CN108949926A

CN108949926A - A kind of detection method based on digital pcr platform EGFR gene Exon19 deletion mutation

Info

Publication number: CN108949926A
Application number: CN201810879707.2A
Authority: CN
Inventors: 张丽英
Original assignee: Individual
Current assignee: Individual
Priority date: 2018-08-03
Filing date: 2018-08-03
Publication date: 2018-12-07

Abstract

The invention discloses a kind of detection architectures based on digital pcr platform EGFR gene Exon19 deletion mutation.This method is to lack to carry out abrupt climatic change to EGFR gene Exon19 based on ABI QuantStudio 3D digital pcr system.The present invention can obtain good testing result using the differentiation wild type of MGB probe specificity and the sample of saltant type in the sample of low abundance and muting sensitivity simultaneously, and assay reproducibility can be good, and error is small, be the advantage technology of with detecting low abundance mutant proportion.

Description

A kind of detection method based on digital pcr platform EGFR gene Exon19 deletion mutation

Technical field

The present invention relates to biological detecting method technical fields, and in particular to one kind is based on digital pcr platform EGFR gene The detection method of Exon19 deletion mutation.

Background technique

Since round pcr is since the 1980s is by invention, this method has become life science field In one of most basic and most conventional experimental method.The traditional round pcr of the first generation using the method for agarose gel electrophoresis come PCR product is analyzed, but this method is primarily adapted for use in quantitative and semi-quantitative research.Go out at the beginning of 2 () century 9 () ages Quantitative PCR (quantitative PCR, the qPCR) technology for having showed the second generation, by the way that fluorescent dye is added in reaction method, The fluorescence signal issued in detection reaction reaches the recurring number i.e. cycle threshold (cycle threshold, Ct) of threshold value to calculate The content of purpose acid sequence.QPCR technology is still widely made by each laboratory at present because of its quick, simple and economic feature With.But qPCR technology it is so-called it is " quantitative " be still it is opposite, depend on Ct value and standard curve.QPCR is in aim sequence content It is low, expression difference is very small, in reaction method containing when a large amount of background sequences or mortifier, sensitivity and accuracy All it is very limited.In this background, third generation PCR --- digital pcr (digitalPCR, dPCR) comes into being. The principle of digital pcr be dPCR reaction method is evenly distributed in a large amount of reaction members, do not include in each reaction member or Multiple purpose nucleic acid sequences are arrived comprising one, the quantity of purpose nucleic acid sequence meets Poisson distribution.Then in each reaction member In independently carry out PCR amplification.After amplification, detect the fluorescence signal of each reaction member, finally according to Poisson distribution and The reaction member of the fluorescence signal positive accounts for the ratio of all reaction members to calculate the copy number of purpose nucleic acid sequence.It is anti-in dPCR Answer the generation process of middle fluorescence signal substantially identical as qPCR.DPCR technology qPCR technology has advantage below: (1) Gao Ling Sensitivity.One traditional PCR reaction is substantially become tens of thousands of a PCR and reacted by dPCR, is divided in this tens of thousands of a reaction member Other independent detection aim sequence, to substantially increase the sensitivity of detection.(2) pinpoint accuracy.DPCR is by calculating tens of thousands of Positive numbe rof reactor unit amount and ratio, can accurately detect out the aim sequence difference varied less in a reaction member.(3) Height endurability.The process of dPCR technology first step reaction method distribution, can make background sequence and PCR response inhabitation object uniform It is assigned to each reaction member, and in most of reaction member and does not contain aim sequence, low-abundance aim sequence is opposite It is enriched in certain reaction members, reaction is done to reduce background sequence and mortifier in these reaction members significantly It disturbs.In addition, dPCR only judges male/female two states when carrying out result interpretation to each reaction member, independent of Ct Value, is influenced to be greatly lowered, also be greatly improved to the tolerance of background sequence and mortifier by amplification efficiency.(4) absolutely fixed Amount.PCR directly calculates the copy number of aim sequence, and needing not rely upon ct value and standard curve can be carried out accurately absolutely determining Amount detection.

