CN106754891A - A kind of RNA antisenses purification process - Google Patents
A kind of RNA antisenses purification process Download PDFInfo
- Publication number
- CN106754891A CN106754891A CN201710074375.6A CN201710074375A CN106754891A CN 106754891 A CN106754891 A CN 106754891A CN 201710074375 A CN201710074375 A CN 201710074375A CN 106754891 A CN106754891 A CN 106754891A
- Authority
- CN
- China
- Prior art keywords
- rna
- magnetic bead
- probe
- bead
- supernatant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
- C12N15/1006—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor by means of a solid support carrier, e.g. particles, polymers
- C12N15/1013—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor by means of a solid support carrier, e.g. particles, polymers by using magnetic beads
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
Landscapes
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Crystallography & Structural Chemistry (AREA)
- Plant Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a kind of RNA antisenses purification process.Methods described is comprised the steps of：S1, the crosslinking of cell, cracking and the digestion of genomic DNA, obtain RNA sample；The preparation of S2, probe groups solution；S3, magnetic bead pretreatment；The preparation of S4, probe groups bead complexes；S5, antisense purifying；The wash-out of S6, RNA；The purifying of S7, RNA.The present invention reduces the non-specific adsorption of magnetic bead by closing magnetic bead using BSA and random oligonucleotide primer in advance.Magnetic bead is incubated with probe first in the present invention, is incubated with RNA again after removal excess probes, and the non-specific binding of excess probe closing Streptavidin and protein, nucleic acid etc. improves detection specificity, and sensitivity is high；Repeatedly washed through gradient temperature after hybridization, it is ensured that the abundant bonding probes of magnetic bead and combining target RNA, improve hybridization efficiency.
Description
Technical field
The present invention relates to biological technical field, more particularly to a kind of RNA antisenses purification process.
Background technology
Long-chain non-coding RNA (Long non-coding RNA, lncRNA) is the transcription more than 200 nucleotides
This, the overwhelming majority is located in nucleus.Although lncRNA does not encode any protein, they are in different tissues and development rank
The expression of section still has specificity, and this explanation lncRNA has important biological significance.With the help of sequencing technologies, people
Have discovered that thousands of kinds of lncRNA, but the biological function of these lncRNA is also still a mystery.
2013, Jesse professors M.Engreitz developed the purifying of RNA antisenses
(RNAantisensePurification, RAP) technology, the technology can be in post-transcriptional level identification RNA and RNA and related
The interaction of DNA and protein.Its principle is as follows：First with UV-crosslinked fixed cell, with maintain such as lncRNA rna regulations and
The interaction of RNA, RBP, then carries out cell cracking, then with the oligonucleotide probe group and target lncRNA of biotin labeling
Hybridization, based on the principle that biotin and Streptavidin interact, is separated, purified probes-base with Streptavidin MagneSphere
Cause or protein complex, finally separate protein or RNA, to carry out the analysis in downstream from the complex of purifying.
RAP technologies are widely used by the researchers of different field.Such as Engreitz J M (2013) utilize RAP technologies
By study LncRNA Xist successfully illustrate Xist make x chromosome inactivation the mechanism of action (Engreitz J M,
Pandyajones A,Mcdonel P,et al.The Xist lncRNA exploits three-dimensional
genome architecture to spread across the X-chromosome[J].Science,2013,341
(6147):L35-L38.).The important function that non-coding RNA is played in post-transcriptional level, researcher are further recognized with people
RAP technologies are carried out constantly it is perfect, it is intended to illustrate lncRNA in body with endogenous RNA, the interaction of protein.
2014, Engreitz J M and its colleagues with RAP technical research small nuclear RNA U1 and lncRNA Malat1 with it is preceding
The mechanism of action of body mRNA interactions.By using different cross-linking reagents and cross linking conditions, improved RAP technologies can further grind
Study carefully internal RNA-RNA interactions and RNA positioning on chromosome and participation transcriptional control (Engreitz J,
Sirokman K,Mcdonel P,et al.RNA-RNA Interactions Enable Specific Targeting of
Noncoding RNAs to Nascent Pre-mRNAs and Chromatin Sites[J].Cell,2014,159(1):
188-99.)。
However, existing RAP technologies can adsorb nonspecific nucleic acid and protein, probe groups and RNA hybridization because of magnetic bead
The problems such as Product recycling such as inefficient, nucleic acid and protein is inefficient and have the shortcomings that specific low, sensitivity is not good.
The content of the invention
In view of this, it is necessary to for above-mentioned problem, there is provided a kind of RNA antisenses purification process.
To achieve these goals, the present invention is adopted the following technical scheme that：
A kind of RNA antisenses purification process, comprises the steps of：
S1, the crosslinking of cell, cracking and the digestion of genomic DNA, obtain RNA sample；
The preparation of S2, probe groups solution：To mix after each probe dissolving of biotin labeling, be denatured 3min in 85 DEG C, soon
Speed transfer ice bath, obtains probe groups solution；
S3, magnetic bead pretreatment：Streptavidin mark is closed using BSA (bovine serum albumin(BSA)) and random oligonucleotide primer
The magnetic bead of note；
The preparation of S4, probe groups-bead complexes：Probe groups solution is added in pretreated magnetic bead, is visited
Pin group-bead complexes；
S5, antisense purifying：To probe groups-bead complexes are added in RNA sample, 65 DEG C are denatured 10min, 37 DEG C, 42 DEG C
It is each with 45 DEG C to wash 2 times, 5min is washed every time, obtain RNA- probe groups-bead complexes；
The wash-out of S6, RNA：RNA ElutionBuffer are added to mix RNA- probe groups-bead complexes, 95 DEG C add
Hot 2min, collects supernatant, to Proteinase K Buffer and Proteinase K are added in supernatant, incubates digestion and is washed
RNA after de-；
The purifying of S7, RNA：Mixed to the phenol chloroform-isoamyl alcohol mixed liquor of the elution volume such as addition in the RNA after wash-out
It is even, upper strata aqueous phase is collected by centrifugation, 5M NaCl solutions, glycogen and absolute ethyl alcohol are added in Xiang Shuixiang, -80 DEG C are sunk after mixing
Formed sediment 1~16h, and supernatant is abandoned in centrifugation, adds 80% ethanol of precooling, and supernatant is abandoned in centrifugation, is stored at room temperature air-dried, is added without RNase water,
