataatgtatg ctatacgaag ttatctaatc 60
gccatcttcc agca 74

Claims (10)

1. A carrier comprising the following functional elements thereon in order:
an upstream LoxP sequence, a sgRNA sequence, a Cas9 protein, an inducible promoter, a Cre recombinase and a downstream LoxP sequence in the same direction; wherein the sgRNA sequence and Cas9 protein sequences are interchangeable; the sgRNA sequence targets the gene of interest.
2. The carrier of claim 1, wherein: on the carrier: the sgRNA sequence and the Cas9 protein each also include a constitutive promoter before and a transcription termination element after the Cas9 protein.
3. The carrier of claim 1 or 2, wherein: the upstream LoxP sequence comprises a sequence shown by SEQ ID NO.1 or a complementary sequence thereof, and the downstream LoxP sequence in the same direction comprises a sequence shown by SEQ ID NO.9 or a complementary sequence thereof; or the upstream LoxP sequence comprises a sequence shown in SEQ ID NO.24 or a complementary sequence thereof, and the downstream LoxP sequence comprises a sequence shown in SEQ ID NO.25 or a complementary sequence thereof; or the upstream LoxP sequence comprises a sequence shown by SEQ ID NO.28 or a complementary sequence thereof, and the downstream LoxP sequence comprises a sequence shown by SEQ ID NO.29 or a complementary sequence thereof.
4. The carrier of claim 1 or 2, wherein: inducible promoters include the Mx1, TRE, tTA or ER promoter; alternatively, the inducible promoter comprises the Mx1 or TRE promoter; further alternatively, the Mx1 promoter sequence is shown in SEQ ID NO. 7; the TRE promoter sequence is shown in SEQ ID NO. 23.
5. The carrier of claim 1 or 2, wherein: the sgRNA targets the p53 gene, and further optionally, the sgRNA sequence comprises a sequence shown in SEQ ID No.2 or a complementary sequence of the sequence shown in SEQ ID No. 2;
and/or the sgRNA targets the RPGR gene, further optionally the sgRNA sequence comprises the sequence shown in SEQ ID No.18 or a complement of the sequence shown in SEQ ID No. 18.
6. The carrier of claim 1 or 2, characterized in that: cas9 proteins include saCas9, spCas9, ascipf 1, Cjcas9, NmCas9, St1Cas9 or TdCas 9;
and/or, the Cre recombinase comprises Escherichia virus P1Cre recombinase, Sphingomonas sp.ERG5 Cre recombinase, or Salmonella phage SJ46 Cre recombinase; alternatively, the Cre recombinase comprises Escherichia virus P1Cre recombinase, the coding sequence of which is shown in SEQ ID NO. 8.
7. The carrier of claim 2, wherein: constitutive promoters include CMV, MSCV or U6 promoters;
and/or, the transcription termination element comprises bGH polyA; optionally, the bGH polyA sequence is as shown in SEQ ID No. 5;
and/or, the vector comprises a plasmid; optionally, the vector comprises a viral vector; further optionally, the viral vector comprises a lentiviral vector, a retroviral vector, an adenoviral vector, or an adeno-associated viral vector.
8. A cell comprising the vector of any one of claims 1-7, wherein: the cell comprises human cell, non-human mammal cell and stem cell.
9. A composition comprising the vector of any one of claims 1-7, and a pharmaceutically acceptable excipient.
10. Use of the vector of any one of claims 1-7, the cell of claim 8, the composition of claim 9 for the preparation of a kit for modifying or regulating gene expression or a medicament.
CN202110151816.4A 2021-02-04 2021-02-04 Novel CRISPR-Cas9 system vector and application thereof Pending CN114854791A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110151816.4A CN114854791A (en) 2021-02-04 2021-02-04 Novel CRISPR-Cas9 system vector and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110151816.4A CN114854791A (en) 2021-02-04 2021-02-04 Novel CRISPR-Cas9 system vector and application thereof

Publications (1)

Publication Number Publication Date
CN114854791A true CN114854791A (en) 2022-08-05

Family

ID=82623569

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110151816.4A Pending CN114854791A (en) 2021-02-04 2021-02-04 Novel CRISPR-Cas9 system vector and application thereof

Country Status (1)

Country Link
CN (1) CN114854791A (en)

Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140298498A1 (en) * 2011-08-18 2014-10-02 New York University Inhibition of oncogenic kras-induced gm-csf production and function
CN104419719A (en) * 2013-09-02 2015-03-18 中国农业大学 Method for knocking out selective marker gene of transgenic pig
CN105658805A (en) * 2013-06-05 2016-06-08 杜克大学 Rna-guided gene editing and gene regulation
CN107119067A (en) * 2017-04-25 2017-09-01 华南理工大学 A kind of method of the continuous traceless knockout of gene in Corynebacterium glutamicum
CN107151677A (en) * 2017-03-15 2017-09-12 陕西师范大学 The new method of low transfection efficiency cell line is knocked out based on CRISPR/Cas9 polygenes
CN108732153A (en) * 2017-12-05 2018-11-02 芜湖英特菲尔生物制品产业研究院有限公司 A kind of Bov IFN α biological activity detection methods
US20190085325A1 (en) * 2016-03-17 2019-03-21 Imba - Institut Für Molekulare Biotechnologie Gmbh Conditional crispr sgrna expression
CN109943566A (en) * 2019-03-28 2019-06-28 和元生物技术（上海）股份有限公司 The sgRNAs of selectively targeted YBX1 gene and its application
CN110438160A (en) * 2019-07-18 2019-11-12 浙江大学 A kind of construction method of Cd2ap Gene Knock-Out Animal Model and application
WO2020036445A1 (en) * 2018-08-16 2020-02-20 주식회사 라트바이오 Transgenic animal and transgenic embryo producing artificial nuclease
CN111019971A (en) * 2019-12-19 2020-04-17 上海同科生物科技有限公司 Construction method of mouse model for conditionally overexpressing HPV E6 gene at ROSA26 site

