CN109053871B - Application of AtBIX gene in regulation and control of plant flowering time - Google Patents

Abstract

The invention discloses an application of an AtBIX gene in regulating and controlling plant flowering time. The invention screens arabidopsis gene AtBIX through yeast double-impurity, and can specifically interact with CRY2 under blue light. The CRIPSR technology is utilized to mutate the AtBIX gene to obtain a mutant bix-1, the plant shows a late-flowering phenotype relative to wild Arabidopsis, and RT-QPCR detection finds that the FT gene expression amount in the mutant is reduced, which indicates that the AtBIX gene has the function of promoting flowering.

Description

Application of AtBIX gene in regulation and control of plant flowering time

Technical Field

The invention belongs to the technical field of plant genetic engineering, and particularly relates to an application of an AtBIX gene in regulation and control of plant flowering time.

Background

The growth of plants mainly comprises vegetative growth and reproductive growth, and flowering is an important turning point for the transition of plants from vegetative growth to reproductive growth. Studies on the molecular mechanism controlling flowering-time have been conducted for many years in the long-day plant model plant arabidopsis thaliana and the short-day plant rice, and the studies are relatively intensive. The main factors affecting flowering are light, temperature, nutrition and the surrounding environment. There are four major pathways affecting flowering in arabidopsis: vernalization pathway, autonomic pathway, gibberellin pathway, and photoperiod pathway. The vernalization pathway induces flowering of plants mainly by long-term low-temperature treatment, mainly by inhibiting the expression of the FLC gene; the autonomous pathway is independent of photoperiod and is independent of illumination length, and researches show that a plurality of genes related to the pathway mainly regulate and control FLC genes by influencing RNA binding processing or dyeing conformation change; gibberellin can promote the plants to bloom, and the plants usually bloom late after the gene mutation of the gibberellin pathway; the photoperiod approach mainly regulates and controls the flowering of plants by sensing the length of illumination time, the approach is more researched, light receptors CRY2, PHYB and the like can sense the photoperiod to regulate and control the flowering, and finally the flowering is regulated and controlled by the expression of downstream genes such as CO, FT and the like. The FT gene is mainly generated in the phloem of the leaf and then is transported to the top of the plant to regulate the formation of the meristem floral organ and promote the plant to bloom.

Experimental data show that 5-25% of Arabidopsis genes have blue light response and are mostly mediated by CRY1 and CRY 2. CRYs-mediated blue light regulation of gene expression is mainly through two mechanisms: light-dependent transcript regulation and light-dependent inhibition of protein degradation. Light-dependent transcript regulation is mainly the CRY 2-CIBs use, and CIB1 is the first found blue-light dependent CRY2 interacting protein. After being combined, the CIB1 and CRY2 can act on a promoter of an upstream gene FT of a promoter of a floral meristem gene so as to start the flowering of a plant; the heterodimer of CIB can bind to the E-box of the FT promoter. Light-dependent protein degradation inhibition is mainly the CRY-SPA 1/COP1 pathway through which CRYs indirectly regulate gene expression. CRYs can inhibit COP1 and COP 1-mediated protein degradation under blue light to affect gene expression. CRY1 mediates blue light inhibition of COP1 degradation of several transcription factors, including HY5, HYH, HFR1, which can promote de-yellowing. Similarly, CRY2 mediates primarily blue light inhibition of COP1 for degradation of flowering regulator CO. The CCE region of CRY1 interacts with the C-terminal of SPA1, whereas CRY2 interacts with the N-terminal of SPA1 through the N-terminal PHR region. The difference in the protein interaction mechanism leads to a difference in the inhibition mechanism for COP1, CRY1 acts as a competitive inhibitor for SPA1-COP1 in blue light, while the effect of CRY 2-SPA 1 does not affect the interaction between SPA1-COP 1. Under blue light, the interaction between CRY 2-SPA 1 appeared to enhance the interaction between CRY 2-COP 1 in yeast experiments, forming a CRY2/COP1 complex in plants. The blue light receptor plays an important role in regulating and controlling plant photomorphogenesis, so that the protein interacting with CRY2 is screened by yeast to further improve the optical signal path of CRY 2.

Disclosure of Invention

The invention aims to provide application of an AtBIX gene in regulating and controlling flowering time of plants.

In order to achieve the purpose of the invention, the invention provides an application of AtBIX gene in regulating and controlling flowering time of plants, wherein the protein coded by the AtBIX gene is (a) or (b) as follows:

(a) a protein consisting of an amino acid sequence shown as SEQ ID NO. 2;

(b) 2, protein which is derived from (a) and has the same function by substituting, deleting or adding one or more amino acids in the sequence shown in SEQ ID NO. 2.

The cDNA sequence of the AtBIX gene is shown in SEQ ID NO. 1.

In the aforementioned application, the regulation is promoting flowering of the plant.

The invention also provides an AtBIX gene mutant bix-1, wherein the mutant bix-1 is as follows:

i) 3, the nucleotide sequence shown in SEQ ID NO; or

ii) a nucleotide sequence which is obtained by substituting, deleting and/or adding one or more nucleotides into the nucleotide sequence shown in SEQ ID NO. 3 and expresses the same functional protein; or

iii) a nucleotide sequence which hybridizes with the sequence shown in SEQ ID NO. 3 under stringent conditions in a 0.1 XSSPE containing 0.1% SDS or a 0.1 XSSC solution containing 0.1% SDS at 65 ℃ and washing the membrane with the solution and expresses the same functional protein; or

iv) a nucleotide sequence which has more than 90% homology with the nucleotide sequence of i), ii) or iii) and expresses the same functional protein.

The invention also provides a biological material containing the mutant bix-1, wherein the biological material is an expression cassette, an expression vector, a cloning vector, an engineering bacterium or a non-renewable plant part.

The invention also provides application of the mutant bix-1 or biological material containing the mutant in preparing transgenic plants.

The invention also provides application of the mutant bix-1 or biological material containing the mutant in regulating and controlling plant flowering time. Wherein the regulation is delaying flowering time.

Preferably, the use is such that the plant comprises mutant bix-1.

The invention also provides application of the AtBIX gene, the mutant bix-1 or a biological material containing the mutant in plant breeding.

The invention also provides application of the AtBIX gene, the mutant bix-1 or a biological material containing the mutant in plant breeding.

The plant of the invention is a monocotyledon or dicotyledon, preferably arabidopsis thaliana.

The invention also provides a method for delaying the flowering time of arabidopsis thaliana, which is characterized in that site-directed mutagenesis is carried out on the arabidopsis thaliana AtBIX gene by means of genetic engineering, so that the function of the gene is deleted or weakened, and the flowering time of arabidopsis thaliana is delayed; or

The Arabidopsis thaliana AtBIX gene is silenced by introducing a repressor into a plant, thereby delaying the flowering time of Arabidopsis thaliana. Preferably, the method is based on CRISPR/Cas9 technology, sgRNA is designed by taking AtBIX gene as a target, a DNA fragment for coding the sgRNA is constructed on a pYAO: hSpCas9-bar vector (He et al, 2017), arabidopsis is transformed, and transgenic plants with delayed flowering time are screened.

Wherein, the primers for amplifying the DNA fragment encoding the sgRNA are as follows:

BIX-F:5′-GTCGAAGTAGTGATTGTGAAGAAGTCATCACAAGGGTTTTAGAGCTAGAAAT AGC-3′

scaffold-R：5′-TGCCAAGCTTACGCGTAAAAAAAGCACCGACTCGGTGC-3′

the invention also provides a method for cultivating transgenic plants, which comprises the steps of introducing the vector into target plants to obtain transgenic plants and regulating and controlling the flowering time of Arabidopsis plants.

In one embodiment of the present invention, the method of breeding a transgenic plant further comprises obtaining a seed of the transgenic plant and obtaining progeny of the transgenic plant by planting the seed.

The invention also provides a method for regulating and controlling the flowering time of a plant, which comprises the step of introducing the vector or the vector containing the gene into the plant to express the vector in the plant, so as to regulate and control the flowering time of an arabidopsis thaliana plant.

The expression vector carrying the gene of interest can be introduced into Plant cells by conventional biotechnological methods using Ti plasmids, Plant viral vectors, direct DNA transformation, microinjection, electroporation, etc. (Weissbach, 1998, Method for Plant Molecular Biology VIII, academic Press, New York, pp.411-463; Geiserson and Corey, 1998, Plant Molecular Biology, 2)^ndEdition)。

In a specific embodiment of the invention, a CRIPSR system is utilized to construct a target sequence of an Arabidopsis AtBIX gene on a pYAO hSpCas9-bar vector, the vector is transferred into Agrobacterium AGL0, an Arabidopsis is transformed by a method of soaking inflorescences, and a gene editing plant is obtained. And carrying out flowering experiment statistics and gene expression detection by using the homozygous mutant.

By the technical scheme, the invention at least has the following advantages and beneficial effects:

the invention screens arabidopsis gene AtBIX through yeast double-impurity, and can specifically interact with CRY2 under blue light. The CRIPSR technology is utilized to mutate the AtBIX gene to obtain a mutant bix-1, the plant shows a late-flowering phenotype relative to wild Arabidopsis, and RT-QPCR detection finds that the FT gene expression amount in the mutant is reduced, which indicates that the AtBIX gene has the function of promoting flowering.

Drawings

FIG. 1 shows the phenotype of the bix-1 mutant with late flowering in a preferred embodiment of the invention; wherein A is the flowering phenotype and B is the statistical result of the flowering time.

FIG. 2 shows the decrease in the expression level of FT gene in bix-1 mutant in a preferred embodiment of the invention.

Detailed Description

The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. Unless otherwise indicated, the examples follow conventional experimental conditions, such as the Molecular Cloning handbook, Sambrook et al (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual,2001), or the conditions as recommended by the manufacturer's instructions.

Example 1 construction of Arabidopsis AtBIX Gene mutant plant knockout vector

Primers for amplification comprising the guide RNA sequence (SEQ ID NO: 4-5):

BIX-F:GTCGAAGTAGTGATTGTGAAGAAGTCATCACAAGGGTTTTAGAGCTAGAAATAGC

scaffold-R：TGCCAAGCTTACGCGTAAAAAAAGCACCGACTCGGTGC

primers used to amplify the U6 fragment:

AtU6-F：ACTAGATCGGACTAGTAAGCTTCGTTGAACAACGGAAA

AtU6-R：AATCACTACTTCGACTCTAGCTG

(1) prime Star amplification of fragments of interest

1) Reaction system:

the JRH0647 vector is constructed by using PUC19 as a framework vector and inserting a fragment U6-gRNA-scaffold between enzyme cutting sites EcoR1 and BamH 1. The construction method of The JRH0647 vector is described in Reqing He et al, photo-responsive F-box protein FOF2 regulating genes homology by promoting FLCexpression in Arabidopsis, The Plant Journal (2017)91, 788-801. The method is briefly described as follows:

and performing two rounds of PCR, wherein the first round of PCR respectively amplifies U6 and scaffold, and the second round of PCR respectively amplifies a fragment U6-gRNA-scaffold by taking the mixed PCR products of the first round as a template.

First round PCR:

primers used to amplify the U6 fragment (template was arabidopsis genome):

JRH0647-F1:GACGGCCAGTGAATTCAGGCCTAAGCTTCGTTGAACAACGGAAA

JRH0647-R1:AGGTCTTCTCGAAGACCCAATCACTACTTCGACTCTAGCT

primers used to amplify the scaffold (template was vector pU3-gRNA, see Shan et al, 2013):

JRH0647-F2：GGGTCTTCGAGAAGACCTGTTTTAGAGCTAGAAATAGCAA

JRH0647-R2：CGACTCTAGAGGATCCACGCGTAAAAAAAGCACCGACTCGGTGC

primers for the second round of PCR:

JRH0647-F1：GACGGCCAGTGAATTCAGGCCTAAGCTTCGTTGAACAACGGAAA

JRH0647-R2：CGACTCTAGAGGATCCACGCGTAAAAAAAGCACCGACTCGGTGC

after two rounds of PCR, a fragment U6-gRNA-scaffold is obtained through amplification, and the fragment U6-gRNA-scaffold is inserted between the EcoR1 and the BamH1 enzyme cutting sites of the vector PUC19, so that the JRH0647 vector is obtained.