65 DEG C of incubation 15min.
Preferably, about 1 × 10 is taken in step S18Individual cell, washed once after removal culture medium with PBS, carry out ultraviolet friendship
Connection, to added in cell after crosslinking the PBS of 15ml precoolings and it is of short duration be placed on ice, collect cell, 4 DEG C of 400g centrifugation 3min are collected
Cell precipitation；To Lysis Buffer, 5 μ l RNase Inhibitor that 1.4ml precoolings are added in cell precipitation, fully piping and druming
Cracking, twitches and mixes 3 times, and ice bath stands cracking 10min, to adding 4.8 μ l DNase Salt Stock, 15 μ l in lysate
DNase, 37 DEG C of incubation 10min；Transfer sample to ice bath environment, rapidly join 20 μ l 0.5M EDTA, 10 μ l 0.5M EGTA,
5 μ l 1M DTT are simultaneously fully mixed；Isometric 2 × Hybridization Buffer are added, is stood on ice after fully mixing
10min；4 DEG C of 16000g are centrifuged 10min, and transfer supernatant is to newly without in RNase centrifuge tubes, -80 DEG C save backup.
Preferably, 1 × TES of every probe is configured to 100 times of probe solutions of nmol in step S2, and all probes are molten
Liquid mixes, and takes 5 μ l mixed liquor degenerative treatments.
Preferably, the method for step S3 magnetic beads pretreatment is：With the 1ml 10mM Tris-HCl resuspended magnetic beads of pH7.5, top
Magnetic bead is collected after mixing on magnetic frame and removes supernatant, repeat washing 2 times；It is resuspended with 1ml1 × Hybridization Buffer
Magnetic bead, collects magnetic bead and removes supernatant after reverse mixing on magnetic frame；Contain BSA and oligonucleotides with power traction to addition 1ml in magnetic bead again
1 × TES of thing, TES solution is removed after incubation at room temperature 30min.
Preferably, the concentration of BSA is 0.05~0.5wt% in TES in step S3, and the concentration of random oligonucleotide primer is
10~20 μm of ol/L.
Preferably, random oligonucleotide primer is the DNA sequence dna within 20bp in step S3.
Preferably, the method that step S4 prepares probe-bead complexes is：Probe groups solution is added into pretreated magnetic
In pearl, and 100 μ l 2 × TES, 25 DEG C of gentle rotation mixing 30min are added, magnetic bead is collected on magnetic frame and removes supernatant；Use 0.35ml
1 × TES washings magnetic bead twice, removes TES.
Preferably, to probe groups-bead complexes are added in RNA sample in step S5,65 DEG C incubate denaturation 10min, use
37 DEG C of the Wash Buffer containing 0.5mM PMSF, 42 DEG C, 45 DEG C of respectively washing 2 times, wash standing on 5min and magnetic frame every time
1min collects magnetic bead and abandons supernatant；With 500 μ l Wash Buffer suspension magnetic beads, 35 DEG C of shake 2~4min of washing, receipts on magnetic frame
Collection magnetic bead simultaneously removes supernatant, and repeated washing 3~6 times, obtains RNA- probe groups-bead complexes.
Preferably, in step S6 to adding 50 μ l RNA Elution Buffer to fill in RNA- probe groups-bead complexes
Divide after mixing, 95 DEG C of heating 2min, magnetic bead is collected on magnetic frame and supernatant is shifted to newly without in RNase centrifuge tubes, repetition is above-mentioned
Step is once；Again to 25 μ l 5 × Proteinase K buffer, 1 μ g Proteinase K is added in supernatant, 50 DEG C incubate
Digestion 1h.
Preferably, the purification process of RNA is in step S7：To the benzene of the elution volume such as addition in the RNA sample after wash-out
Phenol-chloroform-isoamyl alcohol mixed liquor, overturns and mixes 15s；4 DEG C of centrifugation 10min of 13000g, collect upper strata aqueous phase, are transferred to new nothing
In RNase centrifuge tube；20 μ l 5M NaCl, 2 μ l Glycogen, 600 μ l absolute ethyl alcohols are added in Xiang Shuixiang, it is fully reverse mixed
- 80 DEG C of 1~16h of precipitation after even；4 DEG C of 16100g are centrifuged 30min, abandon supernatant；Add 80% ethanol of 1ml precoolings, 4 DEG C of 16100g
Centrifugation 10min, abandons supernatant；It is stored at room temperature air-dried 10min；Add 20~30 μ l RNase-free water, 65 DEG C of incubations
15min。
Compared with prior art, the present invention has the advantages that：
1. the present invention reduces the non-specific of magnetic bead by closing magnetic bead using BSA and random oligonucleotide primer in advance
Property absorption.The size of BSA and random oligonucleotide primer is just right, can close the specificity of magnetic bead Enhancement test, again will not
Combination that is excessive and influenceing probe and RNA.
