WO2011157617A1

WO2011157617A1 - Complex set of mirna libraries

Info

Publication number: WO2011157617A1
Application number: PCT/EP2011/059557
Authority: WO
Inventors: Markus Beier
Original assignee: Febit Holding Gmbh
Priority date: 2010-06-17
Filing date: 2011-06-09
Publication date: 2011-12-22

Abstract

The invention discloses methods for the amplification of RNA species, therefore enabling ultrasensitive detection and analysis for theses species of interest. Furthermore, this invention can be employed in a preparative way.

Description

COMPLEX SETS OF MIRNA-LIBRARIES

TECHNICAL FIELD OF THE INVENTION

The preset invention relates to analytical and preparative methods for small non-coding RNAs, in particular miRNAs

BACKGROUND OF THE INVENTION

MicroRNAs, or miRNAs, are increasingly being accepted as playing a crucial regulatory role in normal and dysfunctional cellular processes. They represent a class of small, noncoding RNA molecules, which have been shown to be involved in almost every human pathology currently under study. From tumor progression and viral host interactions, to immune response and stem cell fate determination, miRNAs are quickly growing in importance as the "master regulators" in cell cycle processes. miRNAs are a class of non-coding RNAs of between 17-27 bp in length. MiRNAs have been found not only in mammalian organisms, but also at lower developed organisms. A well- established repository for miRNAs is the miRBase at the Sanger Insitute (www.mirbase.org). Currently up to 1140 human miRNAs are known (miRBase version 15.0).

Is has been found that the miRNAs are expressed in a highly tissue-specific manner, which makes this class of RNAs especially suited for use as biomarkers in oncology and other diseases. Furthermore, miRNAs were identified also in a broad range of bodily fluids, making them useful for a broad range of diagnostic or prognostic applications.

In order to detect or analyse miRNAs and other classes of small non-coding RNAs serveral technologies are employed. For single-plex detection PCR, RT-PCR or Northern blots can employed. For multiplex detection, - hence parallel detection of a plurality or all miRNAs in a sample - microarrays (Agilent, LCSciences, Affymetrix, Illumina, ...) , bead-based methods (Illumina, Luminex) or next generation sequencing technologies (Illumina Genome Analyzer , ABI Solid, Roche 454) are well suited.

The inventors of the present invention assessed for the first time non-coding RNAs, in particular miRNAs in both analytical and preparative manner on solid supports. SUMMARY OF THE INVENTION

In a first aspect, the invention provides multiplex methods for high parallel detection and analysis of small non-coding RNA and/or miRNA species from a biological sample.

In a second aspect, the invention provides multiplex methods for high parallel preparative isolation of defined sets of small-non-coding RNAs and/or miRNAs from a biological sample.

In a third aspect, the invention provides multiplex methods for high parallel amplification of the antisense sequences of defined sets of small-non-coding RNAs and/or miRNAs from a biological sample.

In a fourth aspect, the invention provides multiplex methods for high parallel isolation and amplification of defined sets of small-non-coding RNAs and/or miRNAs from a biological sample.

In a fifth aspect, the invention provides solid supports for high parallel detection and analysis, isolation and amplificatin of sets of small non-coding RNA and/or miRNA species from a biological sample.

In a sixth aspect, the invention provides a method for miRNA expression analysis employing a multiplex primer extension assay on coded beads.

This summary of the invention does not necessarily describe all features of the invention. DETAILED DESCRIPTION OF THE INVENTION

Before the present invention is described in detail below, it is to be understood that this invention is not limited to the particular methodology, protocols and reagents described herein as these may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended claims. Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art.

In the following, the elements of the present invention will be described. These elements are listed with specific embodiments, however, it should be understood that they may be combined in any manner and in any number to create additional embodiments. The described examples and preferred embodiments should not be construed to limit the present invention to only the explicitly described embodiments. This description should be understood to support and encompass embodiments which combine the explicitly described embodiments with any number of the disclosed and/or preferred elements. Furthermore, any permutations and combinations of all described elements in this application should be considered disclosed by the description of the present application unless the context indicates otherwise.

Preferably, the terms used herein are defined as described in "A multilingual glossary of biotechnological terms: (IUPAC Recommendations)", H.G.W. Leuenberger, B. Nagel, and H. olbl, Eds., Helvetica Chimica Acta, CH-4010 Basel, Switzerland, (1995).

To practice the present invention, unless otherwise indicated, conventional methods of chemistry, biochemistry, and recombinant DNA techniques are employed which are explained in the literature in the field (cf, e.g., Molecular Cloning: A Laboratory Manual, 2^nd Edition, J. Sambrook et al. eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor 1989).

Several documents are cited throughout the text of this specification. Each of the documents cited herein (including all patents, patent applications, scientific publications, manufacturer's specifications, instructions, etc.), whether supra or infra, are hereby incorporated by reference in their entirety. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention.

Throughout this specification and the claims which follow, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.

As used in this specification and in the appended claims, the singular forms "a", "an", and "the" include plural referents, unless the content clearly dictates otherwise. For example, the term "a test compound" also includes "test compounds".

The term "non-coding RNA" refers to functional RNA molecule that is not translated into a protein. Less-frequently used synonyms are non-protein-coding RNA (npcRNA), non-messenger RNA (nmRNA), small non-messenger RNA (snmRNA), ftinctional RNA (fRNA). Non-coding RNAs include highly abundant and functionally important RNAs such as transfer RNA (tRNA) and ribosomal RNA (rRNA), as well as RNAs such as snoRNAs, microRNAs, siRNAs and piRNAs and the long ncRNAs. Small non-coding RNAs refer to shorter non-coding RNAs, preferably up to 500 bp, more preferably up to 150 bp, most preferably up to 75 bp.

The terms "microRNA" or "miRNA" refer to single-stranded RNA molecules of at least 10 nucleotides and of not more than 35 nucleotides covalently linked together. Preferably, the polynucleotides of the present invention are molecules of 10 to 33 nucleotides or 15 to 30 nucleotides in length, more preferably of 17 to 27 nucleotides or 18 to 26 nucleotides in length, not including optionally labels and/or elongated sequences (e.g. biotin stretches).

The miRNAs regulate gene expression and are encoded by genes from whose DNA they are transcribed, but miRNAs are not translated into protein (i.e. miRNAs are non-coding RNAs). The genes encoding miRNAs are longer than the processed mature miRNA molecules. The miRNAs are first transcribed as primary transcripts or pri-miRNAs with a cap and poly-A tail and processed to short, 70 nucleotide stem-loop structures known as pre-miRNAs in the cell nucleus. This processing is performed in animals by a protein complex known as the Microprocessor complex consisting of the nuclease Drosha and the double-stranded RNA binding protein Pasha. These pre-miRNAs are then processed to mature miRNAs in the cytoplasm by interaction with the endonuclease Dicer, which also initiates the formation of the RNA-induced silencing complex (RISC). When Dicer cleaves the pre-miRNA stem-loop, two complementary short RNA molecules are formed, but only one is integrated into the RISC. This strand is known as the guide strand and is selected by the argonaute protein, the catalytically active RNase in the RISC, on the basis of the stability of the 5' end. The remaining strand, known as the miRNA*, anti-guide (anti-strand), or passenger strand, is degraded as a RISC substrate. Therefore, the miRNA* s are derived from the same hairpin structure like the "normal" miRNAs. So if the "normal" miRNA is then later called the "mature miRNA" or "guide strand", the miRNA* is the "anti-guide strand" or "passenger strand". In the context of the present invention, the terms "miRNA" and "miRNA*" are interchangeable used.

The term "miRBase" refers to a well established repository of validated miRNAs. The miRBase (www.mirbase.org) is a searchable database of published miRNA sequences and annotation. Each entry in the miRBase Sequence database represents a predicted hairpin portion of a miRNA transcript (termed mir in the database), with information on the location and sequence of the mature miRNA sequence (termed miR). Both hairpin and mature sequences are available for searching and browsing, and entries can also be retrieved by name, keyword, references and annotation. All sequence and annotation data are also available for download. The term "antisense", as used herein, refers to nucleotide sequences which are complementary to a specific DNA or RNA sequence. The term "antisense strand" is used in reference to a nucleic acid strand that is complementary to the "sense" strand.The present invention may be employed to analyse miRNAs which are dysregulated in biological samples such as blood or tissue of patients in comparison to relevant controls.

The term "label", as used herein, means a composition detectable by spectroscopic, photochemical, biochemical, immunochemical, chemical, or other physical means. For example, useful labels include 32P, fluorescent dyes, electron-dense reagents, enzymes (e.g., as commonly used in an ELISA), biotin, digoxigenin, or haptens and other entities which can be made detectable. A label may be incorporated into nucleic acids at any position, e.g. at the 3' or 5' end or internally.

