CN108977462B

CN108977462B - Method for increasing sugar content in strawberry fruits

Info

Publication number: CN108977462B
Application number: CN201810970622.5A
Authority: CN
Inventors: 伊兴凯; 魏书
Original assignee: Institute of Gardening of Anhui Academy Agricultural Sciences
Current assignee: Institute of Gardening of Anhui Academy Agricultural Sciences
Priority date: 2018-08-24
Filing date: 2018-08-24
Publication date: 2022-05-17
Anticipated expiration: 2038-08-24
Also published as: CN108977462A

Abstract

The invention provides a method for improving sugar content in strawberry fruits, which is characterized in that genes for encoding strawberry polyol/monosaccharide transport proteins are introduced into target strawberry fruits to be subjected to transient overexpression, and the strawberry fruits with high sugar content are obtained; the gene for coding the strawberry polyol/monosaccharide transport protein consists of a base sequence shown in a sequence 1 in a sequence table, and compared with a control, the method disclosed by the invention improves the sugar content in strawberry fruits, greatly improves the fructose content in the strawberry fruits, and effectively improves the mouthfeel of the strawberry fruits.

Description

Method for increasing sugar content in strawberry fruits

Technical Field

The invention relates to the field of strawberry planting, in particular to a method for improving sugar content in strawberry fruits.

Background

Strawberry is a perennial herb of the Rosaceae family. The fruits are sharp-pointed and oval, delicious, red and tender, and juicy, so the fruits are praised as 'fruit queen' because of the abundant vitamin C and wide application value. However, strawberries have a wide difference in flavor and quality among different varieties. The variety bred by the conventional hybridization method in China has a lower cultivation area and market share than those of Japanese and American varieties, and the poor flavor quality caused by the low sugar content of strawberry fruits is one of the most important reasons. How to increase the sugar content of strawberry fruits, improve the flavor quality of the fruits and increase the market share is a technical problem to be solved urgently.

Sugars are not only the material basis for fruit growth and development, but also play a critical role in regulating carbohydrate partitioning, coordinating intercellular signal transduction, and enhancing adaptability to the environment (Rolland et al, 2006). In most fruits, soluble sugar accumulation mainly exists in the form of sucrose, glucose and fructose (Patrick et al, 2012), Agius (2005) and the like, and it is considered that methods for improving the ratio of fructose to glucose, improving fruit flavor and improving fruit health by improving fructose accumulation through genetic and molecular biology techniques have important significance.

In the transport of carbohydrates in plants, sugar transport across the membrane is mediated by sugar transporters, but sugar transporters have different functions and different action positions (Doidy et al, 2012; Martinoia et al, 2012). Studies have shown that arabidopsis polyol/monosaccharide transporters (AtPMT) are demonstrated to have a sugar transport function, and are involved in the transport of fructose into sink cells in phloem exosomes (Klepek et al, 2010), Wormit (2006) reports that during fruit development, sugar transporter activity on the vacuolar membrane is up-regulated, with a consequent increase in sugar transport into the vacuole.

Disclosure of Invention

The invention aims to provide a method for improving the sugar content in strawberry fruits. In order to achieve the technical purpose, the invention adopts the specific technical scheme that:

a method for increasing sugar content in strawberry fruit comprises introducing genes encoding strawberry polyol/monosaccharide transport protein into objective strawberry fruit for transient overexpression to obtain strawberry fruit with high sugar content;

the gene for coding the strawberry polyhydric alcohol/monosaccharide transport protein consists of a base sequence shown as a sequence 1 in a sequence table.

As an improved technical scheme, the gene for encoding the strawberry polyhydric alcohol/monosaccharide transport protein is introduced into the strawberry fruit through a recombinant vector; the recombinant vector is obtained by inserting the DNA molecule shown in the sequence 1 in the sequence table into the multiple cloning site of the pCAM2300 plasmid and transforming the competent cell of the agrobacterium GV3101, so as to obtain the over-expression vector 2300-31477-GV 3101.

As an improved technical scheme, the primer sequence of the gene for coding the strawberry polyhydric alcohol/monosaccharide transport protein is as follows:

5′–3′ATGAAGGGGGCTGTGTTTGTGG

3′–5′TTACTCATTTTTGGCAGCAGCAATT

as an improved technical scheme, the pCAM2300 plasmid is subjected to double digestion by a restriction enzyme KpnI and a restriction enzyme XbaI.

As an improved technical scheme, the gene for coding the strawberry polyol/monosaccharide transporter is subjected to double enzyme digestion by restriction enzyme KpnI and restriction enzyme XbaI.

As an improved technical scheme, the gene for coding the strawberry polyhydric alcohol/monosaccharide transport protein and the pCAM2300 plasmid are connected for 12h to 16h by T4 ligase at the temperature of 12 ℃ to 16 ℃.

As an improved technical scheme, the double enzyme digestion system comprises: 30 μ L of plasmid +0.5 μ L KpnI +0.5 μ L XbaI +5 μ L LM Buffer +14 μ L ddH 2O.

As an improved technical scheme, the transient overexpression process comprises the following steps: the over-expression vector 2300-31477-GV3101 is injected into the strawberry fruit and slowly injected from the fruit stem to the central part of the fruit.

As an improved technical scheme, the transient overexpression operation is carried out at the 3 rd stage of strawberry fruit development.

Advantageous effects

The invention provides a method for improving sugar content in strawberry fruits, which is characterized in that genes for encoding strawberry polyhydric alcohol/monosaccharide transporters are introduced into objective strawberry fruits to be transiently overexpressed, and the strawberry fruits with high sugar content are obtained. According to the invention, the over-expression vector 2300-31477-GV3101 is injected into the 3 rd stage of strawberry fruit development, and is slowly injected from the fruit stalk to the central part of the fruit, so that the agrobacterium is infiltrated into the whole fruit during injection, and after instantaneous infection for 3 weeks, the sugar content in the fruit is increased by more than 45.5% compared with that in a control, the glucose and sucrose contents are also increased, the mouthfeel of the strawberry fruit is greatly improved, and the strawberry fruit is sweet.

Drawings

FIG. 1 shows 7 different developmental stages of strawberry fruit according to the present invention.

FIG. 2 is a graph showing fluorescence logarithm curves of quantitative expression detection of strawberry fruit genes in the present embodiment.

FIG. 3 is a fluorescence linear diagram showing the quantitative expression detection of strawberry fruit genes in the embodiment of the present invention

FIG. 4 shows the expression of important genes in strawberry fruits according to the present invention.

FIG. 5 shows the alignment of g-31477 cDNA sequences in the example of the present invention.

FIG. 6 shows the transmembrane structure analysis (gene31477) of the protein sequence in the present embodiment.

FIG. 7 shows the g-31477 specific band in the present example.

FIG. 8 shows the recycling of the cut rubber in the embodiment of the present invention.

FIG. 9 shows colony PCR for pEAST ligation in an example of the present invention.

FIG. 10 shows an alignment of the nucleotide sequences of the sequencing results in the examples of the present invention.

FIG. 11 shows an alignment of the protein sequences obtained from the sequencing according to the example of the present invention.

FIG. 12 shows the pCAM2300 plasmid double digestion in the present embodiment.

FIG. 13 shows the 31477-pEASY plasmid double digestion according to the present invention.

FIG. 14 shows DH5a-31477 verification according to one embodiment of the present invention.

FIG. 15 shows the validation of G-31477 Agrobacterium in an example of the present invention.

FIG. 16 shows plasmid pCAM2300 constructed in an example of the present invention.

FIG. 17 depicts overexpression transient infection in an embodiment of the invention.

FIG. 18 shows the sugar content in fruits after over-expression vector injection in the present example.

FIG. 19 shows the sugar content of control CK strawberry fruits in the examples of the present invention.