EGFR (epidermal growth factor receptor, referred to as EGFR, ErbB-1 or HER1) is epidermis One of growth factor receptors (HER) family member.The family includes HER1 (erbB1, EGFR), HER2 (erbB2, NEU), HER3 (erbB3) and HER4 (erbB4).HER family plays important adjustment effect in cellular physiological processes.EGFR is distributed widely in The cell surfaces such as mammalian epithelial cell, fibroblast, spongiocyte, horn cell, EGFR signal path is to cell The physiology courses such as growth, proliferation and differentiation play an important role.3rd area EGFR Fen Wei: extracellular ligand binding domain, transmembrane region and Intracellular kinase area.Research shows that high expression or unconventionality expression in many entity tumors there are EGFR.EGFR and tumour cell Proliferation, angiogenesis, tumor invasion, transfer and the inhibition of Apoptosis it is related.Its mechanism has: the high expression of EGFR is drawn Play the enhancing of downstream signal transduction；The increase of mutant egf R receptor or ligand expression leads to the continuous activation of EGFR；Autocrine The effect of ring enhances；The destruction of receptor down-regulated mechanism；The activation etc. of abnormal signal conduction path.The overexpression of EGFR is pernicious swollen It plays an important role in the evolution of tumor, has in the tissue such as spongiocyte, kidney, lung cancer, prostate cancer, cancer of pancreas, breast cancer The overexpression of EGFR.It is mainly related with its gene magnification to the high expression of the research discovery EGFR of spongiocytoma.But sometimes After the dysregulation of EGFR expression exists in translation and translation.After high expression of the EGFR in tumour is also possible to and activates Degradation reduction is related, and some researchs point out that c-Src can be by inhibiting receptor ubiquitination and endocytosis raise EGFR level.Perhaps With the presence of mutant egf R in more tumours, it has now been found that many kinds of EGFR saltant types.The effect of mutant egf R may include: tool There is the cell continuous activation of ligand independent form receptor；Since certain structural domains of EGFR lack and lead to receptor down-regulated mechanism Destruction, the activation of abnormal signal conduction path, inhibition of Apoptosis etc..The generation of mutant is lacking due to EGFR gene It loses, be mutated and reset.The ligand of EGFR has a significant impact to Cellular Signaling Transduction Mediated.The ligand of EGFR is swashed by autocrine form EGFR living promotes cell Proliferation, their coexpression often indicates that tumor prognosis is bad, for example, in infiltration ductal carcinomas of breast It is found in research, TGFα and EGFR are co-expressed, and this coexpression is significant related to the survival rate of patient.Kopp et al. to knot/ The carcinoma of the rectum research shows that the autocrine growth of tumour is the overexpression and its coefficient result of ligand expression of EGFR.

Summary of the invention

In view of the above-mentioned problems existing in the prior art and demand, it is flat based on digital pcr that the object of the present invention is to provide one kind The detection method of platform EGFR gene Exon19 deletion mutation, using low abundance recall rate, the high sensitivity, height of digital pcr platform The advantage of specificity improves the detection performance to gene mutation site, to better meet the requirement of scientific research and clinic.

Technical solution: to achieve the goals above, the present invention provides a kind of based on digital pcr platform EGFR gene Exon19 The detection method of deletion mutation: the detection method includes the following steps:

(1) prepare digital pcr reaction mixture: the sample containing genes DNA template to be detected, the site EGFR gene Exon19 are just TaqMan probe, reference gene B2M forward and reverse are marked to reversed amplimer, EGFR gene Exon19 deletion segment Amplimer, reference gene B2M label TaqMan probe and the mixing of PCR reaction premixed liquid, are prepared digital pcr reaction Mixed liquor；

(2) digital pcr reaction chip is prepared；

(3) digital pcr amplification program is carried out；

(4) reading of pcr chip fluorescence signal is carried out；

(5) data analysis and result statistics.

Preferably, the EGFR gene Exon19 deletion segment forward and reverse amplimer packet designed in the step (1) Include the specific primer pair for expanding POLE gene, the specific primer is to including a forward primer SEQ ID Nos:1 With the sequence of reverse primer SEQ ID Nos:2, forward primer SEQ ID a Nos:1 are as follows: The sequence of CAGAAGGTGAGAAAGTTAAAATTC, reverse primer SEQ ID Nos:2 are as follows: CATCGAGGATTTCCTTGTTG.