In this contects the term "detection" refers to applying a spectroscopic, photochemical, biochemical, immunochemical, chemical, or other physical method for detecting a label. Preferably fluorescent or chemiluminescent detection technologies are used. Also combinations of spectroscopic, photochemical, biochemical, immunochemical, chemical, or other physical method may be useful. E..g. detection of fluorescent label can be combined with flow cytometry for detection (e.g Luminex detection of flurescent labeled and color-coded microspheres; www.luminexcorp.com)

The term "stringent hybridization conditions", as used herein, means conditions under which a first nucleotide sequence (e.g. polynucleotide in its function as a probe for detecting a miRNA or miRNA*) will hybridize specifically to a second nucleotide sequence (e.g. target sequence such as nucleotide sequence of a miRNA or miRNA) having the effect that unspecific binding is surpressed and binding of the desired targets is enhanced. Exemplary stringent hybridization conditions include the following: 50% formamide, 5x SSC, and 1% SDS, incubating at 42°C, or, 5x SSC, 1% SDS, incubating at 65°C, with wash in 0.2x SSC, and 0.1% SDS at 65°C; or 6x SSPE, 10 % formamide, 0.01 %, Tween 20, 0.1 x TE buffer, 0.5 mg/ml BSA, 0.1 mg/ml herring sperm DNA, incubating at 42°C with wash in 05x SSPE and 6x SSPE at 45°C.

Unbound and non-specific bound targets are removed from the solid support, e.g. by washing with appropriate buffers under appropriate conditions. The term "denaturating conditions" refers to conditions forcing a nucleic acid double strand into two single strands, which occurs when the hydrogen bonds between the strands are broken. Ways to denature nucleic acids include application of high temperatures and/or application of duplex destabilizing agents (denaturants), e.g. organic solvents (e.g. ethanol, formamide, DMSO) chaotropic reagents (e.g. urea, guanidinium chloride) or low salt concentrations.

The term "RNA promoter" refers to a specific sequence element that is recognized by a R A polymerase and catalyzes the formation of RNA in the 5'→ 3' direction. Preferably, the RNA promoter is a phage promoter that catalyzes the synthesis of RNA employing SP6- T7 or T3- RNA polymerases. These polymerases can be used to synthesize RNA sequences from short DNA templates which contain the -18 bp promoter region (consensus promoter sequences, eg. T7 : TAATACGACTCACTATAAGG, SP6 : ATTTAGGTGACACTATAGA, T3 : ATTAACCCTCACTAAAGG)

The term "complement" or "complemetary" of the present invention refers to Watson-crick (e.g. A-T, A-U and C-G) or Hoogsteen base-pairing between nucleotides or nucleotide analogs of nucleic acid molecules. A "full complement" or "fully complementary" may mean 100% complemetary base-pairing between nucleotides or nucleotide analogs of nucleic acid molecules. This is not restricted to base-pairing between DNA or RNA and its analogs, but includes also base-pairing between DNA, RNA and its analogs and mixtures of DNA, RNA and its analogs.

The term "biological sample", as used in the context of the present invention, refers to any sample containing non-coding RNAs or miRNAs. These may be of biological origin or synthetic origin or a combination thereof. For example, biological samples encompassed by the present invention are tissue (e.g. section or explant) samples, all kind of body fluid samples, cell culture samples, cell colony samples, single cell samples, collection of single cell samples, blood (e.g. whole blood or a blood fraction such as serum or plasma or the leucocyte fraction, PBMCs etc.) samples, urine samples, stuhl, or samples from other peripheral sources, nucleic acid isolates from plants, mammals, bacteria, viral orign, and furthermore, nucleic acid mixtures that are a result of a pre-processing of natural or synthetic nucleic acid sources or combinations thereof.

The biological sample of the present invention may be subjected to pre-processing steps before it is employed according to the present invention. The term "pre-processing" of a biological sample may include any kind of enzymatic manipulation of a biological samples, preferably a R A-containing sample, including polyadenylation, adapter ligation, amplification. Furthermore, non-enzymatic steps e.g. include size selection, fragmentation or fractionation of the RNA samples prior to processing on the solid support.

The application of the biological sample to the support in the present invention can be done manually or by aid of instrumentation or autmated by instumentation

The term "solid support", as used in the context of the present invention, refers to any support or matrices that is suited for nucleic acid manipulation, handling or analysis. Suitable materials include, but are not restricted to organic or non-organic material, e.g. glass, modified or functionalized glass, plastic material (including acrylics, polystyrene, poly ehtlyene, polypropylene, Teflon, cor-polmers etc.), nylon, nitrocellulose, resins, silica, silica-based amterials, carbon, metals. Suitable supports include, but are not restricted to, 2- or 3- dimensional, planar, flexible supports, e.g. microarrays, biochips, macroarrays, arrays, microtiter plates, PCR-plates, tubes, wells, well plates, beads, luminex microspheres, stripes, line assays, cells etc. The solid supports may be derivatized with functional groups including hydroxyl-, amino-, carboxyl-, oxo- or thiolgroups for anchoring or affixing hybridisation probes onto the solid support and may contain spacer or linker elements between the surface of the support and the hybridisation probes.

The term "hybridisation probe" refers to one or more probes of nucleic acid origin on one or more solid supports, which contain DNA or RNA monomeric units or mixtures of these and may be affixed to the surface of the support via the 3'- the 5 '-terminus or internally. Additionally the monomeric units may contain also nucleic acid analogs (e.g. PNA, LNA, phosphothioates, ..). Furthermore, also other momomeric units of choice may be incoporated within the hybridisation probes, e.g. abasic sites, linkers, spacers, phosphates. These other monomeric units may be incorporated at the 3'- or the 5 '-end of the hybridisation probe or internally, between the 3' and the 5 '-end.

The hybridisation probes may be attached to the solid support covalently or non-covalently. The hybridisation probes may be prefabricated and afterwards affixed to the solid supoport by immobilsation technologies well known to the skilled in the art or can be synthesized by in situ synthesis methods (light-directed synthesis, photolithography, spot synthesis, ink-jet printing)

According to the present invention the solid support comprises one or more hybridisation probes, preferable more than 10, preferably more than 100, more preferably more than 1000, most preferably more than 10.000 hybridisation probes. The hybridisation probes in the context of the present invention may contain a hybridisation element (M) and one or two elongation elements at the 3 '- or 5'-terminus of the hybridisation element (ELI, EL2, see Figure 1 : hybridisation probes la- If).

The hybridisation element (M) is at least a partially complementary to the RNA molecules of interest, preferably non-coding RNAs, most preferably miRNAs. The complementarity of the sequence of the hybridisation element should be greater than 50%, preferably greater than 60 % , preferably greater than 70 %, preferably greater than 80 % or most preferably greater than 90 %, when compared to the sequence of the RNA molecules of interest in the biological sample.

The 1 or 2 elongation elements represent sequences at the 3'- or 5 '-terminus of the hybridisation probe(s) that are preferably not complementary to the RNA molecules of interest in the biological sample. The first elongation element (ELI) is at the 5 '-terminus of the hybridisation probe(s). The sequence of ELI contains at least one nucleotide, preferably more than 1 nucleoteotide, preferably 1-35, preferably 3-30, preferably 5-25, preferably 15-25 nucleotides. The second elongation element (EL2) is at the 3 '-terminus of the hybridisation probe(s). The sequence of EL2 contains at least one nucleotide, preferably more than 1 nucleoteotide, preferably 1-35, preferably 3-30, preferably 5-25, preferably 15-25 nucleotides.

The inventors of the present invention surprisingly found that miRNAs can be analysed, detected, amplified and isolated in preparative fashion by solid support based methods employing hybridisation probes of type la- If (see Figure 1).

In a first aspect, the invention provides multiplex methods for high parallel detection and analysis of small non-coding RNA and/or miRNA species from a biological sample, comprising the steps :

(a) Providing a biological sample

(b) Providing a plurality of hybridisation probes on one or more solid supports , the hybridisation probes comprising:

1. a hybridisation element that is at least partially complementary to the small non-coding RNA, including miRNA molecules, present in said sample u. first elongation element at the 5 '-terminus of said hybridisation element (c) Bringing said sample into contact with the solid support under hybridisation conditions to bind small non-coding RNA, including miRNA, molecules

(d) Removing unbound and/or non-specific bound material

(e) Subjecting the bound small non-coding RNA, including miRNA, molecules to a polymerase extension reaction to extend the small non-coding RNA, including miRNA, molecules at the 3 '-terminus

(f) Detecting the bound and elongated small non-coding RNA, including miRNA, molecules

In a preferred embodiment the processing of the bound RNA molecules is a template directed primer extension reaction, (e.g. see Figure 2: steps (I) to (III), which includes a final detection of the captured and elongated RNA molecules

The hybridisation probes preferably contain a hybridisation element and a frist elongation element (ELI) at the 5 '-terminus (Figure 1 : lc, If), but may optionally also contain a second elongation element (EL2) at the 3 '-terminus (Figure 1 : la, Id),

The polymerase reaction makes use of the bound RNA species as a primer. Hence, the bound RNA molecules are extended by the polymerase. This includes the reaction of a suitable polymerase (e.g. Klenow polymerase) with labeled (e.g. biotin or other haptens, fluorescent dyes) or un-labeled nucleotide triphosphates to elongate the bound RNA-molecules at the 3 '-end. This extension produces a stretch of nucleotides that is complementary to the elongation element ELI of the hybridisation probes. The sequence produced on the 3'-teminus of the bound RNA molecules is herby determined by the the sequence of the elongation element ELI of the hybridisation probes. Therefore, the design of the elongation element ELI determines the sequence that is generated by the enzymatic extension reaction. This enables to add a sequence of choice to the 3'-end of the captured RNA-molecules. The primer extension reaction can be carried out in one step, herby adding all required reagents for generating the elongation of the bound RNA molecules or in serial fashion, herby adding the required reagents only for one base extension and afterwards in consecutive steps the reagents that are required for the following steps.

After elongation, detection is used to for quantitative or qualitative analysis of the RNA species present in the biological sample. In a second aspect, the invention provides multiplex methods for high parallel preparative isolation of defined sets of small-non-coding RNAs and/or miRNAs from a sample, comprising the steps :

(a) Providing a biological sample

i. a hybridisation element that is at least partially complementary to the small non-coding RNA, including miRNA, molecules, present in said sample ii. and a first elongation element at the 5 '-terminus of said hybridisation element

(c) Bringing said sample into contact with the solid support under hybridisation conditions to bind small non-coding RNA, including miRNA, molecules

(d) Removing unbound and/or non-specific bound material

(f) Optionally detecting the bound and elongated small non-coding RNA, including miRNA, molecules

(g) Eluting the bound and elongated small non-coding RNA, including miRNA, molecules from step (e) or (f) from the solid support

In a preferred embodiment the processing of the bound RNA molecules comprises of a template directed primer extension reaction, followed by an optional detection and a preparative isolation of the elongated RNA species (see Figure 2 : steps (I) to (IV)).

The hybridisation probes preferably contain a hybridisation element and a first elongation element (ELI) at the 5 '-terminus (Figure 1 : lc, If), but may optionally also contain a second elongation element (EL2) at the 3 '-terminus (Figure 1 : la, Id),

The polymerase reaction makes use of the bound RNA species as a primer. Hence, the bound RNA molecules are extended by the polymerase. This includes the reaction of a suitable polymerase (e.g. lenow polymerase) with labeled (e.g. biotin or other haptens, fluorescent dyes) or un- labeled nucleotide triphophates to elongate the bound RNA-molecules at the 3 '-end. This extension produces a stretch of nucleotides that is complementary to the elongation element ELI of the hybridisation probes. The sequence produced on the 3'-teminus of the bound RNA molecules is herby determined by the the sequence of the elongation element ELI of the hybridisation probes. Therefore, the design of the elongation element ELI determines the sequence that is generated by the enzymatic extension reaction. This enables to add a sequence of choice to the 3 '-end of the captured RNA-molecules. The primer extension reaction can be carried out in one step, herby adding all required reagents for generating the elongation of the bound RNA molecules or in serial fashion, herby adding the required reagents only for one base extension and afterwards in consecutive steps the reagents that are required for the following steps.

After elongation an optional detection step can be used to control the elongation reaction or for quantitative or qualitative analysis of the RNA species present in the biological sample.

In order to harvest the captured and elongated RNA species, denaturating conditions are applied to de-hybridize and elute the targets from the solid support bound hybridisation probes. The dehybridized targets are collected in suitable containers and may be subjected to further processing or manipulation.

In a preferred embodiment the elongation element comprises a restriction enzyme recognition site that allows for cutting parts or the complete elongated sequence after detection and/or preparative isolation of the RNA species of interest in order to recover the native RNA species without the elongated sequence.

In a third aspect, the invention provides multiplex methods for high parallel amplification of the antisense sequences of defined sets of small-non-coding RNAs and/or miRNAs from a sample, comprising the steps .

(a) Providing a biological sample

I. a hybridisation element that is at least partially complementary to the small non-coding RNA, including niiRNA, molecules, present in said sample u. and a first elongation element at the 5 '-terminus of said hybridisation element which represents the sequence or the antisense sequence of a phage promoter

(c) Bringing said sample into contact with the solid support under hybridisation conditions to bind small non-coding RNA, including rniRNA, molecules (d) Removing unbound and/or non-specific bound material

(e) Subjecting the bound small non-coding RNA, including miRNA, molecules to a polymerase extension reaction to extend the small non-coding RNA, including miRNA, molecules at the 3 '-terminus to produce a phage promoter site

(g) Optionally eluting the the bound and elongated small non-coding RNA, including miRNA, molecules from step (e) or (f) from the solid support

(h) Adding a oligonucleotide having the sequence of ELI and subjecting the elongated small non-coding RNA, including miRNA, molecules to a RNA polymerase extension reaction to produce a plurality of antisense sequences of the small non-coding RNA, including miRNA, molecules

In a preferred embodiment the processing of the bound RNA molecules comprises of a template directed primer extension reaction, followed by an optional detection and a RNA polymerase based amplification reaction. Alternatively the amplification reaction can be either carried out directly on the solid support or in solution after the elongated RNA species have been eluted from the support in a preparative fashion (see Figure 2 steps (I) to (IV) followed by Figure 4 steps (I) to (III)).

The hybridisation probes preferably contain a hybridisation element and a frist elongation element (ELI) at the 5'-terminus (Figure 1 : lc, I f), but may optionally also contain a second elongation element (EL2) at the 3 '-terminus (Figure 1 : la, Id).

The polymerase reaction makes use of the bound RNA species as a primer. Hence, the bound RNA molecules are extended by the polymerase. This includes the reaction of a suitable polymerase (e.g. lenow polymerase) with labeled (e.g. biotin or other haptens, fluorescent dyes) or un- labeled nucleotide triphophates to elongate the bound RNA-molecules at the 3 '-end. This extension produces a stretch of nucleotides that is complementary to the elongation element ELI of the hybridisation probes. Preferably, the sequence that is generated at the 3 '-end of the bound RNA molecules represents the complementary sequence of a RNA-polymerase promoter preferably a phage promoter (T7, SP6 or T3). This is to produce a functional double-stranded promoter, allowing a RNA-polymerase based transcription/amplification reaction.

The primer extension reaction can be carried out in one step, herby adding all required reagents for generating the elongation of the bound RNA molecules or in serial fashion, herby adding all required reagents only for one base extension and afterwards in consecutive steps the reagents that are require for the following steps.

In order to harvest the captured and elongated RNA species, denaturating conditions are applied to de-hybridize the targets from the solid support bound hybridisation probes. This elution process generates a complex mixture of molecules, containing a plurality of different nucleic acid species that are recovered from the solid support and may be stored in suitable containers (e.g. tubes, plates, wells)

The dehybridized targets are collected and are amplified by a RNA polymerase based amplification scheme. For doing so, an oligonucleotide ahvingteh sequence of ELI is added to produce a functional double-stranded promoter for a T7-, SP6- or T3-RNA polymerase, resulting in a plurality of copies of the antisense miRNA species after amplificaiton.

In a preferred embodiment of the invention the eluted mixture of amplified antisense nucleic acid species may be employed for a further round of analyses or further/other analytical purposes (e.g. another round of analysis at higher sensitivity e.g. by microarrays, microspheres, beads etc.)

In a fourth aspect, the invention provides multiplex methods for high parallel isolation and amplification of defined sets of small-non-coding RNAs and/or miRNAs from a sample, comprising the steps :

(a) Providing a biological sample

1. a hybridisation element that is at least partially complementary to the small non-coding RNA, including miRNA, molecules, present in said sample

11. a first elongation element at the 5 '-terminus of said hybridisation element which represents a first primer sequence

in and a second elongation element at the 3 '-terminus of said hybridisation element which represents a second primer sequence

(c) Bringing said sample into contact with the solid support under hybridisation conditions to bind small non-coding RNA, including miRNA, molecules (d) Removing unbound and/or non-specific bound material

(e) Subjecting the bound small non-coding RNA, including miRNA, molecules to a polymerase extension reaction to extend the small non-coding RNA, including miRNA, molecules at the 3 '-terminus to produce a first primer site

(0 Optionally detecting the bound and elongated small non-coding RNA, including miRNA, molecules

(g) Subjecting the 5 '-end of the elongated bound small non-coding RNA, including miRNA, molecules to a template directed ligation reaction to produce a second primer site at the 5 '-terminus

(h) Optionally eluting the bound, elongated and ligated small non-coding RNA, including miRNA, molecules

(i) Adding primers defined by the first and the second elongation element to start a PCR amplification reaction

In a preferred embodiment the processing of the bound RNA molecules comprises of a template directed primer extension reaction, followed by an optional detection, a template directed ligation reaction and finally a PCR amplification reaction (see Figure 3 steps (I) to (III) followed by Figure 5 steps (I) to (II)). Alternatively the PCR amplification reaction can be either carried out directly on the solid support or in solution (see Figure 5) after the elongated and ligated RNA species have been eluted from the support in a preparative fashion.