2) Reaction procedure:

the U6 fragment was amplified using the primer U6-F/U6-R, and the gRNA-containing fragment was amplified using the primer BIX-F/SCAFFOLD-R.

(2) PCR product recovery and product ligation

The PCR product was recovered using an agarose gel recovery kit (purchased from Axygen), and after recovery, the two fragments were ligated together by amplification using the primers U6-F/SCAFFOLD-R according to the procedure described above (in which the template was changed to U6 and gRNA fragments).

(3) Enzyme digestion

The vector pYAO hSpCas9-bar was digested with SpeI, MluI.

1) Reaction system:

2) reaction conditions are as follows:

water bath at 37 deg.C for 30 min.

(4) In-fusion junction

The reagent used is Clontech 5 × In-

HD Enzyme Premix。

And connecting the recovered DNA fragment with the vector pYAO (hSpCas 9-bar) which is recovered after enzyme digestion.

1) Reaction system:

In-fusion 0.5μL

DNA fragment 1. mu.L

Vector fragment 1. mu.L

2) Reaction conditions are as follows:

50℃，30min。

(5) e.coli TOP10 transformation

1) Taking out TOP10 competent cells (Kangji) from-80 ℃ and placing in an ice box, after the competent cells are slightly melted, taking 50 mu L into a 1.5mL EP tube, adding 2.5 mu L of the ligation product into the EP tube by using a pipette, flicking the tube wall to fully mix the two, and standing the cell in ice for about 30 min;

2) placing the centrifuge tube in a 42 ℃ water bath kettle, thermally shocking for 90s, and rapidly carrying out ice bath for 2 min;

3) adding 600 mu L of LB culture medium without antibiotics into each centrifuge tube, mixing uniformly, placing in a 37 ℃ shaking table, and carrying out shaking culture at 200rpm for 1 h;

4) carrying out instantaneous centrifugation at 12000rpm, taking out the centrifuge tube in a super clean bench, removing most of the LB culture medium supernatant, leaving about 50 mu L of the LB culture medium supernatant, and blowing and mixing the medium by a pipette;

5) the bacterial liquid is evenly coated on an LB plate culture medium added with kanamycin antibiotic, and after the plate is dried, the plate is placed upside down in a thermostat at 37 ℃ for culture overnight.

(6) Identification of Positive clones

Single clones on the plate were picked with toothpicks, streaked on LB plates containing antibiotics, and then colony PCR was performed with toothpicks in a tube containing PCR reaction mixture under gentle agitation for several hours. Multiple single clones can be picked and marked on the plate to increase the probability of obtaining positive clones. The plates were then incubated overnight at 37 ℃.

1) Reaction system: (2 XTaq MasterMix available from Kangshu Co.)

2) Reaction procedure:

and (3) carrying out electrophoretic detection on the PCR product, cloning a target fragment, marking a corresponding plate, and sending a bacterium solution for sequencing to obtain a positive clone connected with the forward gene.

(7) Plasmid extraction for sequencing correct monoclonal, amplification of bacterial liquid, extraction of plasmid with kit,

the method comprises the following steps:

a) 2ml of overnight-cultured bacterial solution was centrifuged at 12000g for 1min, and the supernatant was discarded.

b) Add 250. mu.l Buffer S1 (containing RNase) and pipette the suspended bacterial pellet, as necessary to ensure uniformity.

c) Adding 250 μ l of Buffer S2, gently turning up and down for several times, and mixing uniformly to crack the thallus fully until a transparent solution is formed. This step should not be carried out for more than 5min to prevent the plasmid DNA from being cleaved.