FIG. 20 shows comparison of expression difference between control of important sugars and treatment in examples of the present invention.

In the figure, 1 is a g-31477 specific strip, 2 is a pCAM2300 plasmid double-enzyme-cutting product, 3 is 31477-pEASY plasmid double-enzyme-cutting, and M is marker.

Detailed Description

In order to make the purpose and technical solutions of the embodiments of the present invention clearer, the technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. It is to be understood that the embodiments described are only a few embodiments of the present invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the described embodiments of the invention without any inventive step, are within the scope of protection of the invention.

It will be understood by those skilled in the art that, unless otherwise defined, all terms (including technical and scientific terms) used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. It will be further understood that terms, such as those defined in commonly used dictionaries, should be interpreted as having a meaning that is consistent with their meaning in the context of the prior art and will not be interpreted in an idealized or overly formal sense unless expressly so defined herein.

In order to solve the problems of low sugar content and poor taste of strawberry fruits in the prior art, the invention provides a method for improving the sugar content of the strawberry fruits.

Example 1

The method comprises the steps of (I) screening a strawberry polyol/monosaccharide transporter gene based on a cDNA sequence, and excavating the strawberry polyol/monosaccharide transporter gene. Strawberry complete genomes (Fragaria vesca) published at NCBI and strawberry genome websites (http:// www.strawberrygenome.org) are respectively aligned by taking protein sequences of Arabidopsis thaliana monosaccharide transporter PMT (poly/monosaccharide transporter) as templates to obtain 13 Arabidopsis thaliana AtPMT homologous suspected sugar transporter genes.

2. And (3) designing a primer. Quantitative PCR primers were designed in the cDNA region of each sugar transporter gene using the software Premier primers5.0, and 18SrRNA was used as an internal reference gene for fluorescent quantitative PCR analysis. Quantitative PCR primers (Table 1) were designed based on the cDNA sequence of the gene obtained above, and 18SrRNA was used as a reference gene.

TABLE 1 primer sequences for qRT-PCR analysis

3. And (3) extracting and purifying RNA. And (4) extracting RNA. [ CTAB buffer solution (1M Tris-HCl, 0.5M Na)₂EDTA.2H₂O, 5M NaCl, CTAB, PVP)1mL, preheating at 65 ℃ for 10 minutes; ② liquid nitrogen precooling mortar and pestle, adding material to be ground, and fully grinding the strawberry sample under the condition of keeping freezing. Adding the ground sample into the preheated extracting solution (adding 40 μ L of beta-mercaptoethanol), and shaking for 10 min; water bath at 65 deg.C for 30min, and shaking up every 5 min; centrifugation for 15min (12000g, 4 ℃); ③ taking the supernatant, adding equal volume of chloroform: isoamyl alcohol (24:1, v/v)Shaking up; centrifuging at 12000g and 4 ℃ for 10 min; fourthly, taking the supernatant, adding 2.5 times of precooled absolute ethyl alcohol and 200 mu L of NaAc into the supernatant, and precipitating the mixture for 30min at the temperature of minus 20 ℃; 12000g, centrifuging for 10min at 4 ℃; adding 70% ethanol, washing precipitate, centrifuging at 12000g and 4 deg.C for 5min, removing supernatant, and repeating once; standing at room temperature for 5 minutes, and air-drying the precipitate; fourthly, 0, dissolving the precipitate by 400 mu L of DEPC sterile water, adding 1/4 volumes of 10M LiCl, and standing overnight at the temperature of minus 20 ℃ for 8 to 12 hours; 112000g, centrifuging for 15min at 4 ℃; washing the precipitate with 70% ethanol for one time; air dried and dissolved in 50. mu.L of DEPC sterile water. And (4) purifying the RNA sample. Preparing the following mixed solution in a microcentrifuge tube: 10 XDNaseBuffer 5.0. mu.L, DNase I (RNase Free, 10Units) 2.0. mu.L, RNase Inhibitor (20Units) 0.5. mu.L; ② taking 20-50 mu L of strawberry RNA sample, adding DEPC treated water, and obtaining 50 mu L of total volume. Placing the centrifugal tube (reaction system) in an incubator, reacting for 30min at 37 ℃, and taking out; ③ adding 50 mu L of DEPC sterilized water, adding phenol/chloroform/isoamyl alcohol (25:24:1, v/v/v) with the same volume, and mixing evenly; centrifuging at 12000g for 5min at room temperature; fourthly, taking the supernatant, adding chloroform/isoamylol (24:1, v/v) with the same volume, and mixing; centrifuging at 12000g for 5min at room temperature; taking the supernatant, adding 10 mu L of 3M sodium acetate and 250 mu L of glacial acetic acid, mixing and then placing at-80 ℃ (20 minutes); centrifuging at 12000g for 10min at 4 ℃, and removing supernatant; sixthly, adding 70 percent cold ethanol, washing, centrifuging for 5 minutes at 4 ℃ at 12000g, and removing supernatant; standing at room temperature for 5min to dry the precipitate; dissolved with 50 μ L DEPC treated water; seventhly, using 1.0% agarose gel electrophoresis to detect the integrity of the total DNA and RNA. The concentration of RNA was measured using a Nanodrop2000 nucleic acid analyzer (Thermo, USA).