Patent Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140298498A1 (en) * 2011-08-18 2014-10-02 New York University Inhibition of oncogenic kras-induced gm-csf production and function
CN105658805A (en) * 2013-06-05 2016-06-08 杜克大学 Rna-guided gene editing and gene regulation
CN104419719A (en) * 2013-09-02 2015-03-18 中国农业大学 Method for knocking out selective marker gene of transgenic pig
US20190085325A1 (en) * 2016-03-17 2019-03-21 Imba - Institut Für Molekulare Biotechnologie Gmbh Conditional crispr sgrna expression
CN107151677A (en) * 2017-03-15 2017-09-12 陕西师范大学 The new method of low transfection efficiency cell line is knocked out based on CRISPR/Cas9 polygenes
CN107119067A (en) * 2017-04-25 2017-09-01 华南理工大学 A kind of method of the continuous traceless knockout of gene in Corynebacterium glutamicum
CN108732153A (en) * 2017-12-05 2018-11-02 芜湖英特菲尔生物制品产业研究院有限公司 A kind of Bov IFN α biological activity detection methods
WO2020036445A1 (en) * 2018-08-16 2020-02-20 주식회사 라트바이오 Transgenic animal and transgenic embryo producing artificial nuclease
CN109943566A (en) * 2019-03-28 2019-06-28 和元生物技术（上海）股份有限公司 The sgRNAs of selectively targeted YBX1 gene and its application
CN110438160A (en) * 2019-07-18 2019-11-12 浙江大学 A kind of construction method of Cd2ap Gene Knock-Out Animal Model and application
CN111019971A (en) * 2019-12-19 2020-04-17 上海同科生物科技有限公司 Construction method of mouse model for conditionally overexpressing HPV E6 gene at ROSA26 site

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
ASSIRI, A.M等: "Ovis aries Mx1 (Mx1) gene, promoter and exon 1", GENBANK DATABASE, pages 028199 *
LI, Y.等: "Cloning vector pTRE-EYFP, complete sequence", GENBANK DATABASE, pages 486925 *
MARKUS, B.M.等: "Cloning vector pBM062, complete sequence", GENBANK DATABASE, pages 019114 *
SAKANAKA, M.等: "Shuttle vector pBFS109 Cre recombinase gene, complete cds", GENBANK DATABASE, pages 854762 *
YING-JIE YANG等: "Genome Editing in Model Strain Myxococcus xanthus DK1622 by a Site-Specific Cre/loxP Recombination System", BIOMOLECULES, vol. 8, no. 4, pages 144 - 145 *

Similar Documents

Publication Publication Date Title
JP7263327B2 (en) Non-Integrating DNA Vectors for Genetic Modification of Cells
RU2759335C2 (en) Gene editing of deep intron mutations
KR20200036912A (en) Cell model and therapy for ophthalmic diseases
JP2024023294A (en) CPF1-related methods and compositions for gene editing
US20230416787A1 (en) SYSTEMS AND METHODS FOR ONE-SHOT GUIDE RNA (ogRNA) TARGETING OF ENDOGENOUS AND SOURCE DNA
KR20210056329A (en) New CAS12B enzyme and system
KR20190132626A (en) Compositions and Methods for Improved Gene Expression
KR20170121745A (en) Regulation of gene expression by aptamer mediated regulation of selective splicing
US20220133768A1 (en) Crispr/rna-guided nuclease-related methods and compositions for treating rho-associated autosomal-dominant retinitis pigmentosa (adrp)
KR102636351B1 (en) Highly active regulatory element
KR20210125560A (en) Disruption of splice receptor sites of disease-associated genes using an adenosine deaminase base editor, including for treatment of hereditary diseases
CN114174520A (en) Compositions and methods for selective gene regulation
KR20200095462A (en) Adeno-associated virus composition for restoring HBB gene function and method of use thereof
CN113874510A (en) Non-human animals including humanized TTR loci with beta glide mutations and methods of use
KR102545070B1 (en) Gene Therapy for Eye Disorders
CN109337928B (en) Method for improving gene therapy efficiency by over-expressing adeno-associated virus receptor
CN113874512A (en) Compositions and methods for inducing hair cell differentiation
WO2020000641A1 (en) Nucleic acid for coding human nadh dehydrogenase sigmasubunit protein and application thereof
CN114854791A (en) Novel CRISPR-Cas9 system vector and application thereof
CN111278972B (en) Non-integrated DNA vectors for cytogenetic modification
WO2020187272A1 (en) Fusion protein for gene therapy and application thereof
US20230383275A1 (en) Sgrna targeting aqp1 rna, and vector and use thereof
CN114958920A (en) Novel CRISPR-Cas9 system vector and preparation method and application thereof
WO2022261394A1 (en) Rna polymerase iii promoters and methods of use
US9546357B2 (en) UGT8 mini-promoters

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination