CN109082441A - A kind of circular rna expression vector and the TRAP method using the expression vector - Google Patents
A kind of circular rna expression vector and the TRAP method using the expression vector Download PDFInfo
- Publication number
- CN109082441A CN109082441A CN201811006913.9A CN201811006913A CN109082441A CN 109082441 A CN109082441 A CN 109082441A CN 201811006913 A CN201811006913 A CN 201811006913A CN 109082441 A CN109082441 A CN 109082441A
- Authority
- CN
- China
- Prior art keywords
- rna
- trap
- expression vector
- protein
- buffer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6897—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids involving reporter genes operably linked to promoters
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Plant Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a kind of circular rna expression vector and using the TRAP method for being suitable for circRNA interaction RNA or albumen of the expression vector, solves traditional TRAP experiment at present only using the interactions RNA such as LncRNA or the confinement problems of albumen research.
Description
Technical field
The invention belongs to field of biotechnology, and in particular to a kind of circular rna expression vector and use the expression vector
The TRAP method for being suitable for circRNA interaction RNA or albumen.
Background technique
Circular rna (Circular RNAs) is extensive and is diversely present in a variety of biological cells have controlling gene
A kind of endogenous ncRNA molecule of expressional function.Most it is found in RNA virus earlier than the 1970s.Decades later,
People have also discovered some circRNA being made of exon in some transcripts, as colorectal cancer missing gene is transcribed
Sheet, mankind's Ets-1 gene transcripts etc., but they are considered as " noise " of transcription, the concern for not causing people too many at that time.
And in recent years, with the fast development of bioinformatics technique, Salzman etc., Jeck etc., Memczak etc. and Guo etc. exist respectively
Thousands of kinds of circRNA are had found in the various kinds of cell of the mankind and mouse.
In recent years, with high throughput sequencing technologies and the high speed development of biochip technology, researchers are in eucaryote
More and more circRNA are had found in vivo.Such as Salzman has found hundreds of relevant to human gene expression
circRNA.Jeck etc. detects up to more than 25000 kinds of circRNA in human fibroblast.
Presently found circRNA can be divided into 3 according to the difference in its source and its composition sequence in genome
Class: the annular RNA molecule in exon source and is collectively constituted the annular RNA molecule in introne source by exon and introne
Annular RNA molecule.
CircRNA has the feature that expression differs greatly；With sequence conservation；It prefers in cytoplasm；No
Easily degraded by exonuclease RNase R；Based on exon source；Belong to ncRNA；The role that may act as ceRNA regulates and controls target base
The expression of cause；Regulating and controlling effect is played in transcription or post-transcriptional level.These features make circRNA that machine occur in study of disease
System intervenes target spot and biological markers etc. display significant advantage.
Studies have shown that circRNA has very important gene expression regulation effect in transcription and post-transcriptional level.1,
MiRNA sponge effect: 1 anti-sense transcript of Cerebellar Degeneration-related Protein (antisense to the cerebellar
Degeneration-related protin 1transcript, CDR1as) be a kind of circRNA, possess at least 60 with it is micro-
The conserved binding site that tiny RNA -7 (microRNA-7, miR-7) combines, so that miR-7 sponge is served as, effectively influence miR-7
Target gene activity.In addition, the study found that the circRNA of testicle specificity gene Sry has the target position of 16 Micrornas -138
Point can interact with miR-138, serve as miR-138 sponge.2, controlling gene is transcribed: Zhang etc. identifies one kind and derives from
The circRNA in gene intron region has found this circRNA molecule rich content in nucleus, may participate in genetic transcription
Regulation.3, rna regulation binding protein: Bohjanen etc., which devises one kind, can specifically combine trans-activation modulin
The circRNA molecule of (transactivating regulatory protein, Tat), to inhibit I type human immune deficiency
The expression of viral 1 (HIV-1) gene.4, partially protein translation: Hepatitis D virus (hepatitis D virus is participated in
Antigen, HDAg) it is played an important role in disease development.In addition, the study found that in human skull's oncocyte U2OS,
CircRNA has interpretative function, although its translation efficiency is very low.
In recent years, with high throughput sequencing technologies and the high speed development of biochip technology, researchers are in eucaryote
More and more circRNA are had found in vivo.Such as Salzman has found hundreds of relevant to human gene expression
circRNA.Jeck etc. detects up to more than 25000 kinds of circRNA in human fibroblast.Danan etc. has found again
The various characteristics of circRNA in organism.Meanwhile people have found them in the hair of disease when recognizing the structure of circRNA
Important function has been played in raw and development.Such as circRNA and tumour, the nervous system disease, atherosclerosis, diabetes and disease
Virus hepatitis etc. is related, and therefore, circRNA is played in the discovery and treatment of disease as the diagnostic value of molecular marked compound
Great function.However, the research of function and molecular mechanism of action that circRNA is played in vivo is considerably less.Current
In research, only specify that circRNA has the effects that sponge effect, the controlling gene transcription of adsorbing miRNA.It is usually used at present
Study method RNA antisense purifying that circRNA and albumen or RNA interact (RNA antisense Purification,
RAP)。
RNA antisense purifying (RNA antisense Purification, RAP) is a kind of for studying post-transcriptional level mirror
Determine the method for RNA Yu RNA, RNA and protein interaction mechanism.RAP technology fixes cell with UV crosslinking first, to maintain such as
Then the interaction of the rna regulations such as circRNA and RNA, RBP carries out cell cracking, then use the few nucleosides of biotin labeling
Acid probe (for the joint sequence of circRNA) hybridizes with target circRNA, is interacted based on biotin and Streptavidin
Principle is separated, purified probes-gene or protein complex with Streptavidin MagneSphere, finally from the complex of purifying
Protein isolate matter or RNA, to carry out the analysis in downstream.