The hybridisation probes preferably contain a hybridisation element and two elongation elements, a first one at the 5 '-terminus (ELI) and a second elongation element (EL2) at the 3'- terminus (Figure 1 : la, Id)

In a preferred embodiment the processing of the bound RNA molecules is a template directed primer extension reaction. The polymerase reaction makes use of the bound RNA species as a primer. Hence, the bound RNA molecules are extended by the polymerase. This includes the reaction of a suitable polymerase (e.g. Klenow polymerase) with labeled (e.g. biotin or other haptens, fluorescent dyes) or un-labeled nucletide triphophates to elongate the bound RNA- molecules at the 3 '-end. This extension produces a stretch of nucleotides that is complementary to the elongation element of the hybridisation probes. In a prefered embodiment of the invention the sequence that is attached to the 3 '-terminus of the bound RNA molecules is a primer site that can be used in a PCR-like reaction. By defining and then copying the sequence of the elongation element onto the 3 '-terminus of the bound RNA molecules, the primer site is attached to the RNA molecules that may be utilized as a first primer site for a PCR-based amplification reaction. After elongation an optional detection step can be used to control the elongation reaction or for quantitative or qualitative analysis of the RNA species present in the biological sample.

The ligation of the second primer site to the 5 '-terminus can be carried out either by enzymatic or chemical ligation. In case that the NA-molecules are miRNA molecules, there is already a phosphate moiety present at the 5 '-terminus, therefore, the 5 '-terminus not necessarily has to be phosphorylated. When other RNA-species, whithout a 5 '-phosphate are employed, an additional phosphorylation of the 5 '-terminus is required. The phosphorylation may be carried out by enyzmatic means, employing a kinase enzyme, or by chemical means. When the ligation is carried out enzymatically, ATP-dependent and ATP-independent ligase enzymes may be used. In order to harvest the captured and elongated RNA species, denaturating conditions are applied to de-hybridize the targets from the solid support bound hybridisation probes. This elution process generates a complex mixture of nucleic acid molecules, containing a plurality of different nucleic acid species that are recovered from the solid support and may be stored in suitable containers (e.g. tubes, plates, wells)

The dehybridized targets are collected and are subjected to a PCR- or PCR-like amplification reaction. This amplification reaction may be carried out either directly on the solid support or after the elongated and ligated RNA-molecules have be eluted from the solid support (sse Figure 5), e.g. in liquid phase (e.g. in a tube).

In a preferred embodiment both elongation elements comprises a restriction enzyme recognition sites that allows for cutting parts or the complete elongated sequences after detection and/or and/or PCR-amplification and/or preparative isolation of the RNA species of interest in order to recover the native RNA species without the elongated sequence

In a fifth aspect of the invention a method for high parallel amplification of defined sets of small- non-coding RNAs and/or miRNAs from a sample, comprising the steps :

(a) Providing a biological sample

i. a hybridisation element that is at least partially complementary to the small non- coding RNA, including miRNA, molecules, present in said sample ii. a first elongation element at the 5 '-terminus of said hybridisation element which represents a first primer sequence iii. and a second elongation element at the 3 '-terminus of said hybridisation element which represents a second primer sequence

(c) Bringing said sample into contact with the solid support under hybridisation conditions to bind small non-coding R A, including miRNA, molecules

(d) Removing unbound and/or non-specific bound material

(e) Bringing said bound small non-coding RNA, including miRNA, molecules into contact with a polynucleotide sequence of 20-200bp comprising

i. a phosphate group at the 5 '-end

ii. a first sequence at the 5 '-end that is complementary to the first elongation element at the 5 '-terminus of said bound small non-coding RNA, including miRNA, molecules

iii. a second sequence at the 3 '-end that is complementary to the second elongation element at the 3 '-terminus of said bound small non-coding RNA, including miRNA, molecules

and performing two template directed ligation reactions to both ends of the said bound small non-coding RNA, including miRNA, molecules, therby producing circular nucleotide sequences

(f) Optionally detecting the circular nucleotide sequences

(g) Eluting the circular nucleotides sequences from the one or more solid supports

(h) Adding primers complementary to either the said first or the second sequence of the circular nucleotide sequence in order to start a rolling circle amplification

In a preferred embodiment both sequences adjacent to the hybridisation element comprises restriction enzyme recognition sites that allow for cutting the complement of the ligated sequence after rolling circle amplification, therby setting free multiple copies of the antisense non-coding RNA, preferably antisense miRNA molecules.

In a sixth aspect, the invention provides multiplex methods for high parallel isolation anc amplification of defined sets of small-non-coding RNAs and/or miRNAs from a sample comprising the steps :

(a) Providing a biological sample (b) Providing a plurality of hybridisation probes on one or more solid supports , the hybridisation probes comprising:

i. a hybridisation element that is at least partially complementary to the small non-coding RNA, including miRNA, molecules, present in said sample ii. and a second elongation element at the 3 '-terminus of said hybridisation element which represents a second primer sequence

(d) Removing unbound and/or non-specific bound material

(e) Subjecting the 5 '-end of the bound small non-coding RNA, including miRNA, molecules to a template directed ligation reaction to produce a RNA promoter at the 5'-teminus

(f) Subjecting the double-stranded construct to a RNA-polymerase driven amplification reaction to produce a plurality of copies of the small non-coding RNA, including miRNA, molecules

In a preferred embodiment the processing of the bound RNA molecules comprises of a template directed ligation and a RNA polymerase reaction, (see Figure 8 steps (I) to (IV) to produce a plurality of copies of the small non-coding RNA, including miRNA, molecules.

The hybridisation probes preferably contain a hybridisation element and a second elongation element (EL2) at the 3 '-terminus (Figure 1 : lb, le)

In a preferred embodiment the processing of the bound RNA molecules is a template directed ligation reaction. The ligation of the reverse compement of EL2 to the 5 '-terminus can be carried out either by enzymatic or chemical ligation methods. In case that the RNA-molecules of interest are miRNA molecules, there is already a phosphate moiety present at the 5 '-terminus, therefore, the 5 '-terminus not necessarily has to be phosphorylated. When other RNA-species, whithout a 5 '-phosphate are employed, an additional phosphorylation of the 5 '-terminus is required. The phosphorylation may be carried out by enyzmatic means, employing a kinase enzyme, or by chemical means. When the ligation is carried out enzymatically, ATP-dependent and ATP- independent ligase enzymes may be used.

Preferably EL2 is a RNA-promoter, more preferably a phage promoter (T7, T3, SP6). After ligation the solid support bound construct represent a double-stranded substrate for a RNA- polymerase driven transcription/amplification scheme. By using the surface bound hybridisation probes as template strands, a plurality of copies of the hybridized non-coding RNA, including miR A, molecules is generated when employing a RNA polymerase, preferably a T7-, T3-, or SP6-RNA polymerase.

After RNA polymerase reaction the plurality of copies of the hybridized non-coding RNA, including miRNA, molecules are eluted from the one or more solid supports and collected.

In a preferred embodiment of the invention the eluted mixture of amplified nucleic acid species may be employed for a further round of analyses or analytical purposes (e.g. another round of analysis at higher sensitivity e.g. by microarrays, microspheres, beads etc.)

In a preferred embodiment of the invention the eluted mixture of nucleic acid species can be further processed. These downstream processing steps include amplifiaction (e.g. PCR, isothermal amplification), cloning, sequencing or a combination thereof. In another preferred embodiment, the isolated RNA molecules are further processed, e.g. by cloning in suitable vectors and/or translated into peptides or proteins. Alternatively the isolated RNA molecules may be tranfected into cell lines, cells or organism for the purpose of translation, functional or regulatory studies or for targeting destinct transcripts, employed as therapeutic agents. Targeting certain disease-related transcripts (e.g. oncogenes, tumor-surpressor genes, cancer-related genes) may be especially useful for the purpose of down- or up-regulation of certain transcripts or even a complete pathway or parts of such a pathway.

Another aspect of the present invention relates to a kit for isolation and amplification of small non-coding RNAs, comprising

a. One or more solid supports comprising hybridisation probes, the hybridisation probes comprising :

i. a hybridisation element that is at least partially complementary to a small non-coding RNA

ii. a first elongation element at the 5 '-terminus of said hybridisation element iii. and optionally a second elongation element at the 3 '-terminus of said hybridisation element

b. Reagents for performing a primer extension reaction

c. Reagents for eluting molecules from the one or more solid supports

d. Optionally reagents for performing an amplification reaction The reagents for performing an amplification reaction comprise either a polymerase suitable for performing a PCR reaction including appropropriate primers, chemicals and buffers or alternatively a RNA-polymerase including appropriate chemicals and buffers.

Another aspect of the present invention relates to a solid support for isolation and amplification of small non-coding RNAs, comprising hybridisation probes, wherein the hybridisation probes comprise :

a. a hybridisation element that is at least partially complementary to a small non- coding R A

b. a first elongation element at the 5 '-terminus of said hybridisation element c. and optionally a second elongation element at the 3'-terminus of said hybridisation element

Prefereably the solid support is a microarray or a collection of color-coded beads or microspheres. Preferabyl, the small non-coding RNAs are miRNAs.

In a sixth aspect of the present invention a method for miRNA expression analysis employing a multiplex primer extension assay on coded beads is disclosed.

The bead-based microRNA-pro filing assay described here (see Figure 9-11) makes use of total RNA as starting material. There is no need for enrichment of the small RNA fraction out of the complex pool of different RNA species (e.g. mRNA, tRNA, rRNA) contained in total RNA. No amplification step is required that may introduce bias to the microRNA expression levels. Furthermore, the total RNA is directly employed for hybridization without prior labeling. This reduces cost and time and adds significant sensitivity to the assay since potential background signals arising from non-specific hybridization are reduced.

The bead-based microRNA-profiling assay combines coded beads (e.g. magnetic color-coded beads, MagPlex-TAG microspheres, Luminex) providing unique TAG-sequences and assay- specific capture probes (hybridization probes).

The DNA-based capture probes (hybridization probes) are at least partially complementary to all known microRNAs, as annotated in the miRBase at the Sanger Institute (www.mirbase.org). The capture-probe consists of 3 elements : the T-element is complementary to the x-TAG sequence on coded beads (e.g. the Luminex MagPlex-TAG microspheres), the M-element is complementary to a individual microRNA and the EL-element on the 5 '-end represents the template for a Klenow polymerase based primer extension reaction to elongate and label microRNA molecules that previously hybridized to the M-element of the capture probe(s).

In a first step the total RNA is hybridized to a capture probe or a pool of different capture probes. By applying stringent hybridization or a step-down hybridization scheme it is assured that a high fraction of perfect matched sequences bind to the capture-probes in solution. These conditions allow for high specific recognition of miRNA targets especially at the central position of the M- element of the capture probe. Afterwards, a pool of MagPlex magnetic beads, is added in order to hybridize to the T-elements of the corresponding capture probes. By pulling down the capture probes to the magnetic beads, unbound and non-specific RNA molecules are separated from hybridized and bound miRNA-targets. After careful washing of the beads, in a next step, a template oriented primer extension reaction is carried out, employing the bead-bound microRNA molecules as primers and the elongation element as template. By using the Klenow polymerase together with biotin-labeled triphosphate-nucleotides, not only microRNAs are elongated, but simultaneously biotin-labels are incorporated into the support bound microRNAs. These biotin- moieties can be stained via the streptavidine-phycoerythrine system in the subsequent detection step (e.g. performed on a MagPix Luminex instrument).

Altogether, the described procedure comprises of two consecutive specificity steps, namely a first stringent hybridization step with a high discrimination power at the central position of the microRNA and a second primer extension step that ensures high discrimination at the terminal 3 '-end of the microRNA by use of a polymerase.

The total RNA employed in the described miRNA expression profiling assay on beads can be derived from a broad spectrum of RNA source, including but not limited to natural or synthetic sources, tissue material, body fluids, cellular or cell-free material. The described assay is especially valuable for use in non-invasive diagnostic tests. Therefore, body fluids are a preferred source of total RNA from which a microRNA expression profile can be generated.

Suitable bead for running miRNA expression analysis according to the present invention include all kind beads that are capable for being employed in a multiplex manner, therefore, different bead entities are required to be distinguishable from another. This can be achieved e.g. by combination of a color coding of the beads or any other means that allow for distinction of the different bead entities (e.g. tag-sequence coding, (para-)magnetic coding, etc.). Beads may be magnetic or non-magnetic.

The capture probes suitable for use with the described miRNA expression profiling assay may contain DNA and/or RNA moieties. Prefereably the capture probes contain DNA moieties. The T-element is complementary to a TAG-sequence on a bead and contains 10-50 nucleotides, preferably 15-35, more preferably 18-30, most preferably 20-24 nucleotides. In order to allow for multiplex assays the individual TAG-sequence are required to have similar hybridization behavior (e.g. similar melting temperatures) and show sufficient sequence difference that minimize cross-hybridisation. Beads with such TAG sequence can be purchased from Luminex (www.luminex.com).

The M-element is at least partially complementary to a known (www.miRBase.org) or predicted microRNA molecule. A high complementarity at the 3 '-end of a microRNA ensures for good performance in the primer extension step, hence labeling and detectability of the corresponding microRNA. Due to the fact that length of known microRNAs between 17-27 bp translates a broad spectrum of melting temperatures, truncation of nucleotides from the 5 '-end may be used to equilibrate and uniform the melting behavior of different microRNAs. Therefore, the also M- elements that correspond to '-truncated miRNAs may be employed in the present invention.

Besides microRNAs also other kind of nucleotide targets with a defined 3 '-end may be employed in the described assay. These my include other non-coding RNA or short DNA molecules.

The EL-element represents a template for the primer extension reaction that uses the hybridized microRNA as a primer and allows for introducing a label into the microRNA-capture probe duplex by use of labeled triphosphate reagents. This positive selection allows for the detection and quantification of the hybridized microRNA targets. The sequence of the EL-element defines the nucleotide triphosphates that are employed in the primer extension reaction. For example a homomeric A-sequence triggers the use of a thymidine or uracile triphosphate in the primer extension reaction. Besides homomeric sequences also mixed sequences may be employed in the EL-element. The number of nucleotides in combination with the label on the nucleotide triphosphate reagents influences the sensitivity of the assay. The length of the EL-element may contain 1-50, preferably 1-25,. more preferably 1-10, most preferably 1-5 nucleotides. The labeling scheme on the nucleotide triphosphates include direct labeling (e.g. Cy3, Cy5, fluorescein) or indirect labeling (e.g. hapten), known to the skilled in the art. Preferably, a homomeric A-sequence is employed as EL-element. When more than one A-moiety is used as EL-element, higher signals upon detection are obtained. Additional sensitivity may be obtained by combining a first labeling with a signal amplification scheme (e.g. biotin-labeling with first SAPE-staining followed by biotinylated anti-streptavidin antibody and second SAPE-staining). BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 : Hybridisation probes according to the present invention containing a hybridisation element (M), a first elongantion element (ELI ) at the 5 '-terminus and a second elongation element (EL2) at the 3 '-terminus. Hybridisation probes are affixed to the solid support via the 3'- terminus (la-c) or via the 5 '-terminus (ld-f) and contain one ( lb, lc, l e, I f) or two ( l a, Id) elongation elements.

Figure 2 : Exemplary workflow for isolation of elongated small-non-coding RNAs, preferably miRNAs starting from a hybridisation probe of type la. In a first step (I) a biological sample is hybridized to the solid support under stringent conditions to specifically bind e.g. a miRNA to the hybridisation element of the hybridisation probe. After removing non-bound or not specific bound material in step (II) the bound miRNA is elongated at the 3 '-terminus via a primer extension reaction, e.g. employing a lenow polymerase and nucleotide triphosphates, to build up the complementary sequence to the first elongation element ELI (step III). In step (IV) the produced elongated product is eluted from the solid support by applying denaturating conditions.

Although the workflow for isolation is depicted her exemplarily only for one hybridisation probe, it is understood that following this procedure a plurality of different elongated products can be preparatively isolated when different hybridisation probes on one or more solid supports are implemented.

Figure 3 : Exemplary workflow for isolation of elongated and ligated small-non-coding RNAs, preferably a miRNAs starting from a the already elongated primary product 4 (see also worflow Figure 2). In a first step (I) the already elongated product 4 is brought into contact with the complementary sequence of EL2 for a template directed ligation reaction. The miRNA bound to the hybridisation probe naturally already has a 5'-phosphate moiety. By applying a ligase enzyme, the complement of the EL2 is readily affixed to the 5 '-end of the bound RNA construct (step II) via a template directed ligation reaction. In step (III) the produced elongated and ligated product is eluated from the solid support by applyling denaturating conditions. Although the workflow for isolation is depicted her exemplarily only for one hybridisation probe, it is understood that following this procedure a plurality of different elongated products can be preparatively isolated when different hybridisation probes 4 on one or more solid supports are implemented. Figure 4 : Exemplary workflow for RNA-polymerase-based amplification of elongated small- non-coding RNAs, preferably miRNAs starting from the eluated product 5 ( see also workflow Figure 2). The elongated sequence 5 represents the template strand for a RNA promoter driven transcription reaction. Therefore, in step (I) product 5 is contacted with the complement of the promoter sequence to from a double-stranded promoter motif that is recognized by a RNA- polymerase (e.g. T7-, T3, SP6-polmerase) to transcribe the template strand, herby producing rna- transcripts 10 that are antisense to the non-coding RNAs, preferably miRNAs, in large quantities 1 1.

Although the workflow for amplification is depicted her exemplarily only for one elongated RNA species, it is understood that following this procedure a plurality of different elongated products can be amplified when more than one individual elongated RNA species are implemented.

Figure 5 : Exemplary workflow for PCR-based amplification of elongated and ligated small- non-coding RNAs, preferably miRNAs starting from the eluated product 8 ( see also workflow Figure 3). In 8 both elongation elements (ELI, EL2) represent a primer site that allows for running a PCR for amplification of the miRNA sequence with adapter sequence at the 3'- and 5'- end. Therefore, in step (I) the appropriate 2 primers a PCR-polmerase (e.g. taq polymerase) and the appropriate reagents are added to amplify by PCR, generating DNA a plurality of double- standed DNA products.

Although the workflow for amplification is depicted here exemplarily only for one element, it is understood that following this procedure a plurality of different amplified products are obtained when more than one species of eluated products 8 are implemented.

Figure 6 : Exemplary workflow for a bead-based detection of small non-coding RNAs, in particular miRNAs starting from a plurality of color-coded beads or microspheres (1,2,3). Perferably, Luminex microspheres are employed. Each of the hybridisation probes of the color- coded beads contains a hybridisation element (M) and first elongation element (ELI) at the 5'- terminus. Each color-code allows for analysis of a different miRNA species (l=probe for hsa- let7b, 2= probe for hsa-miR-574-3p, 3= probe for hsa-miR-454) and defines a different receptor. In a first step (I) a plurality of color-coded beads is contacted with a biological sample. The hybridisation probe of color-coded bead 1 captures its target hsa-let7b, whereas the other beads do not capture a miRNA target. Afterwards the plurality of color-coded beads is contacted with a Klenow polymerase, biotinylated dATPs (or biotinylated ATPs) to extend the hsa-let7b miRNA at its 3 '-terminus by 5 biotinylated adenosine nucleotides. In step (III) the biotin-labels are detected and quantified , e.g. via fluorescense detection (e.g. by streptavidin-fluorophore- conjugates). By decoding of the beeds/color-codes (e.g. with a Luminex system) the detection signal is linked to the individual miRNA-assay or receptor (hybridisation probe).

Figure 7 : Exemplary workflow for Rolling Circle-based amplification (RCA) of bound and double ligated small-non-coding RNAs, preferably miRNAs starting from product 2. following tehis scheme multiple copies of the antisense non-coding RNA or antisense miRNA are produced after RCA.

Figure 8 : Exemplary workflow for RNA-polymerase-based amplification of elongated small- non-coding RNAs, preferably miRNAs starting from lb ( see Figure 1). EL2 represents the consensus sequence of a phage RNA promoter (e.g. T7, T3, SP6). In step (I) a miRNA binds to the hybridisation element of the hybridisation probe. The miRNA bound to the hybridisation probe naturally already has a 5 '-phosphate moiety. The DNA/RNA duplex is contacted with the reverse complement of the EL2 and a template directed ligation reaction is performed in step (II). Hereby a double stranded phage promoter is produced. The hybrisiation probe lb represents the template strand for a RNA promoter driven transcription reaction. Therefore, in step (III) product 17 is contacted with a RNA-polymerase (e.g. T7-, T3, SP6-polmerase) to transcribe the template strand, herby producing rna-transcripts 18 that are copies of the miRNAs, preferably in large quantities 19.

Figure 9a, 9b : miRNA expression analysis employing a multiplex primer extension assay on magnetic beads. The capture probes comprising a T-element, a M-element and a EL-element hybridize with its M-element being complementary to a microRNA in solution. Afterwards the hybridzed DNA-RNA duplex is pulled down with magnetic beads based on the complementarity of the T-element to the tag-sequence on the bead. Using the EL-element as template a primer extension reaction is performed using the microRNA as primer. By use of labeled nucleotide triphosphates simultaneously lables are incorporated to allow for subsequent analysis. Fig 9a : EL-element contains a 5-mer homomeric adenine sequence. Fig 9b : EL-element contains a 5- mer homomeric thymidine sequence.

Figure 10 : miRNA expression analysis employing a multiplex primer extension assay on magnetic beads. The capture probes comprising a T-element, a M-element and a EL-element hybridize with its M-element being complementary to a microRNA in solution. Using the EL- element as template a primer extension reaction is performed using the microRNA as primer. By use of labeled nucleotide triphosphates simultaneously lables are incorporated. Afterwards the hybridzed DNA-RNA duplex is pulled down with magnetic beads based on the complementarity of the T-element to the tag-sequence on the bead.

Figure 11 : miRNA expression analysis employing a combination of a multiplex primer extension and RNase cleavage assay on magnetic beads. The chimeric DNA/RNA capture probes comprising a T-element, a M-element and a EL-element (containing RNA nucleotides and a 5-biotin label) hybridize with its M-element being complementary to a microRNA in solution. Afterwards the hybridzed DNA-RNA duplex is pulled down with magnetic beads based on the complementarity of the T-element to the tag-sequence on the bead. Using the EL-element as template a primer extension reaction is performed using the microRNA as primer. Then RNase One is used to cleave mismatched RNA-duplexes at the EL-element, thereby cleaving off the terminal biotin-label. Only perfect matched RNA-duplexes at the EL-element give rise to a signal upon detection.

EXAMPLES

Example 1

The biological sample containing non-coding RNAs, in particular miRNAs is whole blood sample. 5 ml blood was collected from a human individual in PAXgene Blood RNA tubes (BD, USA) and stored at 4°C until RNA was extracted. Total RNA was isolated from blood cells using the miRNeasy Mini Kit (Qiagen, Germany) and stored at -80°C.

Samples were analyzed with the Geniom Real-time Analyzer (febit group, Germany; www. febit.com) using the febit biochip miRNA homo sapiens as solid support. Each microarray contains 7 replicates of hybridisation probes, each designed to capture one of the 866 miRNAs and miRNA* sequences as annotated in the Sanger miRBase 12.0 (www.miRBase.org). Therefore, the 866 individual hybridisation probes contain a hybridisation element (M) which is the reverse complement of one of the 866 miRNAs and a first elongation element at the 5'- terminus- the sequence of ELI was TTTTT. Example for capturing miRNA hsa-let-7a

miRNA sequence (hsa-let-7a): 5'-ugagguaguagguuguauaguu-3'

hybridisation probe (hsa-let-7a): 5 ' -TTTTT- AACT AT AC AACCTACT ACCTC A-3 '

The hybridisation probes were affixed to the solid support via the 3 '-terminus and were fabricated by light-directed in situ synthesis on a functionalized febit biochip.

Step 1 : Hybridization of the biological sample

250 ng of total RNA, isolated from blood cells, were suspended in 25 μΐ of the hybridization buffer :

Hybridisation buffer

The RNA sample was denatured the at 94°C for 3 minutes and placed on ice immediately for 2 minutes. Afterwards the sample was applied to one of the 8 microarrays of the febit biochip via the Geniom RT Analyzer instrument and hybridized at 42°C for 14 hours. Next the microarray was washed with 6x SSPE and then with 0.5x SSPE buffer to remove unbound and non-specific bound material. Step 2: Polymerase elongation of the bound molecules

The microarrays was washed and equlibrated with 200 μΐ of enzyme equilibration mixture (prepared from 160 μΐ of ΙΟχ NEBuffer 2 and 1440 μΐ of DEPC-H₂0) at 37°C.

Primer Extension Mixture:

Afterwards 50 μΐ of primer extension mixture was applied to the microarray and the elongation reaction was run for 15 min.

Step 3 : Detection of the bound and elongated molecules

Then the microarray was washed with 200 μΐ of 6x SSPE before for detection solution applied.

Detection solution :

After 15 min the microarray was washed with 200 μΐ of 6x SSPE and the staining mixure was applied. Fluorescense detection (Cy3) was carried out employing the inbuilt CCD-camera of the Geniom RT Analyzer instrument.

Staining mixture

DEPC-H₂o 1554 μΐ

Total volume 3500 μΐ

Step 4 : Elution of the bound and elongated molecules

The biochip was removed from the Geniom RT Analyzer and introduced into the febit elution holder. Then, 15 μί of 90% Hi-Di™ formamide (prepared from 25 mL 100% Hi-Di™ formamide with 2.78 mL of ultra-pure H₂O) were applied and the elution holder was placed into a hybridization oven at 70 °C for 30 minutes. Afterwards the elution holder was removed from the oven and the formamide solution was recovered by use of a syringe and collected into a tube. Next the eluate, containing the previously bound and elongated molecules, was dried in a speedvac at 65 °C to complete dryness (-1.5 to 2.5hours).

Example 2

miRNA expression analysis employing a multiplex primer extension assay on magnetic beads

Materials:

- Hybridization buffer: Mix 198 μΐ of SSPE (20x), 66 μΐ of formamide, 66 μΐ of TE-buffer (lx), 13.2 μΐ of BSA (50mg/ml), 13.2 μΐ of Tween 20 (0.5%) and 107.1 μΐ of DEPC-H20 to a final volume of 463.5 μΐ.

- Washing Buffer (6x SSPE): Mix 300 ml of 20x SSPE with 700 ml of DEPC-H20 to a final volume of 1000 μΐ.

- SAPE (streptavidine phycoerythrine) solution: Add 22 μΐ of SAPE ( 1 mg/ml) to a solution of 4500 μΐ of SSPE (6x) and 180 μΐ BSA (50mg/ml) to a final volume of 4702 μΐ.

- Equilibration solution: Mix 160 μΐ of ΙΟχ NEBuffer 2 with 1440 μΐ of DEPC-H20 to obtain 1600 μ 1 of 1 x NEBuffer2

Primer extension mixture (enzymatic elongation & labeling solution): Mix 44 μΐ of NEBuffer 2 (lOx), 44 μΐ of Biotin-1 1-dUTP (40 μΜ) or alternatively Biotin-16-dUTP (40μΜ), 2.9 μΐ lenow exo- (50,000 U/ml) and 349.1 μΐ ddH20 to obtain 440 μΐ of primer extension mixture. Prepare fresh and store on ice before use.

- Total RNA brain (Ambion first choice human brain reference, lOOng/μΙ), total RNA heart

(Ambion human heart total RNA, lOOng/μΙ) 10-plex bead mixture : combine 8 μΐ of each of the MagPlex-Tag bead solution (MTAG- A012, A013, A014, A015, A018, A019, A020, A021, A022, A025, each at a 2500 beads/μΐ) to a final volume of 80 μΐ.

10-plex capture probe mixture : combine 1.5 μΐ of each of the capture probes (each at 100 μΜ) and add 135 μΐ of DEPC-H20 to obtain 150 μΐ of 10-plex capture probe mixture. miRNA Capture MTA Capture Probe Sequence (5'-3')

Probe Name G-N0.

hsa-miR- miR- MTA AAAAATCCTCTCAACCCAGCTTTTCATAATCAAT 320d 320d_A5_A0 G- TTCAACTTTCTACT

12 A012

hsa-miR- miR- MTA AAAAAGCCCTCCCCTGACTCCCTGACAAATACAT 4270 4270_A5_A0 G- AATCTTACATTCACT

13 A013

hsa-miR- miR- MTA AAAAATAGCTGGTTGAAGGGGACCAAAAATTTCT 133b 133b_A5_A0 G- TCTCTTTCTTTCACAAT

14 A014

hsa-miR- miR-499- MTA AAAAAAAACATCACTGCAAGTCTTAATACTTCTT 499-5p 5p_A5_A015 G- TACTACAATTTACAAC

A015

hsa-miR- miR-338- MTA AAAAACAACAAAATCACTGATGCTGGAACACTT 338-3p 3p_A5_A018 G- ATCTTTCAATTCAATTAC

A018

hsa-miR- . miR- MTA AAAAAACCCACCGACAGCAATGAATGTTATACTT 181b 181b_A5_A0 G- TACAAACAAATAACACAC

19 A019

hsa-miR- miR- MTA AAAAAACATGGTTAGATCAAGCACAACTTTCTCA 218 218_A5_A02 G- TACTTTCAACTAATTT

0 A020

hsa-miR- miR- MTA AAAAAGCGGAACTTAGCCACTGTGAATCAAACTC 27a 27a_A5_A02 G- TCAATTCTTACTTAAT

1 A021

hsa-miR- miR- MTA AAAAAGCTGTAAACATCCGACTGAAAGCAAACA 30e* 30e*_A5_A0 G- AACATTCAAATATCAATC 22 A022

hsa-miR- miR- MTA AAAAAAACACTGATTTCAAATGGTGCTACTTTCT 29b 29b_A5_A02 G- TAATACATTACAACATAC

5 A025

Step 1 : Hybridization of total RNA

On ice, 5 μΐ of total RNA (lOOng/μΙ) was added into a single well of a 96-well PCR Plate (ABgene) to a mixture of 14.75 μΐ hybidisation buffer and 1.25 μΐ of 10-plex capture probe mixture. When 8 total RNA samples from brain and 8 from heart were added, the PCR plate was sealed and introduced into a PCR-Cycler running a step-down hybridization scheme (3min at 90°, 6 min at each temperature stepping down from 80 to 60°C, then hold at 37°C).

Step 2 : Pulling down to magnetic beads

When reaching the 37°C hold step, the PCR plate was removed from the cycler, centrifuged and 4 μΐ of the 10-plex bead mixture was added to each sample well. After vortexing and spinning down the PCR plate was reintroduced to the PCR cycler for 30 min at 37°C to pull down the capture-probe bound miRNA targets to the magnetic beads.

Step 3 : Primer Extension

The PCR plate was remove from the cycler, spinned down and placed on a 96-well magnetic separator plate (Invitrogen). The magnetic beads were subjected to a 2 min migration procedure before the supernatant was carefully removed by use of a 8-channeI pipette. The PCR plate was remove form the magnetic separator, 25 μΐ of equilibration solution was pipetted into each sample well and mixed by pipetting up and down for 4-5 times. Then the PCR plate was reintroduced to the magnetic separator and the magnetic beads were subjected to a 2 min migration procedure before the supernatant was carefully removed. To each sample well 25 μΐ of primer extension mix was added. The PCR plate was sealed, vortexed, spinned down and reintroduced into the PCR cycler at 30°C for 30 min.

Step 4 : Washing & Staining

The PCR plate was removed from the PCR cycler, placed on a magnetic separator and the magnetic beads were subjected to a 2 min migration procedure before the supernatant was carefiilly removed. 75 μΐ of SAPE-solution was added to each sample well, mixed by pipetting up and down for 4-5 times and incubated for 15 min at room temperature. Then the PCR plate was reintroduced to the magnetic separator and the magnetic beads were subjected to a 2 min migration procedure before the SAPE-solution was carefully removed. To each sample well 180 μΐ of washing buffer was added, mixed by pipetting up and down for 4-5 times. Then the PCR plate was reintroduced to the magnetic separator and the magnetic beads were subjected to a 2 min migration procedure before the washing buffer was carefully removed. One further washing step with 180 μΐ of washing buffer was carried out. After removal of supernatant, the magnetic beads were suspended in a volume of 100 μΐ of washing buffer for analysis in the MagPix instrument.

Step 5 : Detection

For analysis the PCR plate was read on the MagPix instrument employing 50 μΐ of the total bead suspension vo lume .

Collection of blood samples and Extraction of total R A from blood samples

Materials: PaxGene Blood RNA tubes (Beckton Dickinson), miRNeasy Mini Kit (Qiagen, Germany), Tempus Blood RNA Tubes (Applied Biosystems), Chloroform, Ethanol.

Blood was drawn in PAXgene™ Blood RNA Tubes or Tempus Tubes that contain a proprietary reagent composition based on a patented RNA stabilization technology that stabilizes intracellular RNA. By that, ex vivo changes of expression profiles are avoided.

The RNA can be stabilized by PAXgene™ system (qiagen)for three days at 18-25°C, for five days at 2-8°C, and over a longer period (at least 6 months) at -20°C to -70°C. The PAXgene™ tubes contain 6.9 ml of RNA stabilizing solution and are suitable for the sampling of 2.5 ml blood per tube and patient. Collect 2.5 ml of blood directly into a PAXgene tube.

The RNA can be stabilized by the TEMPUS tube system (Life Technologies) for three days at 18-25°C, for five days at 2-8°C, and over a longer period (at least 6 months) at -20°C to -70°C. The PAXgene™ tubes contain 6.9 ml of RNA stabilizing solution and are suitable for the sampling of 2.5 ml blood per tub

1. Shake tube well

2. Store away at 4°C overnight or at -20°C for a period of several days before proceeding to RNA isolation For extraction of total RNA from blood collected in PAXgene tubes, the miRNeasy Mini Kit (Qiagen) is employed.

1. When frozen, equilibrate the PAXgene tube for at least 2 hours at room temperature. 2. Pellet the blood cell fraction by centrifugation at 5,000g for 10 minutes at room temperature

3. Resuspend the pellet in 10 ml RNase free water, centrifuge again (5,000 g, 10 min, room temperature).

4. Resuspend the pellet in 700 μΐ of QIAzol lysis reagent employing the miRNeasy mini Kit (Qiagen) and incubate for 5 min at room temperature.

5. Add 140 μΐ of chloroform, vortex for 15 sec and incubate for 2-3 min at room temperature.

6. Centrifuge for 15 min with 14,000 rpm at room temperature.

7. Remove the upper aqueous phase containing the RNA fraction and mix it with 1.5 volumes of absolute ethanol to precipitate the RNA.

8. Make aliquots of 700 μΐ each and place each aliquot on a single column provided with the miRNeasy Kit.

9. Centrifuge 15 sec at 13,000 rpm at room temperature. Discard the flow-through.

10. Add 700 μΐ of RWT buffer to each column and centrifuge 15 sec at 13,000 rpm at room temperature. Discard the flow-through.

11. Add 500 μΐ of RPE buffer to each column and centrifuge 2 min at 13,000 rpm at room temperature. Discard the flow-through.

12. Dry the columns by centrifugation at 13,000 rpm for 1 min.

13. Elute the total RNA by adding 40 μΐ of RNase-free water to each of the columns and centrifugation at 13,000 rpm for 1 min at room temperature.

14. Store the total RNA at -70°C until use.

Quality Control

Materials : Nanodrop 1000 (Fischer Scientific, Germany), Agilent Bioanalyzer 2100 (Agilent, Germany), RNA 6000 Pico Kit and RNA 6000 Nano Kit (Agilent, Germany)

1. Check the RNA concentration using the Nanodrop ND-1000 photometer (see Nanodrop manufacturers' instructions)

2. Depending on the RNA concentration, use either the Agilent RNA 6000 Nano Kit (for concentration: 5-500 ng/μΐ) or the Agilent RNA 6000 Pico Kit (for concentrations: 50-5000 pg/μΐ)·

3. Employ the Agilent 2100 Bioanalyzer instrument for measuring the RNA integrity number (RJN) of the total RNA. Follow the manufacturer's protocol for handling the Agilent 2100 Bioanalyzer instrument. Any sample with a RIN below 7 has failed the QC. Continue only with samples that have passed the QC.

Vorwerk S, Ganter K, Cheng Y, Hoheisel J, Stahler PF, Beier M. N Biotechnol. 2008;25: 142-9. Microfluidic-based enzymatic on-chip labeling of miRNAs.

Leidinger P, Keller A, Borries A, Reichrath J, Rass K, Jager SU, Lenhof HP, Meese E. BMC Cancer. 2010 Jun 7;10(1):262. High-throughput miRNA profiling of human melanoma blood samples.

Keller A, Leidinger P, Lange J, Borries A, Schroers H, Scheffler M, Lenhof HP, Ruprecht K, Meese E. PLoS One. 2009 Oct 13;4(10):e7440. Multiple sclerosis: microRNA expression profiles accurately differentiate patients with relapsing-remitting disease from healthy controls.

Keller A, Leidinger P, Borries A, Wendschlag A, Wucherpfennig F, Scheffler M, Huwer H, Lenhof HP, Meese E. BMC Cancer. 2009 Oct 6;9:353.miRNAs in lung cancer - studying complex fingerprints in patient's blood cells by microarray experiments.

Vigneault F, Sismour AM, Church GM. Nat Methods. 2008 Sep;5(9):777-9. Efficient microRNA capture and bar-coding via enzymatic oligonucleotide adenylation.

Arnaud-Barbe N, Cheynet-Sauvion V, Oriol G, Mandrand B, Mallet F. Nucleic Acids Res. 1998 Aug l ;26(15):3550-4. Transcription of RNA templates by T7 RNA polymerase.

Rong M, Durbin RK, McAllister WT. J Biol Chem. 1998 Apr 24;273( 17): 10253-60. Template strand switching by T7 RNA polymerase.

Claims

A method for analysis of small-non-coding RNAs from a biological sample, comprising the steps :

(a) Bringing a biological sample into contact with a plurality of hybridisation probes under hybridisation conditions to bind small non-coding RNAs, the hybridisation probes, comprising :

i. a hybridisation element that is at least partially complementary to a small non-coding RNA, and

ii. an elongation element at the 5 '-terminus of said hybridisation element, and iii. a tag-element at the 3 '-terminus of said hybridisation element

(b) Binding the mixture of step (a) to a plurality of beads, the beads comprising

i. a code that allows to discriminate different beads, and

ii. a nucleotide sequence, complementary to the tag-element at the 3'- terminus of said hybridisation element

(c) Removing unbound and/or non-specific bound material from the beads

(d) Subjecting the bead bound small non-coding RNAs to a template directed

polymerase extension reaction, hereby simultaneously extending and labeling the small non-coding RNA at the 3 '-terminus

(e) Detecting the bead bound elongated non-coding RNA molecules

The method of claim 1 , wherein the hybridisation elements are at least partially complementary to miRNAs

The method of claim 1 or 2, wherein the nucleotide sequence of the hybridization probe and the nucleotide sequence on the beads and the elongated sequence are composed of DNA moieties

The method of any of the claims 1 to 3, wherein the elongation element comprises adenine moieties

The method of claim 4, wherein the beads are color-coded

The method of claim 4 or 5, wherein the beads are magnetic

A kit for analysis of small non-coding RNAs, comprising

(a) hybridisation probes, comprising :

ii. an elongation element at the 5 '-terminus of said hybridisation element, and

iii. a tag-element at the 3 '-terminus of said hybridisation element

(b) coded beads, derivatized with nucleotide sequence, complementary to the tag- element at the 3 '-terminus of said hybridisation element

(c) reagents for performing a template directed primer extension reaction with simultaneous labeling

A method for high parallel isolation and amplification of defined sets of small-non- coding RNAs from a sample, comprising the steps :

(a) Providing a biological sample

(b) Providing a plurality of hybridisation probes on one or more solid supports , the hybridisation probes comprising :

(c) Bringing said sample into contact with the hybridisdation probes under hybridisation conditions to bind small non-coding RNAs

(d) Removing unbound and/or non-specific bound material

(e) Subjecting the bound small non-coding RNAs to a template directed polymerase extension reaction to extend the small non-coding RNA at the 3 '-terminus

(f) Optionally detecting the bound and elongated molecules

(g) Eluting the bound and elongated molecules from step (e) or (f) from the one or more solid supports

9. The method of claim 8, wherein the bound and elongated molecules after step (e) of (f) are subjected to a template directed ligation reaction at the 5 '-terminus to join the reverse complement of the second elongation element to 5 '-terminus of the bound molecules

10. The method of claim 9, wherein the ligation reaction is an enzymatic or a chemical

ligation reaction

11. The method of one of the claims 8 to 10, wherein eluted molecules are amplified

12. The method of claim 11, wherein the amplification is a PCR reaction employing the first and the second elongation element as primer sites

13. The method of claim 11, wherein the amplification is provided by a R A polymerase and the sequence of the first elongation element is selected from the group of a T7-, T3-, or SP6-promoter

14. The method of claim 8, wherein the hybridisation elements on one or more solid supports are at least partially complementary to miR As

15. A solid support for isolation and amplification of small non-coding RNAs, comprising hybridisation probes, wherein the hybridisation probes comprise :

a. a hybridisation element that is at least partially complementary to a small non- coding RNA

b. a first elongation element at the 5 '-terminus of said hybridisation element c. and a second elongation element at the 3 '-terminus of said hybridisation element

16. The solid support of claim 15 wherein the support is a microarray

17. The solid support of claim 15, wherein the support is a collection of color-coded beads or microspheres

18. The solid support of claim 16 or 17, wherein the small non-coding RNAs are miRNAs

19. A kit for isolation and amplification of small non-coding RNAs, comprising

ii. a first elongation element at the 5 '-terminus of said hybridisation element iii. and a second elongation element at the 3 '-terminus of said hybridisation element

b. Reagents for performing a template directed primer extension reaction c. Reagents for eluting molecules from the one or more solid supports

The kit of claim 19, additionally including reagents for performing an amplification reaction

The kit of claim 20, wherein the reagents for performing an amplification reaction comprise a polymerase suitable for performing a PCR reaction

The kit of claim 21, wherein the reagents for performing an amplification reaction comprise a RNA-polymerase