2. magnetic bead is incubated with probe first in the present invention, is incubated with RNA again after removal excess probes, excess probe sealed joint
Mould Avidin and the non-specific binding of protein, nucleic acid etc., improve detection specificity, and sensitivity is high；Through gradient temperature after hybridization
Degree repeatedly washing, it is ensured that the abundant bonding probes of magnetic bead and combining target RNA, improves hybridization efficiency.
Brief description of the drawings
Fig. 1 is the agarose gel electrophoresis figure of purifying RNA sample in embodiment 1.Swimming lane 1 is Maker, and swimming lane 2 is purifying
RNA sample afterwards.
Fig. 2 is the agarose gel electrophoresis figure of detection miRNA in embodiment 1.Figure a is result figure of the present invention, and figure b is contrast
The experimental result picture of example 1, figure c is the experimental result picture of comparative example 2.Swimming lane 1 is Maker, and swimming lane 2 is input groups (10%)；Swimming lane 3
It is experimental group；Swimming lane 4 is NC groups.
Fig. 3 is the agarose gel electrophoresis figure of purifying RNA sample in embodiment 2.Swimming lane 1 is Maker, and swimming lane 2 is purifying
RNA sample afterwards.
Fig. 4 is the agarose gel electrophoresis figure of detection lincRNA in embodiment 2.Figure a is result figure of the present invention, and figure b is right
The experimental result picture of ratio 1, figure c is the experimental result picture of comparative example 2.Swimming lane 1 is Maker, and swimming lane 2 is input groups (10%)；Swimming lane
3 is experimental group；Swimming lane 4 is NC groups.
Specific embodiment
In order to better illustrate the present invention, it is described further with reference to the accompanying drawings and detailed description.In the present invention
Agents useful for same or instrument can be bought by market, and detection method for using etc. is all known in the art, be will not be repeated here.
Embodiment 1
CTNNB1 is the mRNA for encoding the albumen of catenin beta 1, and species are the mankind.Carry out for CTNNB1 mRNA
RAP is tested, and target gene is hsa-miR-214.The design of probe and with biotin labeling method be those skilled in the art institute it is ripe
Know, will not be repeated here.Streptavidin is coupled at magnetic bead (BeaverBeadsTMStreptavidin, castor biotechnology
Co., Ltd) on, and with desthiobiotin affine combination；RNA and magnetic bead-rna probe are incubated, can will be non-specific by washing
Property the removal such as combination RNA；Finally, then with eluent (being directed to Streptavidin) eluted, RNA classes can be verified after purification
Type.Comprise the following steps that：
S1, the crosslinking of cell, cracking and the digestion of genomic DNA, obtain RNA sample
S11, culture and collection cell
CCL-RAP cell culture or PAR-CL cell culture modes are used in the present embodiment.Using 15cm Tissue Culture Dish
Culture, the culture of cCL-RAP cells uses DMEM containing 10v/v%FCS, the culture of PAR-CL cells using contain 100 μM of 4SU and
10v/v%FCS DMEM.Per ware about 2 × 10 at the end of culture7Individual cell, every time experiment needs 5 ware cells, altogether about 1 × 108
Individual cell.
S12, crosslinking cell
After removal culture medium, after adding 0.3ml PBS, shake washed once in culture dish, fully removal remnants PBS are simultaneously
Culture dish is placed on ice；Culture dish is placed in uviol lamp 10~15cm distances, 0.15J cm2254nm UV are crosslinked about 1min
(cCL), or 365nm UV be crosslinked about 1min (4SU-labeled, PAR-CL).After crosslinking terminates, add in culture dish as early as possible
Enter the PBS of 15ml precoolings and of short duration be statically placed on ice；Collection cell is scraped with cell；4 DEG C of 400g centrifugations 3min collect cell precipitation,
Removal supernatant.
S13, cell lysis
To Lysis buffer, the 5 μ l RNase Inhibitor of addition 1.4ml precoolings in cell precipitation, and fully blow
Play fully cracking；Using 0.4mm syringe needle gauge injection devices, twitch and mix 3 times, ice bath stands cracking 10min；Lysate sample is immediately
Using or -80 DEG C preserve one week and interior use.
S14, digested genomic dna
To 4.8 μ l 1 × DNase salt stock, 15 μ l DNase (20U) are added in cell pyrolysis liquid, 37 DEG C incubate
10min；Transfer sample rapidly joins 20 μ l 0.5M EDTA, 10 μ l 0.5M EGTA, 5 μ l 1M DTT and fills to ice bath environment
Divide and mix；It is four pipes that cell pyrolysis liquid is pressed into 0.5ml, 0.5ml, 0.2ml and 0.05ml point, respectively indicate the sample of experimental group 1,
The sample of experimental group 2 (parallel test), NC groups sample and input group samples；To being separately added into NC groups and each experimental group sample
Volume 2 × Hybridization Buffer, 10min is stood after fully mixing on ice；In 4 DEG C of 16,000g centrifugation 10min transfers
Clearly to newly without in RNase centrifuge tubes；- 80 DEG C of NC groups, input groups and each experimental group sample are saved backup.
The preparation of S2, probe groups solution：To mix after each probe dissolving of biotin labeling, be denatured 3min in 85 DEG C, soon
Speed transfer ice bath, obtains probe groups solution.In the present embodiment, the probe groups of experimental group contain 8 probes, and the probe groups of NC groups contain
There are 3 probes.Particular sequence is as shown in Table 1 and Table 2.