Preferably, in the step (1) EGFR gene Exon19 deletion segment label TaqMan probe include two can be with Probe SEQ ID Nos:3 and SEQ ID Nos:4, probe the SEQ ID of the absent region specific hybrid EGFR gene Exon19 Nos:3 specific hybrid wild-type amplification product, the sequence of SEQ ID Nos:3 are as follows: GCTTCTCTTAATTCCT；Probe SEQ ID Nos:4 specific hybrid saltant type amplified production, the sequence of SEQ ID Nos:4 are as follows: GCTATCAAAACATCT.

Preferably, the reference gene forward and reverse amplimer designed in the step (1) includes for expanding internal reference The specific primer pair of gene B2M, the specific primer is to reversed comprising a forward primer SEQ ID Nos:5 and one The sequence of primer SEQ ID Nos:6, forward primer SEQ ID Nos:5 are as follows: CACTGAATTCACCCCCACTG, reverse primer The sequence of SEQ ID Nos:6 are as follows: AAGCAGAATTTGGAATTCATCC.

Preferably, the reference gene label TaqMan probe in the step (1) can be in specific hybrid comprising one Join the probe SEQ ID Nos:7 of gene B2M amplification region, probe SEQ ID Nos:7 sequence are as follows: ATGGAGGTTTGAAGA.

Preferably, the spy of EGFR gene Exon19 deletion segment SEQ ID Nos:3 specific hybrid wild-type amplification product The fluorescein of needle label is VIC, and the amplification of EGFR gene Exon19 deletion segment SEQ ID Nos:4 specific hybrid saltant type produces The fluorescein of the probe label of object is FAM.

Preferably, it is ROX that reference gene B2M, which marks the fluorescein of TaqMan probe label,.

Preferably, the digital pcr amplification program of the step (3) are as follows: 95 DEG C of thermal startings, 10 minutes；94 DEG C of denaturation, 30 Second；60 DEG C of annealing, 60 seconds；Expand 40 circulations；98 DEG C of enzyme inactivations, 10 minutes；4 DEG C of heat preservations.

Compared with prior art, the invention has the following beneficial effects:

(1) detection method of the present invention based on digital pcr platform EGFR gene Exon19 deletion mutation is sensitive in detection Degree aspect increases significantly compared with conventional method, and when previous traditional fluorescence quantitative PCR detection gene mutation is minimum to be can detecte To 1% mutant proportion, and its lowest detection ratio can achieve the present invention is based on the detection method of digital pcr platform development 0.1%, there is very big advantage in the low detection demand of mutant proportion.

(2) detection method of the present invention based on digital pcr platform EGFR gene Exon19 deletion mutation has exhausted To quantitative advantage, conventional fluorescent quantitative PCR is the detection method for belonging to relative quantification, needs to be taken according to standard curve and calculates The concentration of sample to be tested, and the bright detection method based on digital pcr platform EGFR gene Exon19 deletion mutation of this law is a kind of The detection method of absolute quantitation, directly prompt in testing result sample to be examined concentration and the corresponding sample containing mutated gene This quantity, to count mutant proportion.

(3) detection method of the present invention based on digital pcr platform EGFR gene Exon19 deletion mutation operates letter Single, high with the compatibility of conventional fluorescent quantitative PCR technique, as a result detection consistency is good, application value with higher.

Detailed description of the invention

Fig. 1 is the digital pcr testing result figure of sample01；

Fig. 2 is the digital pcr testing result figure of sample02.

Specific embodiment

It is of the invention below by way of combining following specific embodiments to further illustrate.It should be pointed out that real in detail below It applies mode for explaining only the invention, is not used to be defined the contents of the present invention.

A kind of detection method based on digital pcr platform EGFR gene Exon19 deletion mutation, which is characterized in that the inspection Survey method includes the following steps:

(2) digital pcr reaction chip is prepared；

(3) digital pcr amplification program is carried out；

(4) reading of pcr chip fluorescence signal is carried out；

(5) data analysis and result statistics.