In recent years, TRAP (tagged RNA affinity purification) technology is also applied to research RNA interaction
On, i.e., using the method for the RNA of specific RNA label separation expression.One of most widely used label MS2, is to be present in MS2
Long virus (bacteriophage) RNA sequence of 19 nucleotide of the ribosome bind site of replicase mRNA, is folded into hairpin loop knot
Structure.By MS2 phage capsid rna binding protein MS2, (Kd is 3-300 × 109, depend on stem ring sequence and MS2RBP become
Body), which is identified with high specific and affinity.The expression of RBP MS2 as the chimeric protein containing peptide tag
Promote the separation of other molecules present in [MS2RNA/MS2 albumen] compound and compound.MS2 has been widely used for marking
Note transcribes the RNA of other application in vitro and in vivo.
MS2 pulldown method is made of three basic steps:
1. being related to constructing two plasmid vectors and its cotransfection being entered mammalian cell.First plasmid expression contains thoughts
The chimeric RNA of the test rna of interest, followed by several MS2RNA hair clips (usually 12 or 24 series connection MS2 hairpin loops).Usually
It is recommended that MS2 sequence to be attached to the end 3' of test rna, but before the tail portion poly (A), to avoid blocking translation or may turn over
Translate MS2 sequence.Control plasmid simply expresses the MS2 hair clip of no interested test rna.Second plasmid expression includes MS2
The chimeric protein of capsid protein and affinity tag.Compared with detecting chimeric protein, in order to reduce non-specific binding, expression is more
More chimeric RNA are important.Such as the expression mouse lincRNA-p21 of MS2 hairpin loop (lincRNA-p21-MS2) label
As interested RNA (MS2RNA is expressed in the parallel transfection of control).
2. detection protein MS2-GST is related to harvest 24-48 hours culture cultures after transfected plasmids, then with reservation
The buffer of the integrality of natural RNP carries out cell cracking.Then cell lysate is mixed and is made it combine with affinity reagent,
It separates and washs RNP compound.Glutathione-SH (GSH) GSH pearl that affinity reagent is attached to bead is combined with high-affinity
The GST component of fusion protein (MS2-GST), and MS2RNP can be efficiently separated by centrifugation.Then the heavy of recycling is handled with DNA enzymatic
Starch, separation RNA are further analyzed.
3. RNA or Protein present in the RNP compound of purification Identification.
Above-mentioned RAP method have the shortcomings that 3 points it is obvious: (1) pulled down in experiment using hybridizing to probe with circRNA
CircRNA, hybridization temperature is higher, and hybridization efficiency is lower and RNA is degradable, be easy to cause the false negative of experimental result；(2)
CircRNA joint sequence may cause probe that can not can not pull down circRNA in conjunction with circRNA, cause with protein binding
Experiment can not carry out；(3) it needs the markd rna probe of anamorphic zone and probe is easy to degrade.
And traditional TRAP experiment is not yet applied at present only using the research of the interactions RNA such as LncRNA or albumen
In the research of circRNA, the research of circRNA is caused to have significant limitation.
Summary of the invention
Of the existing technology in order to solve the problems, such as, the present invention provides described in a kind of circular rna expression vector and use
The TRAP method for being suitable for circRNA interaction RNA or albumen of expression vector solves traditional TRAP experiment and only applies at present
The interactions such as LncRNA RNA or the confinement problems of albumen research.
The object of the present invention is to provide a kind of circular rna expression vectors.
Another object of the present invention is to provide a kind of TRAP method TRAP method using the expression vector.
Circular rna expression vector according to the present invention reacts upstream element-intron A G comprising promoter-reverse complemental
Receptor (MS2 partial sequence)-multiple cloning sites-introne GT donor (MS2 partial sequence)-reverse complemental reacts downstream components-
Terminator, the sequence of the intron A G receptor is as shown in SEQ ID NO:1, the sequence of the introne GT donor such as SEQ ID
Shown in NO:2.
The sequence of the SEQ ID NO:1 are as follows: GATCACCCATGTCTGCAG.
The sequence of the SEQ ID NO:2 are as follows: CTCTAGAAAACATGAGGTAAG.
Circular rna expression vector according to the present invention, wherein the sequence such as SEQ of the reverse complemental reaction upstream element
Shown in ID NO:3, the sequence of the reverse complemental reaction downstream components is as shown in SEQ ID NO:4.