Table 1, experimental group probe sequence
Table 2, NC group probe sequences
The preparation of probe groups solution is illustrated by taking experimental group as an example：To in each bar probe add 100 times the 1 of nmol number μ l ×
TE, if probe is the powder of 1nmol, then adds the TE of 100 μ l, is fully vortexed after mixing after micro- centrifugation, is transferred to same
In centrifuge tube, add 1 × TE to adjust every concentration and probe concentration for 10pmol/ μ l, obtain probe mixed liquor；5 μ l probe mixed liquors are taken,
Wherein every probe content is 50pmol, and probe total amount is n × 50pmol, and n is number of probes；After 85 DEG C of denaturation 3min, quickly
Transfer ice bath, obtains experimental group probe groups solution.NC group probe groups solution can be prepared using identical method.
S3, magnetic bead pretreatment：The magnetic bead of marked by streptavidin is closed using BSA and random oligonucleotide primer.
Magnetic bead concentration is 400pmol/100 μ l, 1pmol magnetic beads is needed per 1pmol probes, by n (number of probes) × 100 μ
L/ (400pmol/50pmol) Streptavidin MagneSphere standard, is that experimental group prepares magnetic bead, magnetic bead is collected on magnetic frame and is gone
Clearly；After adding 1ml 10mM Tris-HCl pH 7.5 fully resuspended, overturn and mix 10 times, magnetic bead is collected on magnetic frame and is gone
Clearly, repeated washing 2 times；After adding 1 × Hybridization of 1ml Buffer fully resuspended, overturn and mix 10 times, magnetic frame
Collect magnetic bead and remove supernatant.Add 1ml containing 0.05~0.5wt%BSA and 10~20 μm of ol/L oligonucleotides with power traction to magnetic bead
1 × TES of thing, is placed in removal TES solution on magnetic frame after incubation at room temperature 30min.NC groups can be prepared using identical method
Use magnetic bead.
The preparation of S4, probe groups-bead complexes：Probe groups solution is added in pretreated magnetic bead, is visited
Pin group-bead complexes.
The experimental group probe groups solution that will be prepared adds experimental group to use in pretreated magnetic bead, and the μ l 2 of addition 100 ×
TES, 25 DEG C of gentle mixing 30min of rotation, collects magnetic bead and removes supernatant on magnetic frame, add 1 × TES of 0.35ml, gentle rotation
Washing magnetic bead, is placed in and cleaning solution is removed on magnetic frame, and repeated washing once, obtains experimental group probe groups-bead complexes.Adopt
NC groups probe groups-bead complexes are prepared with identical method.
S5, antisense purifying
Experimental group probe groups-the bead complexes of preparation are added in experimental group sample；65 DEG C of incubations on vertical vortex mixer
Denaturation 10min, 37 DEG C are incubated hybridization 180min, and 37 DEG C of washings are washed 2 times, 45 DEG C for 2 times, 42 DEG C and washed 2 times, vertical mixing every time
Wash Buffer are used in device shake washing 5min, washing, using being preceding preheating to corresponding wash temperature and add 0.5mM PMSF,
1min collection magnetic beads are stood on magnetic frame abandon supernatant after washing；Last time adds 500 μ l Wash Buffer to hang after washing
Floating magnetic bead, on magnetic frame collects magnetic bead and removes supernatant after 35 DEG C of 2~4min of shake washing, and repeats 3~6 times, obtains experimental group
With RNA- probe groups-bead complexes.NC groups RNA- probe groups-bead complexes are prepared using identical method.
The wash-out of S6, RNA
Experimental group RNA- probe groups-bead complexes sample magnetic bead adds 50 μ l RNA Elution Buffer abundant
After mixing, 95 DEG C of heating 2min；Magnetic frame collects magnetic bead and shifts supernatant in newly without RNase centrifuge tubes, repeats the above steps
Once；25 μ l 5 × Proteinase K buffer, 1 μ g Proteinase K are added, 50 DEG C incubate digestion 1h, are tested
RNA sample after group wash-out.Using identical method wash-out NC groups RNA- probe groups-bead complexes, NC groups use is obtained
RNA sample after wash-out.
To adding 25 μ l 5 × Proteinase K buffer, 1 μ g Proteinase K, 50 μ l in input group samples
RNA Elution Buffer, 50 DEG C incubate digestion 1h, obtain input group RNA samples.
The purifying of S7, RNA
(125 μ l) phenol chloroform-isoamyl alcohol of the elution volume such as addition is mixed in RNA sample after being eluted to experimental group
Liquid is closed, is overturned and is mixed 15s；4 DEG C of centrifugation 10min of 13000g, collect upper strata aqueous phase and are transferred to new without in RNase centrifuge tube；Plus
Enter 20 μ l 5M NaCl, 2 μ l Glycogen, 600 μ l absolute ethyl alcohols, -80 DEG C of 1~16h of precipitation after fully reverse mixing；4℃
16100g is centrifuged 30min, abandons supernatant；80% ethanol of 1ml precoolings is added, 4 DEG C of 16100g are centrifuged 10min, abandon supernatant；Room temperature is quiet
Put air-dried 10min；20~30 μ l RNase-free water are added, is stood preserve on ice；65 DEG C of incubation 15min, fully dissolving
RNA and removal residual DNA enzymatic activity, obtain experimental group sample after purification.After being eluted using identical method treatment NC groups
RNA sample and input group RNA samples, respectively obtain NC groups sample and input group samples after purification.