Detection method of the present invention based on digital pcr platform EGFR gene Exon19 deletion mutation is mainly based upon The method that digital pcr platform detects EGFR gene Exon19 deletion segment.According to the Statistics of digital pcr, we Method can detecte the sample of low-abundance sample size and low mutant proportion.First choice is based on EGFR gene Exon19 deletion segment Sequence design a pair of specific amplification primer pair, while absent region design two TaqMan probes, respectively by with Wild type and the hybridization of saltant type amplified production, obtain fluorescence signal.Letter is further carried out to reaction chip by CCD imaging technique It number collects, eventually passes through software calculating, wild-type probe signal and saltant type probe are believed using the Statistics of Poisson distribution Number carry out data statistics calculating, finally obtain the concentration information of sample to be examined, mutant proportion information.

The digital pcr platform involved in the present invention arrived is ABI QuantStudio 3D digital pcr system, is used Experiment reagent be the matched pcr amplification reaction method of the platform.

Below by embodiment, the present invention is furture elucidated.It should be pointed out that the present invention is not intended to be limited to the reality Apply example.

Embodiment 1

(1) patient's extracting genome DNA

Extracting genome DNA operation is carried out to the tumor sample of patient in Biohazard Safety Equipment.Using QIAamp DNA FFPE Tissue Kit (Qiagen Cat No:56404) extracts experiment.

(2) design of primers

Design of primers is carried out for Human epidermal growth factor receptor gene Exon19 deletion segment, respectively for a pair of of specificity of this site design PCR primer and two hybridization probes are respectively used to hybridization wild-type amplification product and saltant type amplified production, while according to internal reference The sequence design pair for amplification primer of gene B2M, while hybridization probe is marked with ROX.Designed PCR primer and probe sequence As shown in table 1.

Table 1

Primer	Sequence number	5'-3'
			EGFR-Exon19-F	SEQ ID Nos 1	CAGAAGGTGAGAAAGTTAAAATTC
EGFR-Exon19-R	SEQ ID Nos 2	CATCGAGGATTTCCTTGTTG
			EGFR-Exon19-WT	SEQ ID Nos 3	VIC-GCTTCTCTTAATTCCT-MGB
EGFR-Exon19-MT	SEQ ID Nos 4	FAM-GCTATCAAAACATCT-MGB
			B2M-F	SEQ ID Nos 5	CACTGAATTCACCCCCACTG
B2M-R	SEQ ID Nos 6	AAGCAGAATTTGGAATTCATCC
			B2M-T	SEQ ID Nos 7	ROX-ATGGAGGTTTGAAGA-MGB

(3) specific PCR reacts

The target fragment comprising EGFR gene Exon19 deletion segment is amplified using specific PCR technology, according to the reaction of table 2 Method prepares amplified reaction, and reaction method is expanded after the completion of preparing according to the response procedures of table 3.

Table 2

Table 3

(4) reading of pcr chip fluorescence signal is carried out:

Chip after reaction, is put into the card slot of reading data by PCR, and push-in, instrument is read automatically；Screen shows read access time After, chip can be directly taken out.If primary experiment detects multiple samples, can take out after a chip directly It is put into next chip to be read, until after last chip is read, all chips of reading before analyzing together. After all chip analysis are complete, data are exported to USB.

(5) data analysis and result statistics:

Pcr chip detection data is directed on the Cloud Server of Thermo, using cloud processing software, detection data is carried out Analysis.It needs to register user account before data analysis, can freely be used after completing register flow path.

The analysis result of the present embodiment is as shown in table 4, table 5 and Fig. 1, Fig. 2.The present embodiment pattern detection two different FFPE sample, is denoted as Sample01 and Sample02 respectively.Its testing result is that Sample01 is wild type sample, in EGFR base Because Exon19 deletion segment is there is no deletion mutation, Sample02 is saltant type sample, lacks position in EGFR gene Exon19 Deletion mutation occurs for point, and mutant proportion is 0.37%, and the valid data of whole reaction chip are respectively 14709/15213, wherein Saltant type valid data are 0/11, and wild type valid data are 2201/3146, almost the same with practical 10 ng of PCR applied sample amount.