4. And (5) reverse transcription reaction. Reverse transcription was performed as described using the PrimeScript RT reagent Kit (TaKaRa). The method comprises the following steps: reaction solution 10. mu.l, 5 XPrimescript buffer 4. mu.l, primipt RT Enzyme mix 11.0. mu.l, RT primer mix 1.0. mu.l, RNase, free DH₂O4.0. mu.l; temperature control: 15 minutes at 37 ℃ and 5 seconds at 85 ℃.

5. And (4) quantitative PCR and sequencing. The real-time fluorescent quantitative PCR adopts SYBR Green dye method TransStart Top Green qPCR Mix (10 mu L); DNA template (100 ng); forward primer (10mM, 0.5. mu.L); reverse primer (10mM 0.5. mu.L); ddH₂O (9. mu.L). Expanding deviceAdding a program: firstly, pre-denaturation is carried out for 1min at 95 ℃; ② denaturation at 94 ℃ for 20 seconds; ③ annealing at 58 ℃ for 20 seconds; extension at 72 ℃ for 20 seconds; the cycle was 27 times. Analyzing a melting curve: 65-95 ℃ and is increased from 65 ℃ to 95 ℃ at a temperature of 0.5 ℃/5 seconds. Each reaction was repeated 3 times. Taking 18S as an internal reference gene, carrying out homogenization treatment on data obtained by different samples through the internal reference gene, and then carrying out 2^-ΔΔCTThe relative expression quantity of the gene to be detected is calculated by the method.

6. And (4) carrying out quantitative analysis on fruit samples of different development stages of the strawberries. The strawberry samples were divided into 7 developmental stages (fig. 1). After RNA extraction and purification, Primescript is used^TMThe purified RNA was reverse transcribed by RT reagent Kit (TaKaRa), and then subjected to quantitative PCR analysis. The gene specificity is shown by a dissolution curve that the tested gene has stronger specificity (figure 2 and figure 3). The data obtained from different samples are normalized by the reference gene and then pass 2^-ΔΔCTThe relative expression level of the gene is calculated.

7. And (3) screening the strawberry polyol/monosaccharide transporter gene based on the cDNA sequence. In strawberry fruit, the real-time fluorescence quantitative expression pattern of 13 genes of the FAPMT family of carbohydrate metabolic pathways is shown in the figure. The results show that 13 genes show different degrees of expression, wherein g-31477(XP _004300112.1) has relatively high expression level in the fruit development process (FIG. 4), and the g-31477(XP _004300112.1) is considered to be screened.