MiRNA detections are carried out to RNA sample after purification, specific method is as follows.Take 5 μ l RNA samples and carry out 1.5%
Agarose gel electrophoresis detects RNA concentration effects, and as a result display detects obvious RNA enrichments (such as Fig. 1).Take 2 μ l RNA samples
Product Agilent 2100 detects RNA concentration and clip size scope, and the RNA concentration that testing result display enrichment is obtained is 6.9ng/
μ l, magnitude range is 200~700bp, within normal range (NR).Take 2 μ l RNA samples nanodrop detection RNA purity and dense
Degree, as a result shows that its purity is：OD260/280 is 1.91, concentration be 8.9ng/ μ l, testing result is close twice, illustrate into
Work(completes the enrichment and purifying of RNA.
In order to better illustrate effect of the invention, inventor has also carried out two groups of controls, and control group 1 uses conventional method
(Jesse Engreitz.RNA Antisense Purification(RAP):Experimental Protocols.2014.)
Detection has-MiR-214 genes；Control group 2 detects internal reference U6 genes using RAP kits of the present invention.
Use QiagenmiScript Reverse Transcription Kit (218061) reverse transcribing RNA samples, tool
Body method refers to Reverse Transcriptase kit specification；20 μ l PCR amplification systems are configured with reference to 2 × Taq PCR kits specification,
Enter performing PCR amplification, take 5~10 μ l pcr amplification products and carry out agarose gel electrophoresis (2%~3%), as a result as shown in Figure 2.
Target gene hsa-miR-214 expanding fragment lengths are for about 90bp (Fig. 2 a), compared with the result of control group 1 (Fig. 2 b), are in
Correct scope, but have more preferable concentration and purity than conventional method.F primer sequences are ACAGCAGGCACAGACAGGCAG (SEQ
ID NO：12), R primers carry primer for kit.U6 expanding fragment lengths are 94bp, F primer sequences in control group 2 (Fig. 2 c)
For：CTCGCTTCGGCAGCACA(SEQ ID NO：13)；R primer sequences are：AACGCTTCACGAATTTGCGT(SEQ ID
NO：14).
Embodiment 2
SENP1 is the mRNA for encoding the albumen of SUMO1/sentrin specific peptidase 1, and species are the mankind.Pin
Carry out RAP experiments to SENP1mRNA, target gene is lincRNA-p21.
S1, the crosslinking of cell, cracking and the digestion of genomic DNA, obtain RNA sample.Specific method and the phase of embodiment 1
Together.
The preparation of S2, probe groups solution：In addition to the sequence difference of experimental group probe groups, the present embodiment middle probe group solution
The specific method of preparation is same as Example 1.
In the present embodiment, the probe groups of experimental group contain 10 probes, and the probe groups of NC groups contain 3 probes (with implementation
Example 1 is identical).Particular sequence is as shown in table 3.
Table 1, experimental group probe sequence
S3, magnetic bead pretreatment：It is same as Example 1.
The preparation of S4, probe groups-bead complexes：It is same as Example 1.
S5, antisense purifying：It is same as Example 1.
The wash-out of S6, RNA：It is same as Example 1.The purifying of S7, RNA：It is same as Example 1.
In order to better illustrate effect of the invention, inventor has also carried out two groups of controls, and control group 1 uses conventional method
(Jesse Engreitz.RNA Antisense Purification(RAP):Experimental Protocols.2014.)
Detection lincRNA-p21 genes；Control group 2 detects GAPDH genes using RAP kits of the present invention.
LincRNA detections are carried out to RNA sample after purification, specific method is as follows.Take the development of 5 μ l RNA samples
1.5% agarose gel electrophoresis detects RNA concentration effects, and as a result display detects obvious RNA enrichments (result such as Fig. 3 institutes
Show)；2 μ l RNA samples Agilent 2100 detection RNA concentration and clip size scope are taken, testing result display enrichment is obtained
RNA concentration is 8.9ng/ μ l, and magnitude range is 500~3000bp within normal range (NR)；Take 2 μ l RNA samples nanodrop
Detection RNA purity and concentration, as a result show that its purity is：OD260/280 is 1.94, and concentration is 10.2ng/ μ l, twice detection knot
Fruit proves to be successfully completed the enrichment and purifying of RNA.
(TaKaRa PrimeScript II 1st Strand cDNA Synthesis Kit (D6210A)) is used to reverse
Record RNA sample, specific method refers to Reverse Transcriptase kit specification；20 μ l are configured with reference to 2 × Taq PCR kits specification
PCR amplification system, enters performing PCR amplification, takes 5~10 μ l amplified productions and carries out agarose gel electrophoresis (2%~3%), as a result such as
Shown in Fig. 4.Target gene lincRNA-p21 expanding fragment lengths are 156bp (Fig. 4 a), compared with conventional method (Fig. 4 b), knot
Fruit is in correct scope, but has the band for becoming apparent from than conventional method, and more preferably, primer sequence is for concentration and purity：F is
TGCAGAGCGTTTTGTTTGTC(SEQ ID NO：25)；R is CAGCCTCTGGGAAGAAAATG (SEQ ID NO：26).Control
GAPDH expanding fragment lengths are 189bp (Fig. 4 c), and primer sequence is：F is CGGCTACTAGCGGTTTTACG (SEQ ID NO：
27)；R is AAGAAGATGCGGCTGACTGT (SEQ ID NO：28).