The sequence of the SEQ ID NO:3 are as follows:
GGTGGACTGCCTGAGGTCAGGAGTTCGTGACCAGACTGACCAACATGGTGAAACCCTGTCTCTACTAA
AAATACAAAAAAAATTAGCCAGGTGCGGTGGCATGCACCTGTAATCCCAGCTACTCGGGAGGCTAAGGCAGGGGAA
TTGCTTGAACCAGGGAGGTGGAGGTCGCAGTGAGCCGAGATGGCGCCACTGCACTCCAGCCTGGGCAACAGAGAGA
GACTCTATCTTAAAAAAAAAAAAAAAAATTATTCTGGTAGGCTCAGGCCCCATGTGGCCT。
The sequence of the SEQ ID NO:4 are as follows:
AGGCCACATGGGGCCTGAGCCTACCAGAATAATTTTTTTTTTTTTTTTTAAGATAGAGTCTCTCTCTG
TTGCCCAGGCTGGAGTGCAGTGGCGCCATCTCGGCTCACTGCGACCTCCACCTCCCTGGTTCAAGCAATTCCCCTG
CCTTAGCCTCCCGAGTAGCTGGGATTACAGGTGCATGCCACCGCACCTGGCTAATTTTTTTTGTATTTTTAGTAGA
GACAGGGTTTCACCATGTTGGTCAGTCTGGTCACGAACTCCTGACCTCAGGCAGTCCACCGCTCGTGGCTTTTTTT
TTTTTTTTTTTTTTTTTTTGAGACAGAGTATCACCCTGTCACCCAGG。
Circular rna expression vector according to the present invention, wherein the promoter is pCMV promoter；The terminator is
BGH pA terminator.
Circular rna expression vector according to the present invention, wherein the multiple cloning sites include BamH I, filling sequence according to this
Column and EcoR I.
TRAP method according to the present invention, the TRAP method use the circular rna expression vector.
TRAP method according to the present invention, wherein the TRAP method comprises the steps of:
A, the building of circular rna expression vector: PMS2- circular rna expression vector is obtained；
B, cell culture, transfection and cracking: preparing cell, and the PMS2- circular rna expression obtained using step A is carried
Body or PMS2 zero load transfect cell, are cracked after culture, obtain lysate；
C, the lysate in step B is taken, Pulldown experiment is carried out, obtains NT2 buffer, is labeled as TRAP liquid；
D, the TRAP liquid in step C is taken, carries out RNP collection and RNA purifying according to this, and carries out reverse transcription and qPCR detection.
TRAP method according to the present invention, wherein the step B, concrete operations of cell culture, transfection and cracking are as follows:
1. preparing cell；
2. the PMS2- circular rna expression vector or PMS2 that common transfection procedure A is obtained are unloaded, and with 150 μ L
The diluted 1 μ g PMS2GST of OPTIMEM；
3. after 48 hours, washing cell twice with PBS, and in lysis buffer, protease inhibitors, RNase inhibition
It is cracked in agent and 100mM DTT lysate 10 minutes on ice；
4., with 10 at 4 DEG C, 000 × g is centrifuged lysate 15 minutes after scraping collection cell lysate；
5. collecting supernatant using Bradford measuring method and measuring protein concentration；
6. carrying out pulldown experiment using 2 μ g/ μ l lysates.
TRAP method according to the present invention, wherein the step C, concrete operations of Pulldown experiment are as follows:
1. taking the GSH magnetic bead of 200 μ L 10% respectively, GSH magnetic bead is washed twice with ice-cold PBS, and with isometric
PBS is resuspended, and 50% slurries are made；
2. above-mentioned magnetic bead is separately added into two groups of supernatants, 4 DEG C are incubated for 3 hours；
3. 4 DEG C, after 4,500rpm centrifugations 1 minute, washing pearl twice with 1mL NT2 buffer；
4. the DNA enzymatic I of magnetic bead and 20U without RNA enzyme is incubated for 15 minutes in 100 μ L reaction volumes at 37 DEG C respectively；
5. 1mL NT2 buffer is added；
6. if subsequent experimental studies albumen and RNA simultaneously, 1mL NT2 buffer is equally divided into two pipes, 4 DEG C, 4500rpm
Centrifugation 1 minute；
7. 1mL NT2 buffer is divided to by 100 μ L and 900 μ L manages if subsequent experimental only studies albumen for two, mark respectively
For TRAP RNA, TRAP protein, 4 DEG C, 4500rpm is centrifuged 1 minute；
8. 1mL NT2 buffer is divided to by 100 μ L and 900 μ L manages if subsequent experimental only studies RNA for two, mark respectively
For TRAP protein, TRAP RNA, 4 DEG C, 4500rpm is centrifuged 1 minute.