(II) verification of selected genes

1. And (5) homology comparison. The cDNA sequence of g-31477 was aligned in NCBI and the homology of the glucohexon transporter gene (vitas vinifera hexose transporter-like) to the gene31477cDNA sequence reached 80% (FIG. 5).

2. And (4) analyzing a gene transmembrane structure. Gene31477 to be screened out

(XP-004300112.1) for transmembrane constructs

(http:// www.cbs.dtu.dk/services/TMHMM /) analysis showed that they all contained 12 transmembrane structures, with the N-terminus located extracellularly and the C-terminus located cytosolically, and a hydrophilic loop region of approximately 330 amino acids located intracytoplasmically between the 5 th and 6 th transmembrane regions, consistent with the transmembrane structure of Arabidopsis thaliana, indicating that they belong to the MST family; and a core region intermediate the 6 th and 7 th transmembrane regions (FIG. 6), which is substantially identical to the transmembrane similarity of AtPMT 2.

3. Gene cloning and vector construction

(1) g-31477 cloning gene. Firstly, designing a primer. Calculating and determining an initiation codon and a termination codon according to a continuous amino acid sequence to obtain a continuous sequence, performing nucleotide sequence comparison in NCBI website to obtain mRNA, and designing a primer sequence on the sequence. At NEBcuter V2.0: Website:

http:// tools.neb.com/NEBcut 2/index.php, the cds sequence was placed in a dialog box and the sequences corresponding to the KpnI/XbaI cleavage sites (GGTACC and TCTAGA) were added to the primer front according to the usual pCAMbia2300 plasmid sequence used in this laboratory (Table 2). Strawberry RNA was extracted, reverse transcribed, PCR amplified with designed primers, and the size of the g-31477 fragment was verified by running gel (FIG. 7). ② the gel cutting recovery and purification of the target gene. The fragment of interest was recovered and purified by PCR amplification using Easy Pure Quick Gel Extraction Kit. The eluted DNA was maintained at-20 deg.C (FIG. 8). Connecting, transforming and verifying cloning vector. And (4) connecting. To the 4. mu.L of the LPCR product, 1. mu.L of pEASY-Blunt vector (Transgen, having both kanamycin and ampicillin resistance) was added. 5-6 single colonies were picked, labeled and subjected to colony PCR using Easy-Taq enzyme. Mu.l of each PCR amplification product was collected and detected by 1.5% agarose gel electrophoresis (FIG. 9).

TABLE 2 design of primer sequences for genes to be cloned

The verified colonies were sent to a commercial company for sequencing. Sequencing results the sequencing results were verified using NCBI BLAST (http:// BLAST. NCBI. nlm. nih. gov/BLAST. cgi) (FIGS. 10, 11). The result shows that the matching rate of nucleotide sequence alignment reaches 99%, and the matching rate of protein sequence alignment reaches 100%.

Construction of binary expression vector plasmid and agrobacterium transformation. Extracting with plasmid extraction kit (Transgen)The plasmid DNA was digested with restriction enzymes KpnI and XbaI (TaKaRa) at 37 ℃ to double-cleave the expression vector pCAM2300 plasmid (FIG. 12). The 50. mu.L double enzyme digestion system is: 30 μ L of plasmid +0.5 μ L KpnI +0.5 μ L XbaI +5 μ L Buffer +14 μ L ddH₂And O. The pEASY-Blunt vector ligated with the objective fragment was subjected to double digestion using the same endonuclease (FIG. 13). Recovering the gene fragment and the expression vector after enzyme digestion, and connecting the recovered product by T4 ligase at 16 ℃ for 16 h. Coli, positive clones were screened by colony PCR (fig. 14). Transformed Agrobacterium GV3101 competent cells were verified (FIG. 15), and positive cloning plasmids were extracted (FIG. 16).

4. Transient overexpression verification of gene function

(1) Transient overexpression. The over-expression vector 2300-31477-GV3101 is injected into the 3 rd stage of strawberry fruit development, and agrobacterium containing the constructed plasmid pCAM2300 is slowly injected from the fruit stalk to the central part of the fruit in the way shown in the figure (FIG. 17), so that the agrobacterium infiltrates the whole fruit during injection.