Embodiment described above only expresses several embodiments of the invention, and its description is more specific and detailed, but simultaneously
Therefore the limitation to the scope of the claims of the present invention can not be interpreted as.It should be pointed out that for one of ordinary skill in the art
For, without departing from the inventive concept of the premise, various modifications and improvements can be made, these belong to guarantor of the invention
Shield scope.Therefore, the protection domain of patent of the present invention should be determined by the appended claims.
Sequence table
<110>Guangzhou Bai Xin bio tech ltd
<120>A kind of RNA antisenses purification process
<160>28
<170>PatentIn version 3.3
<210>1
<211>71
<213>It is artificial synthesized
<400>1
ccatcaaatc agcttgagta gccattgtcc acgctggatt ttcaaaacag ttgtatggta 60
tacttcaaat a 71
<210>2
<211>68
<213>It is artificial synthesized
<400>2
tttcagcatc tgtgatggtt cagccaaacg ctggacatta gtgggatgag cagcatcaaa 60
ctgtgtag 68
<210>3
<211>67
<213>It is artificial synthesized
<400>3
gccataagct aaaatttgaa ggcagtctgt cgtaatagcc aagaatttaa catttgtttt 60
gttgagc 67
<210>4
<211>69
<213>It is artificial synthesized
<400>4
gaagctgaac aagagtccca aggagacctt ccatcccttc ctgtttagtt gcagcatctg 60
aaagattcc 69
<210>5
<211>67
<213>It is artificial synthesized
<400>5
gttttcaatg ggagaataaa gcagctgcac aaacaatgga atggtattta gtcctctgat 60
aacaatt 67
<210>6
<211>70
<213>It is artificial synthesized
<400>6
gatatccaag gggttctccc tgggcaccaa tatcaagtcc aagatcagca gtctcattcc 60
aagccattgg 70
<210>7
<211>69
<213>It is artificial synthesized
<400>7
gatccattct tgtgcattct tcacttcttg agtcactccc aaaatccatt tgtattgtta 60
ctcctcgac 69
<210>8
<211>67
<213>It is artificial synthesized
<400>8
aaactgtcca aaacaaggtt ccaaataaca cctcttactg atttacccta cccatacata 60
tcccaaa 67
<210>9
<211>68
<213>It is artificial synthesized
<400>9
caaacggcgg attgaccgta atgggatagg tcacgttggt gtagatgggc gcatcgtaac 60
cgtgcatc 68
<210>10
<211>67
<213>It is artificial synthesized
<400>10
caccacatac aggccgtagc ggtcgcacag cgtgtaccac agcggatggt tcggataatg 60
cgaacag 67
<210>11
<211>67
<213>It is artificial synthesized
<400>11
ccaatccgcg ccggatgcgg tgtatcgctc gccacttcaa catcaacggt aatcgccatt 60
tgaccac 67
<210>12
<211>21
<213>It is artificial synthesized
<400>12
acagcaggca cagacaggca g 21
<210>13
<211>17
<213>It is artificial synthesized
<400>13
ctcgcttcgg cagcaca 17
<210>14
<211>20
<213>It is artificial synthesized
<400>14
aacgcttcac gaatttgcgt 20
<210>15
<211>67
<213>It is artificial synthesized
<400>15
tttctgatgg tggcactagc gatatcacat ctcagggaga taccacagag taggagagtt 60
ggagaaa 67
<210>16
<211>70
<213>It is artificial synthesized
<400>16
gtgagtcttt caaagtattt ttactggaac taagacatcg agacaggtgt aaaggaaaat 60
gtgtggtggg 70
<210>17
<211>68
<213>It is artificial synthesized
<400>17
aagtagaact gggagttgga gtctgggaat ctttcacttt cagtaaaatc acagagtctg 60
atccttca 68
<210>18
<211>67
<213>It is artificial synthesized
<400>18
aagcccttct ctttacttcg ctccatcagc atattcatgt agaaattgat gatctcatca 60
ttgagcc 67
<210>19
<211>71
<213>It is artificial synthesized
<400>19
agagtattct gcaggcttca ttgtttatcc cacccatgga gtcgtaatag gtaatattct 60
tctttctaaa g 71
<210>20
<211>67
<213>It is artificial synthesized
<400>20
tagacaacaa agagctggtc ccccacatgg tcaaggtctg ctaagtgaga cagtcttcac 60
aagagtt 67
<210>21
<211>68
<213>It is artificial synthesized
<400>21
ctggtggttt ttatccctac cttttgccca tgccctttcc tacttcttag taaggcctaa 60
caacaaga 68
<210>22
<211>69
<213>It is artificial synthesized
<400>22
aaacacccta ctcatagggg ctgggatctc tgtgtgctgg aatttggaaa atggaaataa 60
atctacagg 69
<210>23
<211>71
<213>It is artificial synthesized
<400>23
actaaacgag cttgtataaa acagtaaaat tttcaaataa gcccagggaa aaagcacaat 60
gctggaaaga a 71
<210>24
<211>68
<213>It is artificial synthesized
<400>24
cacctttcaa gttgttgctt acatacagta aataccaaga accagacaat attccaggag 60
tcctgcaa 68
<210>25
<211>20
<213>It is artificial synthesized
<400>25
tgcagagcgt tttgtttgtc 20
<210>26
<211>20
<213>It is artificial synthesized
<400>26
cagcctctgg gaagaaaatg 20
<210>27
<211>20
<213>It is artificial synthesized
<400>27
cggctactag cggttttacg 20
<210>28
<211>20
<213>It is artificial synthesized
<400>28
aagaagatgc ggctgactgt 20
Claims (10)
1. a kind of RNA antisenses purification process, it is characterised in that comprise the steps of：
S1, the crosslinking of cell, cracking and the digestion of genomic DNA, obtain RNA sample；
The preparation of S2, probe groups solution：To mix after each probe dissolving of biotin labeling, 3min is denatured in 85 DEG C, it is quick to turn
Ice bath is moved, probe groups solution is obtained；
S3, magnetic bead pretreatment：The magnetic bead of marked by streptavidin is closed using BSA and random oligonucleotide primer；
The preparation of S4, probe groups-bead complexes：Probe groups solution is added in pretreated magnetic bead, obtain probe groups-