TRAP method according to the present invention, wherein the concrete operations that RNP is collected in step D are as follows:
1. 30 μ L Protein Elution Buffer1,7 μ LProtein are added in TRAP protein group pearl respectively
Elution Buffer2 and 0.3 μ L DTT, is placed in boiling water and boils 10min, and midfeather mixes, and magnetic frame moves up supernatant extremely
In new centrifuge tube；
2. it is 1. primary to repeat step；
3. protein example is placed in -80 DEG C and saves backup；
4. 15 μ L protein samples is taken to carry out the detection of PAGE- silver staining；
5. 15 μ L protein samples is taken to carry out PAGE-western blot detection；
6. 30 μ L protein samples is taken to carry out LC-MS detection；
7. -20 DEG C of remaining sample save backup.
TRAP method according to the present invention, wherein the concrete operations that RNA is purified in step D are as follows:
1. 200 μ L RNA Elution Buffer, 2 μ L Proteinase Ks, Input is added in TRAP RNA group pearl respectively
100 μ L RNA Elution Buffer are respectively added in RNA, and 2 μ L Proteinase Ks are incubated for 30 minutes at 55 DEG C；
2. 4 DEG C, 10,000g 5 minutes collection supernatants of centrifugation；
3. it is separately added into phenol chloroform-isoamyl alcohol mixed liquors of equal elution volumes to Input RNA, in TRAP RNA, benzene
Phenol-chloroform-isoamyl alcohol volume ratio is 25:24:1；It is vortexed and mixes 5min；
4. 13,000g 4 DEG C are centrifuged 10 minutes, upper strata aqueous phase is collected, is transferred to newly without in RNA enzyme centrifuge tube；
5. 200 μ L supernatants are separately added into 400 μ L, 100% ethyl alcohol, 20 μ L sodium acetates and 2 μ L Glycogen mixing；
6., with 10 at 4 DEG C, 000 × g is centrifuged 20 minutes after -20 DEG C are placed 2 hours；
7. the RNA precipitate obtained with 500 μ L, 70% ethanol washing, 10,000 × g, 4 DEG C are centrifuged 10 minutes；
8. dry RNA particle, and 10-20 μ L is resuspended in without in the water of RNase；
9. carrying out reverse transcription and qPCR detection.
The invention has the benefit that
1, the present invention provides a kind of circular rna expression vector, MS2RNA is divided into two parts, is located at circRNA
The MS2RNA that can be identified by MS2 albumen could be formed when the both ends before cyclization, only circRNA cyclization, avoid linear rna pair
The interference of experiment.
2, the TRAP method uses the circular rna expression vector, and the present invention improves traditional TRAP experiment
And in the research of application circRNA, new method is provided for the research of circRNA.
3, the TRAP method avoids the method for having used probe to hybridize, and is not visited after protein binding by joint sequence thoroughly
Needle cannot to circRNA research, there are the influences of false negative in conjunction with circRNA, and reduce the degradation of probe hybrid process RNA.
Detailed description of the invention
In order to more clearly explain the embodiment of the invention or the technical proposal in the existing technology, to embodiment or will show below
There is attached drawing needed in technical description to be briefly described, it should be apparent that, the accompanying drawings in the following description is only this
Some embodiments of invention for those of ordinary skill in the art without creative efforts, can be with
It obtains other drawings based on these drawings.
Fig. 1 is pcircRNA 2.3hsa expression vector ideograph；
Fig. 2 is pcircRNA 2.2hsa expression vector ideograph；
Fig. 3 is the concentration effect comparison chart of the TRAP method and RAP method；
Fig. 4 is the TRAP method and RAP method to circ-Foxo3 target protein CDK2 bioaccumulation efficiency comparison chart.
Specific embodiment
To make the object, technical solutions and advantages of the present invention clearer, technical solution of the present invention will be carried out below
Detailed description.Obviously, described embodiments are only a part of the embodiments of the present invention, instead of all the embodiments.Base
Embodiment in the present invention, those of ordinary skill in the art are obtained all without making creative work
Other embodiment belongs to the range that the present invention is protected.
Embodiment 1
The present invention constructs promoter containing pCMV-reverse complemental reaction upstream element (reverse complementary
Matches-upstream, RCMs-up)-MS2 partial sequence-multiple cloning sites-MS2 partial sequence-reverse complemental reaction downstream
Framework based on element (reverse complementary matches-downstream, RCMs-down)-BGH pA
CircRNA forms carrier for expression of eukaryon, and passes through sequence verification.The plasmid vector and slow virus carrier are respectively designated as
pcircRNA 2.3hsa、pcircRNA 2.2hsa。
PcircRNA 2.3hsa, the expression vector ideograph of pcircRNA 2.2hsa are as depicted in figs. 1 and 2.
The circular rna expression vector core element sequence is as follows:
The sequence of the reverse complemental reaction upstream element is as shown in SEQ ID NO:3；
The sequence of the intron A G receptor (MS2 partial sequence) is as shown in SEQ ID NO:1；
The sequence of the multiple cloning sites is as shown in SEQ ID NO:5；
The sequence of SEQ ID NO:5 are as follows: GGATCCGCGCAGGACCGGAATTC；
The sequence of the introne GT donor (MS2 partial sequence) is as shown in SEQ ID NO:2；
The sequence of the reverse complemental reaction downstream components is as shown in SEQ ID NO:4.