d) Mu.l of Buffer S3 was added, gently and well mixed several times, and centrifuged at 12000g for 10 min.

e) The supernatant was aspirated and transferred to a preparation tube (placed in a 2ml centrifuge tube), centrifuged at 12000g for 1min, and the filtrate was discarded.

f) The preparation tube was put back into a 2ml centrifuge tube, 500. mu.l of Buffer W1 was added thereto, 12000g was centrifuged for 1min, and the filtrate was discarded.

g) The prepared tube is put back into a centrifuge tube, 700 mul of Buffer W2 and 12000g are added for centrifugation for 1min, and the filtrate is discarded; and repeating the steps once.

h) The prepared tube was placed back in a 2ml centrifuge tube and centrifuged at 12000g for 1 min.

i) Transfer the preparation tube into a clean 1.5ml centrifuge tube and add 40. mu.l ddH to the center of the adsorption tube membrane₂And O, standing at room temperature for 1 min. The plasmid DNA was eluted by centrifugation at 12000g for 1 min.

Example 2 Gene editing Arabidopsis thaliana

After agrobacterium is transformed by the constructed plasmid containing BIX-gRNA, arabidopsis transformation is carried out.

1. Preparation and transformation of agrobacterium-infected state

1) Preparation of Agrobacterium competence

Single colonies of agrobacterium AGL0 are picked and respectively placed in 5ml LB liquid culture medium containing corresponding antibiotics, and K599 resistance is as follows: streptomycin 100. mu.g/ml; AGL0 resistance was: rifampicin (Rif) at 100. mu.g/ml. Culturing at 28 deg.C overnight; inoculating 500 μ l of overnight culture liquid into 50ml LB liquid culture medium containing corresponding antibiotics, and culturing at 28 deg.C until OD600 is about 0.5; standing on ice for 30 min; centrifugation at 5,000rpm for 10min at 4 ℃ was performed with 15ml of pre-cooled 10mM CaCl₂Resuspending the Agrobacterium cells, and centrifuging at 5,000rpm for 10min at 4 ℃; the pellet was resuspended in 2ml of pre-cooled 10mM CaCl2, aliquoted on ice at 100. mu.l/tube, snap frozen in liquid nitrogen and stored at-80 ℃.

2) Agrobacterium transformation

Thawing 100 μ l of competent cells on ice, adding 1 μ g of plasmid DNA, mixing, standing on ice for 25 min to 30min, quickly freezing with liquid nitrogen for 3-5min, immediately placing in 37 deg.C water bath for 5min, adding 1ml of non-resistant LB liquid culture medium, thawing at 28 deg.C and 160rpm for 3-5h, and uniformly spreading the bacterial liquid on solid culture medium containing corresponding antibiotics. And (3) carrying out inverted culture at 28 ℃ for 2-3 d, selecting single bacteria, and identifying positive clones by using PCR.

2. Agrobacterium transformation of Arabidopsis thaliana

(1) Pretreatment of arabidopsis transformation:

arabidopsis thaliana was grown in a greenhouse with long day at 22 ℃ and infested when most of the plants had formed apical inflorescences (about 35 days).

(2) Preparing inflorescence transformation liquid:

transformed Agrobacterium (AGL0) was inoculated monoclonally into 50mL LB liquid medium (containing antibiotics). Shake culture at 28 ℃ overnight until OD600 is 1.0-2.0. Centrifuging at 4000rpm for 10min, and discarding the supernatant. The Agrobacterium pellet was suspended in inflorescence transformation medium and the OD600 of the suspension was 0.8. 50mL of inflorescence transformation solution was used per 1 pot of Arabidopsis thaliana.

Inflorescence transformation liquid: an aqueous solution containing 5% sucrose and 0.02% Silwet-77.