(2) Fruit sugar changes were analyzed by HPLC. Samples of treated and control strawberry fruits were collected 3 weeks after the transient infestation (table 3, table 4, fig. 18, fig. 19), respectively. The experimental result shows that the sugar content in the fruit is compared with the control, and the difference reaches an extremely significant level. The treatment increased fructose by 45.5%, and increased glucose and sucrose contents (FIG. 20).

TABLE 3 sugar content in fruits after overexpression vector injection

	Retention time (minutes)	Area (microvolt seconds)	Area%	Height (microvolt)	Integral type
						1	10.202	22211	51.53	1400	bb
2	13.217	12825	29.75	416	bb
						3	22.015	8070	18.72	267	bb

TABLE 4 content of sugar in control CK strawberry fruit

	Retention time (minutes)	Area (microvolt seconds)	Area%	Height (microvolt)	Integral type
						1	10.176	15943	55.02	986	bb
2	13.224	8935	30.84	296	bb
						3	21.944	4098	14.14	131	bb

The above are merely embodiments of the present invention, which are described in detail and with particularity, and therefore should not be construed as limiting the scope of the invention. It should be noted that, for those skilled in the art, various changes and modifications can be made without departing from the spirit of the present invention, and these changes and modifications are within the scope of the present invention.

Sequence listing

Horticulture Research Institute of Anhui Academy of Agricultural Sciences

Method for increasing sugar content in strawberry fruits

tcgatcgagtttctgatgaggtgctctggatcttaatctgccagattattttactaaatttctaaaactggagggctgtaatttgtctgtattaccaaga ttccggctaagctagtcctcacaactcttgcagttttaagatatttacctgaggctgacctgttgctgttagctgtatattgtcttcaaaggcctctcct ttttatttcatttcagttgagggtgctcaatgctcaaattcacagttgggaagctctgaactttgccaagcctcactggcctgaagaggtttgattgaga ttgggggtttctttcattccttcattggtgaaaacatgaagggggctgtgtttgtggccattgctgccacaattggtaactttctgcaaggatgggacaa tgctacaattgctggggctattgtttacatcacggatgattttgctttggatagctcggtagaaggtcttgttgtggccatgtcactcatcggggcaaca gttattacaacatgctcaggagcggtatcagattggcttggtcggcgcccaatgctaataacatcatcagttctttattttgtgagtggcttggtgatgt tgtggtcacccaatgtgtatgtcctatgtatagcaaggctgttagatggatttggaattg gtctagcagt tactcttgtt ccagtctaca tatccgagac tgccccatcagatataaggggatcattgaatactcttccacagttccttggttcaggaggcatgtttttgtcatactgtatggtttttgggatgtcactg ttggcctcgccaagctggagactgatgcttggggtcctttccattctctctctaatatattttgtattaaccgtgttttacttgcctgaatctcctcgat ggcttgtgagtaagggcaggatgcttgaagcaaaaaaggttcttcagatgttgcgtggcactgaagatgtttctggtgagatggctttgcttgtcgaaggtcttggagttggaggtgaaacatctttagaagagtacatcataggcgcagctgatgatcttgatggtcaggaagcagctgacaaggacaa aatcaagttatatggacccgaagaaggcctttcctgggttgccagacctgtaactgggcagggttctattgtcagtcttgtgtctcgccaggaagcatg gcaacacagaatgtgcctctaatggatcctcttgtcactctcttcggtagtgtccatgaaaatttccccgaggcagggagtacgcggggaagcatgctct tttctaactt tggcagcatg ttcagcacag cagatcatcc acggggtaaa accgaacaat gggatgaaga gagcttgcat agggaaggtg aggactatgcatctgggggagactcggatgacaatctgcacagtcctttgatttcacgccagacaacaagtatggaaaaggatatggtgccacctcctccttctcatggtagtgttctaggcatgaggcgcaacagcagtctcatgcaaggaactggggagacagttggtagcacaggcattggtggtgg atggcagttggcatggaaatggtctgagagacagggcgaagatggaaagaaggaaggaggattccagagggtatatttgcaccaggaggg agtccccggctcacgtcgtgggtctcttgtgtcacttcctggtagtgatgttcctgcagaaggtgaattcatccaggcagctgctctggttagtcagcct gctctgtactcaaaatcacttatagatcagcatcctattggacctgcaatggttcatccatcagaaacagcttcgaaaggaccaatgtggtctgctctgc ttgaaccagggattaagcatgcattgtttgttggaattggaatccagattcttcagcagttttctgggattaatggagttctctattacactcctcaaat tcttgaagaggcaggagtttcagttcttctttcaaacttgggtctcagtacaacatctgcatctttcctcatcagtgcatttacaactttgttgatgctt ccttgtatagctctagccatgaagctcatggatatcgctggtagaaggatgctgctactgtctacacttcctgtgttgatagtgtccctt attcttcttgtcattgccaacttagtaagcctaagttcagtcgttgaagccgccatatcaaccacttgcgtggtgatctatttctgcgtttttgtcatgg cctacgggccaatcccaaatatcctctgctctgagatttttccgacaagggtgcgtggactctgcatcgccatctgtgctctggtgtactggatttcaga cattatcatcacctactcgctaccggttctgcttgattcaataggcttggctggtatctttgggctctatgccattgtttgtgtcatctctttggttttt atctacttgaaggttccagaaaccaaaggcatgccccttgaagtcatcactgaattcttttctgttggtgcaagacaaattgctgctgccaaaaatgagt aatcaagaacagttggctacttcatcagttttggggttctccatcttgtgtgaggagattttgttccacgcatttgaatattccaaaaggctgattcttc aatttttgattgtgtatgataaacaagattattttggagattatactataattactaaaagcttagaagagatgctgtccttatttaaaataagcattct agctagagtcaatatggcgg aatttgtcat ttttgctggt tcaattacac agttt