The circular rna expression vector, is divided into two parts for MS2RNA, the both ends before being located at circRNA cyclization, only
The MS2RNA that can be identified by MS2 albumen could be formed by having when circRNA cyclization, avoid interference of the linear rna to experiment.
Circular rna expression vector is obtained by goal in research of hsa_circ_0001946, hsa_circ_0001946
For exon circRNA, sequence is as shown in SEQ ID NO:6.
Embodiment 2
A kind of TRAP method, method comprise the steps of:
A, it the building of circular rna expression vector: according to the sequence in embodiment 1, is synthesized by the way of gene chemical synthesis
To circular rna expression vector；
B, cell culture, the preparation of transfection and lysate:
1. preparing 2 × 107Cell；
2. 2 μ g plasmid pms2-circRNA-0001946 or PMS2 of transfection jointly, and with 150 diluted 1 μ of μ L OPTIMEM
g PMS2GST；
3. after 48 hours, cell is washed twice with PBS, and in 1.2ml lysis buffer, 12 μ l protease inhibitors,
It is cracked 10 minutes on ice in 12 μ l RNase inhibitor and 12 μ l 100mM DTT lysates；
4., with 10 at 4 DEG C, 000 × g is centrifuged lysate 15 minutes after scraping collection cell lysate；
5. collecting supernatant using Bradford measuring method and measuring protein concentration；
6. carrying out pulldown experiment using 1000 μ l lysates (2 μ g/ μ l)；
C, Pulldown is tested:
1. taking the GSH magnetic bead of 200 μ L 10% respectively, GSH magnetic bead is washed twice with ice-cold PBS, and with isometric
PBS is resuspended, and 50% slurries are made；
2. above-mentioned magnetic bead is separately added into two groups of supernatants, 4 DEG C are incubated for 3 hours；
3. 4 DEG C, after 4,500rpm centrifugations 1 minute, washing pearl twice with 1mL NT2 buffer；
4. the DNA enzymatic I of magnetic bead and 20U without RNA enzyme is incubated for 15 minutes in 100 μ L reaction volumes at 37 DEG C respectively；
5. 1mL NT2 buffer is added；
6. if subsequent experimental studies albumen and RNA simultaneously, 1mL NT2 buffer is equally divided into two pipes, 4 DEG C, 4500rpm
Centrifugation 1 minute；
7. 1mL NT2 buffer is divided to by 100 μ L and 900 μ L manages if subsequent experimental only studies albumen for two, mark respectively
For TRAP RNA, TRAP protein, 4 DEG C, 4500rpm is centrifuged 1 minute；
8. 1mL NT2 buffer is divided to by 100 μ L and 900 μ L manages if subsequent experimental only studies RNA for two, mark respectively
For TRAP protein, TRAP RNA, 4 DEG C, 4500rpm is centrifuged 1 minute；
D, RNP is collected:
1. 30 μ L Protein Elution Buffer1,7 μ LProtein are added in TRAP protein group pearl respectively
Elution Buffer2 and 0.3 μ L DTT, is placed in boiling water and boils 10min, and midfeather mixes, and magnetic frame moves up supernatant extremely
In new centrifuge tube；
2. it is 1. primary to repeat step；
3. protein example is placed in -80 DEG C and saves backup；
4. 15 μ L protein samples is taken to carry out the detection of PAGE- silver staining；
5. 15 μ L protein samples is taken to carry out PAGE-western blot detection；
6. 30 μ L protein samples is taken to carry out LC-MS detection；
7. -20 DEG C of remaining sample save backup；
E, RNA is purified:
1. 200 μ L RNA Elution Buffer, 2 μ L Proteinase Ks, Input is added in TRAP RNA group pearl respectively
100 μ L RNA Elution Buffer are respectively added in RNA, and 2 μ L Proteinase Ks are incubated for 30 minutes at 55 DEG C；
2. 4 DEG C, 10,000g 5 minutes collection supernatants of centrifugation；
3. it is separately added into phenol chloroform-isoamyl alcohol mixed liquors of equal elution volumes to Input RNA, in TRAP RNA, benzene
Phenol-chloroform-isoamyl alcohol volume ratio is 25:24:1；It is vortexed and mixes 5min；
4. 13,000g 4 DEG C are centrifuged 10 minutes, upper strata aqueous phase is collected, is transferred to newly without in RNA enzyme centrifuge tube；
5. 200 μ L supernatants are separately added into 400 μ L, 100% ethyl alcohol, 20 μ L sodium acetates and 2 μ L Glycogen mixing；
6., with 10 at 4 DEG C, 000 × g is centrifuged 20 minutes after -20 DEG C are placed 2 hours；
7. the RNA precipitate obtained with 500 μ L, 70% ethanol washing, 10,000 × g, 4 DEG C are centrifuged 10 minutes；
8. dry RNA particle, and 10-20 μ L is resuspended in without in the water of RNase；
9. carrying out reverse transcription and qPCR detection.
Embodiment 3
The present embodiment is the comparative test of TRAP method provided by the invention compared with prior art.
1, HEK293 cytolytic proteins are used institute of the present invention by the enrichment by different technologies to circ RNA respectively
The TRAP method and existing RAP method stated are enriched with hsa_circ_0001946, as a result as shown in Figure 3.