(3) Transformation of Arabidopsis thaliana:

pouring the inflorescence transformation liquid into a square culture dish, immersing the inflorescence on the upper part of the Arabidopsis into the transformation liquid, and fully contacting all the inflorescences with the transformation liquid by a method of rotating a flowerpot and pressing a bamboo stick (the time is about 30 s). The Arabidopsis thaliana was placed on its side in a black tray and covered with a black tray and left in the dark for 12-24 h. The next day, a small amount of water was sprayed on the plant surface. And transferring to normal condition for culture until the seeds are mature, and collecting the seeds. If it is desired to increase the transformation rate, the plants may be transformed 2 to 3 times at intervals of 6 days. And harvesting seeds after one month.

Example 3 identification of transgenic Positive lines

A total of 18 transgenic lines were obtained by PCR identification. To determine transgenic positive plants, a fresh and tender leaf was taken, DNA was extracted, and PCR detection was performed. Wherein for CRISPR knockout mutants we detected their Basta resistance gene, Cas9 protein and U6 promoter. And carrying out PCR amplification and sequencing on the position of the gRNA. Finally, 3 mutants were selected from 18 transgenic lines (in the same way as the mutation). The nucleotide sequence of the AtBIX gene mutant bix-1 is shown in SEQ ID NO. 3.

EXAMPLE 4 phenotypic characterization of transgenic plants containing the bix-1 mutant

Adding water to the seeds, vernalizing the seeds for 3 days at 4 ℃, directly connecting the seeds into soil, growing the seeds under long-day sunlight, counting the flowering time of each individual plant when the plants bloom, and photographing.

The experimental results are shown in FIG. 1 and FIG. 2, in FIG. 1, the phenotype of the bix-1 mutant with late flowering is shown, A is the flowering phenotype, and B is the statistical result of the flowering time. FIG. 2 shows that the expression level of FT gene was decreased in the bix-1 mutant. col4 is a wild type control.

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Reference to the literature

1、He,R.,Li,X.,Zhong,M.,Yan,J.,Ji,R.,Li,X.,Wang,Q.,Wu,D.,Sun,M.,Tang,D.,et al.(2017).A photo-responsive F-box protein FOF2regulates floralinitiation by promoting FLC expression in Arabidopsis.Plant J 91,788-801.

2、Yan,L.,Wei,S.,Wu,Y.,Hu,R.,Li,H.,Yang,W.,and Xie,Q.(2015).High-Efficiency Genome Editing in Arabidopsis Using YAO Promoter-Driven CRISPR/Cas9System.Mol Plant 8,1820-1823.

3、Shan,Q.,Wang,Y.,Li,J.,Zhang,Y.,Chen,K.,Liang,Z.,Zhang,K.,Liu,J.,Xi,J.J.,Qiu,J.L.,et al.(2013).Targeted genome modification of crop plants usinga CRISPR-Cas system.Nature biotechnology 31,686-688.

Sequence listing

<110> institute of crop science of Chinese academy of agricultural sciences

Application of <120> AtBIX gene in regulation and control of plant flowering time