Bead complexes；
S5, antisense purifying：To probe groups-bead complexes are added in RNA sample, 65 DEG C are denatured 10min, 37 DEG C, 42 DEG C and 45
DEG C each washing 2 times, washs 5min every time, obtains RNA- probe groups-bead complexes；
The wash-out of S6, RNA：RNA ElutionBuffer are added to mix RNA- probe groups-bead complexes, 95 DEG C of heating
2min, collects supernatant, to Proteinase K Buffer and Proteinase K are added in supernatant, incubates digestion and is eluted
RNA afterwards；
The purifying of S7, RNA：Mixed to phenol chloroform-isoamyl alcohol mixed liquor of the elution volume such as addition in the RNA after wash-out, from
The heart collects upper strata aqueous phase, and 5M NaCl solutions, glycogen and absolute ethyl alcohol are added in Xiang Shuixiang, and -80 DEG C of precipitations 1 after mixing~
Supernatant is abandoned in 16h, centrifugation, adds 80% ethanol of precooling, and supernatant is abandoned in centrifugation, is stored at room temperature air-dried, is added without RNase water, 65 DEG C
Incubate 15min.
2. RNA antisenses purification process according to claim 1, it is characterised in that about 1 × 10 is taken in step S18Individual cell,
Be washed once with PBS after removal culture medium, carry out it is UV-crosslinked, to adding the PBS of 15ml precoolings and of short duration in cell after crosslinking
It is placed on ice, collects cell, 4 DEG C of 400g centrifugations 3min collects cell precipitation；To addition 1.4ml precoolings in cell precipitation
Lysis Buffer, 5 μ l RNase Inhibitor, fully piping and druming cracking, twitch and mix 3 times, and ice bath stands cracking 10min,
To 4.8 μ l DNase Salt Stock, 15 μ l DNase are added in lysate, 37 DEG C incubate 10min；Shift sample to ice bath
Environment, rapidly joins 20 μ l 0.5M EDTA, 10 μ l 0.5M EGTA, 5 μ l 1M DTT and fully mixes；Add isometric 2 ×
Hybridization Buffer, 10min is stood after fully mixing on ice；4 DEG C of 16000g are centrifuged 10min, and transfer supernatant is to new
Without in RNase centrifuge tubes, -80 DEG C save backup.
3. RNA antisenses purification process according to claim 1, it is characterised in that every probe is with 1 × TES in step S2
100 times of probe solutions of nmol are configured to, all probe solutions are mixed, take 5 μ l mixed liquor degenerative treatments.
4. RNA antisenses purification process according to claim 1, it is characterised in that the method for step S3 magnetic beads pretreatment is：
With the 1ml 10mM Tris-HCl resuspended magnetic beads of pH7.5, collect magnetic bead on magnetic frame after reverse mixing and remove supernatant, repeat washing
2 times；With 1 × Hybridization of 1ml resuspended magnetic beads of Buffer, collect magnetic bead on magnetic frame after reverse mixing and remove supernatant；Again
To 1 × TESs of the 1ml containing BSA and random oligonucleotide primer is added in magnetic bead, TES solution is removed after incubation at room temperature 30min.
5. RNA antisenses purification process according to claim 4, it is characterised in that the concentration of BSA is in TES in step S3
0.05~0.5wt%, the concentration of random oligonucleotide primer is 10~20 μm of ol/L.
6. RNA antisenses purification process according to claim 4, it is characterised in that random oligonucleotide primer in step S3
It is the DNA sequence dna within 20bp.
7. RNA antisenses purification process according to claim 1, it is characterised in that step S4 prepares probe-bead complexes
Method be：During probe groups solution added into pretreated magnetic bead, and add 100 2 × TES of μ l, 25 DEG C of gentle rotation mixing
30min, collects magnetic bead and removes supernatant on magnetic frame；Magnetic bead is washed with 0.35ml1 × TES twice, TES is removed.
8. RNA antisenses purification process according to claim 1, it is characterised in that visited to being added in RNA sample in step S5
Pin group-bead complexes, 65 DEG C incubate denaturation 10min, with 37 DEG C, 42 DEG C, 45 DEG C of the Wash Buffer containing 0.5mM PMSF
It is each to wash 2 times, 1min collection magnetic beads are stood on each washing 5min and magnetic frame and abandons supernatant；It is outstanding with 500 μ l Wash Buffer
Floating magnetic bead, 35 DEG C of shake 2~4min of washing, collects magnetic bead and removes supernatant on magnetic frame, and repeated washing 3~6 times, obtains RNA-
Probe groups-bead complexes.
9. RNA antisenses purification process according to claim 1, it is characterised in that to RNA- probe groups-magnetic bead in step S6
After adding 50 μ l RNA Elution Buffer fully to mix in compound, 95 DEG C of heating 2min collect magnetic bead simultaneously on magnetic frame
Transfer supernatant repeats the above steps once in newly without RNase centrifuge tubes；Again to adding 25 5 × Proteinase of μ l in supernatant
K buffer, 1 μ g Proteinase K, 50 DEG C incubate digestion 1h.