It should be noted that being converted into after black and white grayscale image, distinguished between the Individual colours of Fig. 3 smaller, it is not easy to point
It distinguishes, explanation of making explanations herein: each series of abscissa, according to hsa_circ_0001946, CDR1, β-actin, miR-
7, the sequence arrangement of U6.
The corresponding experiment parameter of Fig. 3 are as follows: hsa_circ_0001946: as TRAP experimental group；MS2:TRAP experiment is negative
Control group；Hsa_circ_0001946:RAP experimental group；LacZ:RAP tests negative control group.
, it can be seen that TRAP method of the present invention is bright for the bioaccumulation efficiency of hsa_circ_0001946 from Fig. 3
It is aobvious to be higher than RAP method, while the bioaccumulation efficiency of hsa_circ_0001946 host gene is detected, TRAP method of the present invention
In the RNA of only cyclization could form MS2RNA, and identified by GST-MS2, and pulled down by GSH magnetic bead, so substantially
Residual without containing host gene, and existing RAP method is based on the process of probe hybridization, there is certain host genes
Residual interference experiment；Also, the bioaccumulation efficiency of hsa_circ_0001946 target gene also correspondinglys increase in TRAP method, RAP
It is to be hybridized based on probe with RNA, if there are protein binding, the efficiency of the significantly lower probe of meeting, caused vacation in the position that probe combines
Negative findings, and TRAP method is to avoid this false negative result based on MS2RNA and MS2 protein binding.
To sum up, this test illustrates TRAP method of the present invention compared with existing RAP method, and bioaccumulation efficiency is higher,
Non-specific type combination is lower, as a result more acurrate.
2, HEK293 cytolytic proteins are used institute of the present invention by the enrichment by different technologies to circ RNA respectively
The TRAP method and existing RAP method stated are enriched with circ-Foxo3 target protein CDK2, as a result as shown in Figure 4.
The corresponding experiment parameter of Fig. 4 are as follows: Input:10%input albumen；Circ-Foxo3: experimental group；NC: negative control
Group.
A, B are the effect picture of TRAP method of the present invention in Fig. 4；C is the energy from Fig. 4 according to RAP method effect picture
Enough find out, TRAP method is deeper relative to RAP method band, and protein yield is higher, shows TRAP method and existing RAP method
It compares, there is higher protein enrichment efficiency, specificity is more preferable, and protein enrichment is more efficient, high sensitivity.
The above description is merely a specific embodiment, but scope of protection of the present invention is not limited thereto, any
Those familiar with the art in the technical scope disclosed by the present invention, can easily think of the change or the replacement, and should all contain
Lid is within protection scope of the present invention.Therefore, protection scope of the present invention should be based on the protection scope of the described claims.
Claims (10)
1. a kind of circular rna expression vector, which is characterized in that react upstream element-intron A G comprising promoter-reverse complemental
Receptor-multiple cloning sites-introne GT donor-reverse complemental reacts downstream components-terminator, the sequence of the intron A G receptor
Column are as shown in SEQ ID NO:1, and the sequence of the introne GT donor is as shown in SEQ ID NO:2.
2. circular rna expression vector according to claim 1, which is characterized in that the reverse complemental reacts upstream element
Sequence as shown in SEQ ID NO:3, the sequence of reverse complemental reaction downstream components is as shown in SEQ ID NO:4.
3. circular rna expression vector according to claim 1, which is characterized in that the promoter is pCMV promoter；Institute
Stating terminator is BGH pA terminator.
4. circular rna expression vector according to claim 1, which is characterized in that the multiple cloning sites include according to this
BamH I, padding sequence and EcoR I.
5. a kind of TRAP method, which is characterized in that the TRAP method uses any circular rna table of claim 1-4
Up to carrier.
6. TRAP method according to claim 5, which is characterized in that the TRAP method comprises the steps of:
A, the building of circular rna expression vector: PMS2- circular rna expression vector is obtained；
B, cell culture, transfection and cracking: preparing cell, using the obtained PMS2- circular rna expression vector of step A or
PMS2 zero load transfects cell, is cracked after culture, obtains lysate；
C, the lysate in step B is taken, Pulldown experiment is carried out, obtains NT2 buffer, is labeled as TRAP liquid；
D, the TRAP liquid in step C is taken, carries out RNP collection and RNA purifying according to this, and carries out reverse transcription and qPCR detection.
7. TRAP method according to claim 6, which is characterized in that step B, the specific behaviour of cell culture, transfection and cracking
As:
1. preparing cell；
2. the PMS2- circular rna expression vector or PMS2 that common transfection procedure A is obtained are unloaded, and with 150 μ L OPTIMEM
Diluted 1 μ g PMS2GST；
3. after 48 hours, wash cell twice with PBS, and in lysis buffer, protease inhibitors, RNase inhibitor and
It is cracked in 100mM DTT lysate 10 minutes on ice；
4., with 10 at 4 DEG C, 000 × g is centrifuged lysate 15 minutes after scraping collection cell lysate；
5. collecting supernatant using Bradford measuring method and measuring protein concentration；
6. carrying out pulldown experiment using 2 μ g/ μ l lysates.