<130>KHP181113280.5

<160>5

<170>SIPOSequenceListing 1.0

<210>1

<211>546

<212>DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400>1

atgtcgaaga agaggaaggc tcgtagcggc tacttgaaga agtcatcaca aggaggagac 60

gaagctgtgg tacagcgaag aaaactagtt ccaaaacctg gtaaaattgg gaaagagatt 120

gatgatatct ttgctgggag atctcagagg acgccagagg tccaaaatcc cgagtcgaga 180

gacacgccag aagcccaagt atccgagtcg agagacacta gagctgagat gaatgagctc 240

aatgttgggg tcaataacaa cactgaaagc cgacctagga cgagaattct cagtaacgac 300

acgggacccc gatccaggac gagacgactc ctcaggacga gacgaccact caggacgaga 360

actctccgta acaacaggga aagccgaccc agctcgagta tttttaataa cgatacggaa 420

gatagccgac ccaggaagac aactgaagac gggttacgag tgttcacgga aaatgaaatt 480

ggtttcaaca ggaaagatgc tggtggtact cgtttttgtc cctttgactg ttattgttgc 540

ttctaa 546

<210>2

<211>181

<212>PRT

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400>2

Met Ser Lys Lys Arg Lys Ala Arg Ser Gly Tyr Leu Lys Lys Ser Ser

1 5 10 15

Gln Gly Gly Asp Glu Ala Val Val Gln Arg Arg Lys Leu Val Pro Lys

20 25 30

Pro Gly Lys Ile Gly Lys Glu Ile Asp Asp Ile Phe Ala Gly Arg Ser

35 40 45

Gln Arg Thr Pro Glu Val Gln Asn Pro Glu Ser Arg Asp Thr Pro Glu

50 55 60

Ala Gln Val Ser Glu Ser Arg Asp Thr Arg Ala Glu Met Asn Glu Leu

65 70 75 80

Asn Val Gly Val Asn Asn Asn Thr Glu Ser Arg Pro Arg Thr Arg Ile

85 90 95

Leu Ser Asn Asp Thr Gly Pro Arg Ser Arg Thr Arg Arg Leu Leu Arg

100 105 110

Thr Arg Arg Pro Leu Arg Thr Arg Thr Leu Arg Asn Asn Arg Glu Ser

115 120 125

Arg Pro Ser Ser Ser Ile Phe Asn Asn Asp Thr Glu Asp Ser Arg Pro

130 135 140

Arg Lys Thr Thr Glu Asp Gly Leu Arg Val Phe Thr Glu Asn Glu Ile

145 150 155 160

Gly Phe Asn Arg Lys Asp Ala Gly Gly Thr Arg Phe Cys Pro Phe Asp

165 170 175

Cys Tyr Cys Cys Phe

180

<210>3

<211>547

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

atgtcgaaga agaggaaggc tcgtagcggc tacttgaaga agtcatcaca aaggaggaga 60

cgaagctgtg gtacagcgaa gaaaactagt tccaaaacct ggtaaaattg ggaaagagat 120

tgatgatatc tttgctggga gatctcagag gacgccagag gtccaaaatc ccgagtcgag 180

agacacgcca gaagcccaag tatccgagtc gagagacact agagctgaga tgaatgagct 240

caatgttggg gtcaataaca acactgaaag ccgacctagg acgagaattc tcagtaacga 300

cacgggaccccgatccagga cgagacgact cctcaggacg agacgaccac tcaggacgag 360

aactctccgt aacaacaggg aaagccgacc cagctcgagt atttttaata acgatacgga 420

agatagccga cccaggaaga caactgaaga cgggttacga gtgttcacgg aaaatgaaat 480

tggtttcaac aggaaagatg ctggtggtac tcgtttttgt ccctttgact gttattgttg 540

cttctaa 547

<210>4

<211>55

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

gtcgaagtag tgattgtgaa gaagtcatca caagggtttt agagctagaa atagc 55

<210>5

<211>38

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

tgccaagctt acgcgtaaaa aaagcaccga ctcggtgc 38

Claims (2)

1. A method for delaying the flowering time of Arabidopsis is characterized in that site-directed mutagenesis is carried out on an Arabidopsis AtBIX gene by a genetic engineering means, so that the function of the gene is deleted or weakened, and the flowering time of the Arabidopsis is delayed; or

Silencing Arabidopsis AtBIX gene by introducing inhibitor into plant, thereby delaying Arabidopsis flowering time;

wherein, the amino acid sequence of the protein coded by the AtBIX gene is shown as SEQ ID NO. 2.

2. The method of claim 1, wherein the sgRNA is designed based on CRISPR/Cas9 technology with AtBIX gene as target, a DNA fragment encoding the sgRNA is constructed on a pYAO: hSpCas9-bar vector, and Arabidopsis thaliana is transformed, and transgenic plants with delayed flowering time are screened;

wherein, the primers for amplifying the DNA fragment encoding the sgRNA are as follows:

BIX-F:5′-GTCGAAGTAGTGATTGTGAAGAAGTCATCACAAGGGTTTTAGAGCTAGAAATAGC-3′

scaffold-R：5′-TGCCAAGCTTACGCGTAAAAAAAGCACCGACTCGGTGC-3′。

Images