Claims

1. A method for increasing sugar content in strawberry fruit is characterized in that coded strawberry polysaccharide

The gene of the polyalcohol/monosaccharide transport protein is introduced into the objective strawberry fruit for instantaneous over-expression to obtain the strawberry fruit with high sugar content;

2. The method according to claim 1, wherein the gene encoding a strawberry polyol/monosaccharide transporter is introduced into the strawberry fruit via a recombinant vector; the recombinant vector is obtained by inserting the DNA molecule shown in the sequence 1 in the sequence table into the multiple cloning site of the pCAM2300 plasmid and transforming the competent cell of the agrobacterium GV3101, so as to obtain the over-expression vector 2300-31477-GV 3101.

3. The method of claim 2, wherein the primer sequence of the gene encoding a strawberry polyol/monosaccharide transporter is:

5′–3′ ATGAAGGGGGCTGTGTTTGTGG

3′–5′ TTACTCATTTTTGGCAGCAGCAATT。

4. the method of claim 2, wherein the pCAM2300 plasmid is digested simultaneously with the restriction enzymes KpnI and XbaI.

5. The method of claim 2, wherein the gene encoding the strawberry polyol/monosaccharide transporter is double digested with restriction enzyme KpnI and restriction enzyme XbaI.

6. The method according to claim 2, wherein the gene encoding the strawberry polyol/monosaccharide transporter and the pCAM2300 plasmid are ligated with T4 ligase at 16 ℃ for 16 h.

7. The method of claim 1, wherein the transient overexpression process is: the over-expression vector 2300-31477-GV3101 is injected into the strawberry fruit and slowly injected from the fruit stem to the central part of the fruit.

8. The method according to claim 7, wherein the transient overexpression operation is performed at stage 3 of strawberry fruit development.