8. TRAP method according to claim 6, which is characterized in that the step C, concrete operations of Pulldown experiment are as follows:
1. taking the GSH magnetic bead of 200 μ L 10% respectively, GSH magnetic bead is washed twice with ice-cold PBS, and heavy with isometric PBS
It is outstanding, 50% slurries are made；
2. above-mentioned magnetic bead is separately added into two groups of supernatants, 4 DEG C are incubated for 3 hours；
3. 4 DEG C, after 4,500rpm centrifugations 1 minute, washing pearl twice with 1mL NT2 buffer；
4. the DNA enzymatic I of magnetic bead and 20U without RNA enzyme is incubated for 15 minutes in 100 μ L reaction volumes at 37 DEG C respectively；
5. 1mL NT2 buffer is added；
6. 1mL NT2 buffer is equally divided into two pipes, and 4 DEG C, 4500rpm is centrifuged if subsequent experimental studies albumen and RNA simultaneously
1 minute；
7. 1mL NT2 buffer is divided to by 100 μ L and 900 μ L manages if subsequent experimental only studies albumen for two, it is respectively labeled as
TRAP RNA, TRAP protein, 4 DEG C, 4500rpm is centrifuged 1 minute；
8. 1mL NT2 buffer is divided to by 100 μ L and 900 μ L manages if subsequent experimental only studies RNA for two, it is respectively labeled as
TRAP protein, TRAP RNA, 4 DEG C, 4500rpm is centrifuged 1 minute.
9. TRAP method according to claim 6, which is characterized in that the concrete operations that RNP is collected in step D are as follows:
1. 30 μ L Protein Elution Buffer1,7 μ LProtein are added in TRAP protein group pearl respectively
Elution Buffer2 and 0.3 μ L DTT, is placed in boiling water and boils 10min, and midfeather mixes, and magnetic frame moves up supernatant extremely
In new centrifuge tube；
2. it is 1. primary to repeat step；
3. protein example is placed in -80 DEG C and saves backup；
4. 15 μ L protein samples is taken to carry out the detection of PAGE- silver staining；
5. 15 μ L protein samples is taken to carry out PAGE-western blot detection；
6. 30 μ L protein samples is taken to carry out LC-MS detection；
7. -20 DEG C of remaining sample save backup.
10. TRAP method according to claim 6, which is characterized in that the concrete operations that RNA is purified in step D are as follows:
1. 200 μ L RNA Elution Buffer are added in TRAP RNA group pearl respectively, 2 μ L Proteinase Ks, Input RNA is each
100 μ L RNA Elution Buffer are added, 2 μ L Proteinase Ks are incubated for 30 minutes at 55 DEG C；
2. 4 DEG C, 10,000g 5 minutes collection supernatants of centrifugation；
3. it is separately added into phenol chloroform-isoamyl alcohol mixed liquors of equal elution volumes to Input RNA, in TRAP RNA, phenol-
The volume ratio of chloroform-isoamyl alcohol is 25:24:1；It is vortexed and mixes 5min；
4. 13,000g 4 DEG C are centrifuged 10 minutes, upper strata aqueous phase is collected, is transferred to newly without in RNA enzyme centrifuge tube；
5. 200 μ L supernatants are separately added into 400 μ L, 100% ethyl alcohol, 20 μ L sodium acetates and 2 μ L Glycogen mixing；
6., with 10 at 4 DEG C, 000 × g is centrifuged 20 minutes after -20 DEG C are placed 2 hours；
7. the RNA precipitate obtained with 500 μ L, 70% ethanol washing, 10,000 × g, 4 DEG C are centrifuged 10 minutes；
8. dry RNA particle, and 10-20 μ L is resuspended in without in the water of RNase；
9. carrying out reverse transcription and qPCR detection.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811006913.9A CN109082441A (en) | 2018-08-29 | 2018-08-29 | A kind of circular rna expression vector and the TRAP method using the expression vector |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811006913.9A CN109082441A (en) | 2018-08-29 | 2018-08-29 | A kind of circular rna expression vector and the TRAP method using the expression vector |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109082441A true CN109082441A (en) | 2018-12-25 |
Family
ID=64840284
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811006913.9A Pending CN109082441A (en) | 2018-08-29 | 2018-08-29 | A kind of circular rna expression vector and the TRAP method using the expression vector |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109082441A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109943586A (en) * | 2019-03-15 | 2019-06-28 | 上海交通大学 | A kind of plant circRNA over-express vector and its construction method |
| CN113817724A (en) * | 2021-09-30 | 2021-12-21 | 广州辉骏生物科技股份有限公司 | FII-RNA pulldown kit, method and application thereof |
| CN116621946A (en) * | 2023-05-31 | 2023-08-22 | 山东大学齐鲁医院 | Application of polypeptide circ1946-109aa as esophageal squamous carcinoma prognosis marker |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106191296A (en) * | 2016-08-31 | 2016-12-07 | 广州伯信生物科技有限公司 | A kind of chromatin isolation technics of RNA purification |