10. RNA antisenses purification process according to claim 1, it is characterised in that the purification process of RNA is in step S7：
To the phenol chloroform-isoamyl alcohol mixed liquor of the elution volume such as addition in the RNA sample after wash-out, overturn and mix 15s；13000g
4 DEG C of centrifugation 10min, collect upper strata aqueous phase, are transferred to new without in RNase centrifuge tube；20 μ l 5M NaCl, 2 μ are added in Xiang Shuixiang
L Glycogen, 600 μ l absolute ethyl alcohols, -80 DEG C of 1~16h of precipitation after fully reverse mixing；4 DEG C of 16100g are centrifuged 30min, abandon
Supernatant；80% ethanol of 1ml precoolings is added, 4 DEG C of 16100g are centrifuged 10min, abandon supernatant；It is stored at room temperature air-dried 10min；Add 20
~30 μ l RNase-free water, 65 DEG C of incubation 15min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710074375.6A CN106754891A (en) | 2017-02-10 | 2017-02-10 | A kind of RNA antisenses purification process |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710074375.6A CN106754891A (en) | 2017-02-10 | 2017-02-10 | A kind of RNA antisenses purification process |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106754891A true CN106754891A (en) | 2017-05-31 |
Family
ID=58956465
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710074375.6A Pending CN106754891A (en) | 2017-02-10 | 2017-02-10 | A kind of RNA antisenses purification process |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106754891A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108949750A (en) * | 2018-08-17 | 2018-12-07 | 上海锐翌生物科技有限公司 | Extract the method and kit of faeces DNA |
| CN111607588A (en) * | 2019-02-25 | 2020-09-01 | 上海印序生物科技有限公司 | Annular RNA rapid enrichment kit and method |
| CN114507667A (en) * | 2022-04-20 | 2022-05-17 | 天津欧德莱生物医药科技有限公司 | Probe for specifically enriching miRNA in excrement, application and method |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106168625A (en) * | 2016-08-03 | 2016-11-30 | 广州伯信生物科技有限公司 | A kind of RNA pulldown method and test kit |
| CN106191296A (en) * | 2016-08-31 | 2016-12-07 | 广州伯信生物科技有限公司 | A kind of chromatin isolation technics of RNA purification |
-
2017
- 2017-02-10 CN CN201710074375.6A patent/CN106754891A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106168625A (en) * | 2016-08-03 | 2016-11-30 | 广州伯信生物科技有限公司 | A kind of RNA pulldown method and test kit |
| CN106191296A (en) * | 2016-08-31 | 2016-12-07 | 广州伯信生物科技有限公司 | A kind of chromatin isolation technics of RNA purification |
Non-Patent Citations (2)
| Title |
|---|
| CI CHU等: "Chromatin Isolation by RNA Purification (ChIRP)", 《JOURNAL OF VISUALIZED EXPERIMENTS》 * |
| 周德建等: "利用CLIP技术研究蛋白质和RNA的相互作用", 《生命科学》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108949750A (en) * | 2018-08-17 | 2018-12-07 | 上海锐翌生物科技有限公司 | Extract the method and kit of faeces DNA |
| CN111607588A (en) * | 2019-02-25 | 2020-09-01 | 上海印序生物科技有限公司 | Annular RNA rapid enrichment kit and method |
| CN114507667A (en) * | 2022-04-20 | 2022-05-17 | 天津欧德莱生物医药科技有限公司 | Probe for specifically enriching miRNA in excrement, application and method |
| CN114507667B (en) * | 2022-04-20 | 2022-08-02 | 天津欧德莱生物医药科技有限公司 | Probe for specifically enriching miRNA in excrement, application and method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11884963B2 (en) | Methods of depleting a target molecule from an initial collection of nucleic acids, and compositions and kits for practicing the same | |
| US8278035B2 (en) | Method and substances for isolating miRNAs | |
| US6812341B1 (en) | High efficiency mRNA isolation methods and compositions | |
| JP6963505B2 (en) | Solid phase nucleic acid target capture and replication using strand-substituted polymerases | |
| CN104350152B (en) | Selective kernel acid fragment is reclaimed | |
| US9809847B2 (en) | Methods and compositions for detecting polynucleotides and fragments thereof | |
| US20220056512A1 (en) | Methods of Depleting a Target Nucleic Acid in a Sample and Kits for Practicing the Same | |
| CN106754891A (en) | A kind of RNA antisenses purification process | |
| WO2012083832A1 (en) | Method for enriching prokaryotic mrna and use thereof | |
| EP2137321A1 (en) | Methods for detecting a target nucleotide sequence in a sample utilising a nuclease-aptamer complex | |
| JP2016529914A (en) | Application of oligo-dT molecules to avoid the formation of high molecular weight PCR products induced by poly A-carriers | |
| WO2011157617A1 (en) | Complex set of mirna libraries | |
| US8846350B2 (en) | MicroRNA affinity assay and uses thereof | |
| Dausse et al. | In vitro selection procedures for identifying DNA and RNA aptamers targeted to nucleic acids and proteins | |
| CN206467218U (en) | A kind of RNA antisenses purification kit | |
| JP2021093985A (en) | Nucleic acid molecules that bind to methane-producing bacteria and methods, kits and reagents for detecting methane-producing bacteria using nucleic acid molecules |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170531 |