Table 4

Assay	Sample	Target/Total	Copies/microliter (VIC)	Copies/microliter (FAM)
					FAMVIC	Sample01	0%	185	0
FAMVIC	Sample02	0.37%	181.42	0.668

Table 5

Chip	#FAM	#VIC	#FAMVIC	#Undetermined	#NOAMP
						Sample01	0	2201	0	0	14709
Sample02	11	3146	7	0	15213

The embodiments described above only express several embodiments of the present invention, and the description thereof is more specific and detailed, but can not Therefore it is construed as limiting the scope of the patent.It should be pointed out that for those of ordinary skill in the art, Under the premise of not departing from present inventive concept, various modifications and improvements can be made, and these are all within the scope of protection of the present invention.

Claims

1. a kind of detection method based on digital pcr platform EGFR gene Exon19 deletion mutation, which is characterized in that the detection Method includes the following steps:

(2) digital pcr reaction chip is prepared；

(3) digital pcr amplification program is carried out；

(4) reading of pcr chip fluorescence signal is carried out；

(5) data analysis and result statistics.

2. the detection method according to claim 1 based on digital pcr platform EGFR gene Exon19 deletion mutation, special Sign is that the EGFR gene Exon19 deletion segment forward and reverse amplimer designed in the step (1) includes for expanding Increase the specific primer pair of POLE gene, the specific primer is to anti-comprising a forward primer SEQ ID Nos:1 and one To primer SEQ ID Nos:2, the sequence of forward primer SEQ ID Nos:1 are as follows: CAGAAGGTGAGAAAGTTAAAATTC, reversely The sequence of primer SEQ ID Nos:2 are as follows: CATCGAGGATTTCCTTGTTG.

3. the detection method according to claim 1 based on digital pcr platform EGFR gene Exon19 deletion mutation, special Sign is that EGFR gene Exon19 deletion segment label TaqMan probe can be specific miscellaneous comprising two in the step (1) Hand over probe SEQ ID Nos:3 and SEQ the ID Nos:4, probe SEQ ID Nos:3 of the absent region EGFR gene Exon19 special Property hybridization wild-type amplification product, the sequence of SEQ ID Nos:3 are as follows: GCTTCTCTTAATTCCT；Probe SEQ ID Nos:4 is special Specific hybridization saltant type amplified production, the sequence of SEQ ID Nos:4 are as follows: GCTATCAAAACATCT.

4. the detection method according to claim 1 based on digital pcr platform EGFR gene Exon19 deletion mutation, special Sign is that the reference gene forward and reverse amplimer designed in the step (1) includes for expanding reference gene B2M Specific primer pair, the specific primer is to including a forward primer SEQ ID Nos:5 and a reverse primer SEQ ID The sequence of Nos:6, forward primer SEQ ID Nos:5 are as follows: CACTGAATTCACCCCCACTG, reverse primer SEQ ID Nos:6 Sequence are as follows: AAGCAGAATTTGGAATTCATCC.

5. the detection method according to claim 1 based on digital pcr platform EGFR gene Exon19 deletion mutation, special Sign is that the reference gene label TaqMan probe in the step (1) can be with specific hybrid reference gene B2M comprising one The probe SEQ ID Nos:7 of amplification region, probe SEQ ID Nos:7 sequence are as follows: ATGGAGGTTTGAAGA.

6. the detection method according to claim 3 based on digital pcr platform EGFR gene Exon19 deletion mutation, special Sign is, the probe label of EGFR gene Exon19 deletion segment SEQ ID Nos:3 specific hybrid wild-type amplification product Fluorescein is VIC, the probe of EGFR gene Exon19 deletion segment SEQ ID Nos:4 specific hybrid saltant type amplified production The fluorescein of label is FAM.

7. the detection method according to claim 5 based on digital pcr platform EGFR gene Exon19 deletion mutation, special Sign is that it is ROX that reference gene B2M, which marks the fluorescein of TaqMan probe label,.

8. the detection method according to claim 1 based on digital pcr platform EGFR gene Exon19 deletion mutation, special Sign is, the digital pcr amplification program of the step (3) are as follows: 95 DEG C of thermal startings, 10 minutes；94 DEG C of denaturation, 30 seconds；60 DEG C are moved back Fire, 60 seconds；Expand 40 circulations；98 DEG C of enzyme inactivations, 10 minutes；4 DEG C of heat preservations.