| CN106318976A (en) * | 2016-09-14 | 2017-01-11 | 广州伯信生物科技有限公司 | Human circRNA overexpression vector framework, overexpression vector and preparation methods thereof |
| US20170298347A1 (en) * | 2016-02-03 | 2017-10-19 | Beth Israel Deaconess Medical Center | NOVEL FUSION-CIRCULAR RNAs AND USES THEREOF |
-
2018
- 2018-08-29 CN CN201811006913.9A patent/CN109082441A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20170298347A1 (en) * | 2016-02-03 | 2017-10-19 | Beth Israel Deaconess Medical Center | NOVEL FUSION-CIRCULAR RNAs AND USES THEREOF |
| CN106191296A (en) * | 2016-08-31 | 2016-12-07 | 广州伯信生物科技有限公司 | A kind of chromatin isolation technics of RNA purification |
| CN106318976A (en) * | 2016-09-14 | 2017-01-11 | 广州伯信生物科技有限公司 | Human circRNA overexpression vector framework, overexpression vector and preparation methods thereof |
Non-Patent Citations (2)
| Title |
|---|
| JE-HYUN YOON,ET AL.: "MS2-TRAP (MS2-tagged RNA affinity purification): Tagging RNA to identify associated miRNAs", 《METHODS.》 * |
| 曹洋等: "环状RNAmmu-circ-Pax3.1表达载体的构建及初步验证", 《中国畜牧兽医》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109943586A (en) * | 2019-03-15 | 2019-06-28 | 上海交通大学 | A kind of plant circRNA over-express vector and its construction method |
| CN109943586B (en) * | 2019-03-15 | 2021-02-26 | 上海交通大学 | Plant circRNA overexpression vector and construction method thereof |
| CN113817724A (en) * | 2021-09-30 | 2021-12-21 | 广州辉骏生物科技股份有限公司 | FII-RNA pulldown kit, method and application thereof |
| CN116621946A (en) * | 2023-05-31 | 2023-08-22 | 山东大学齐鲁医院 | Application of polypeptide circ1946-109aa as esophageal squamous carcinoma prognosis marker |
| CN116621946B (en) * | 2023-05-31 | 2024-02-20 | 山东大学齐鲁医院 | Application of polypeptide circ1946-109aa as esophageal squamous carcinoma prognosis marker |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Liu et al. | Circular RNAs: Characterization, cellular roles, and applications | |
| US11560567B2 (en) | Genetic elements driving circular RNA translation and methods of use | |
| Swanson et al. | RNA binding specificity of hnRNP proteins: a subset bind to the 3′ end of introns. | |
| Yoon et al. | MS2-TRAP (MS2-tagged RNA affinity purification): tagging RNA to identify associated miRNAs | |
| CN109082441A (en) | A kind of circular rna expression vector and the TRAP method using the expression vector | |
| AU2010248380B2 (en) | Aptamer that recognizes peptide | |
| CN109097395A (en) | A kind of mankind's circular rna over-express vector frame, over-express vector and preparation method thereof | |
| CN106318976A (en) | Human circRNA overexpression vector framework, overexpression vector and preparation methods thereof | |
| Zhao et al. | SpyCLIP: an easy-to-use and high-throughput compatible CLIP platform for the characterization of protein–RNA interactions with high accuracy | |
| CN114940992B (en) | Application of lncRNA TAB2-AS regulation TAB2 in pig ovary granular cells | |
| CN112795563A (en) | Use and method of biotinylated transposomes for recovering CUT & Tag or ATAC-seq products | |
| CN110678549B (en) | Method for activating expression of p21 gene | |
| Mohr et al. | A highly proliferative group IIC intron from Geobacillus stearothermophilus reveals new features of group II intron mobility and splicing | |
| CN111440826A (en) | RNA-targeted 6-methyladenine modified CasRx vector system, and preparation method and application thereof | |
| CN107858357B (en) | Bovine respiratory syncytial G protein specific aptamer | |
| CN105018508B (en) | RNA cores are detained structure and the application of carrier | |
| Martinez et al. | Pseudouridine synthases modify human pre-mRNA co-transcriptionally and affect splicing | |
| CN114317544B (en) | Aptamer specifically binding to CD133, screening method and application thereof | |
| CN112574992A (en) | Circular RNA over-expression cyclization vector DNA sequence and construction method and application thereof | |
| CN106754891A (en) | A kind of RNA antisenses purification process | |
| CN109609611A (en) | A kind of gene quantification sequencing approach based on high throughput sequencing technologies | |
| WO2015105179A1 (en) | Rna micro-array for detecting interaction between protein and conformation-containing rna | |
| CN114107306B (en) | Nucleic acid aptamer of Cas9 protein and application thereof | |
| Dangerfield et al. | Enhancement of the StreptoTag method for isolation of endogenously expressed proteins with complex RNA binding targets | |
| CA2839771A1 (en) | Binding-induced formation of dna three-way junctions |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20181225 |
|
| RJ01 | Rejection of invention patent application after publication |